Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A204N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86G402N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GCTN000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS729N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HT1080N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYM1N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RH41N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RKNN000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86S117N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SJRH30N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKLMS1N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKUT1N000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE159TN000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE441TN000N
AKAP12AIEEDLEPESOFT_TISSUE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE617TN000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A204N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86G402N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GCTN000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS729N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HT1080N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYM1N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RH41N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RKNN000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86S117N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SJRH30N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKLMS1N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKUT1N000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE159TN000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE441TN000N
AKAP12EEDLEPENGSOFT_TISSUE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE617TN000N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A204N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86G402N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GCTN200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS729N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HT1080N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYM1N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RH41N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RKNN200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86S117N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SJRH30N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKLMS1N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKUT1N200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE159TN200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE441TN200N
AKAP12IEEDLEPENSOFT_TISSUE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE617TN200N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A204N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86G402N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86GCTN000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS729N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HT1080N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86KYM1N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RH41N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86RKNN000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86S117N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SJRH30N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKLMS1N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKUT1N000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE159TN000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE441TN000N
AKAP12KVSVAIEEDSOFT_TISSUE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TE617TN000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A204N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86G402N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GCTN000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS729N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HT1080N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYM1N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RH41N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RKNN000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86S117N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SJRH30N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKLMS1N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKUT1N000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE159TN000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE441TN000N
AKAP12SVAIEEDLESOFT_TISSUE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE617TN000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A204N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86G402N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86GCTN000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS729N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HT1080N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86KYM1N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RH41N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86RKNN000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86S117N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SJRH30N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKLMS1N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKUT1N000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE159TN000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE441TN000N
AKAP12VAIEEDLEPSOFT_TISSUE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TE617TN000N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A204N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86G402N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86GCTN002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS729N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HT1080N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86KYM1N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RH41N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86RKNN002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86S117N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SJRH30N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKLMS1N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKUT1N002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE159TN002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE441TN002N
AKAP12VKVSVAIEESOFT_TISSUE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TE617TN002N
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A204N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86G402N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86GCTN1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS729N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HT1080N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86KYM1N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RH41N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86RKNN1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86S117N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SJRH30N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKLMS1N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKUT1N1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE159TN1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE441TN1500Y
AKAP12VSVAIEEDLSOFT_TISSUE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TE617TN1500Y
AKAP12KKRVRWPSESOFT_TISSUE620p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N100N
AKAP12KRVRWPSESSOFT_TISSUE621p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N200N
AKAP12PKKRVRWPSSOFT_TISSUE619p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N000N
AKAP12RVRWPSESDSOFT_TISSUE622p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N000N
AKAP12RWPSESDKESOFT_TISSUE624p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N000N
AKAP12TPKKRVRWPSOFT_TISSUE618p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N200N
AKAP12VRWPSESDKSOFT_TISSUE623p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N200N
AKAP12VTPKKRVRWSOFT_TISSUE617p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N301N
AKAP12WPSESDKEDSOFT_TISSUE625p.R625Wc.1873C>TMissense_Mutation10.22SJRH30N300N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27G401N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27G402N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS729N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYM1N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RDN000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RH41N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SJRH30N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKLMS1N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKUT1N000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE441TN000N
AKAP9DLEKTKQLESOFT_TISSUE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE617TN000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27G401N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27G402N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS729N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYM1N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RDN000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RH41N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SJRH30N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKLMS1N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKUT1N000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE441TN000N
AKAP9EKTKQLEEQSOFT_TISSUE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE617TN000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27G401N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27G402N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS729N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYM1N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RDN000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RH41N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SJRH30N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKLMS1N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKUT1N000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE441TN000N
AKAP9KQLEEQVQESOFT_TISSUE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE617TN000N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27G401N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27G402N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS729N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27KYM1N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27RDN200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27RH41N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SJRH30N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SKLMS1N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SKUT1N200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TE441TN200N
AKAP9KTKQLEEQVSOFT_TISSUE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27TE617TN200N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27G401N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27G402N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS729N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYM1N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RDN000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RH41N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SJRH30N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKLMS1N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKUT1N000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE441TN000N
AKAP9LEKTKQLEESOFT_TISSUE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE617TN000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27G401N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27G402N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS729N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYM1N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RDN000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RH41N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SJRH30N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKLMS1N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKUT1N000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE441TN000N
AKAP9LQDLEKTKQSOFT_TISSUE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE617TN000N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27G401N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27G402N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS729N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27KYM1N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RDN900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27RH41N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SJRH30N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKLMS1N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKUT1N900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE441TN900N
AKAP9QDLEKTKQLSOFT_TISSUE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27TE617TN900N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27G401N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27G402N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS729N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27KYM1N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RDN1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27RH41N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SJRH30N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKLMS1N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKUT1N1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE441TN1200N
AKAP9QLEEQVQELSOFT_TISSUE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27TE617TN1200N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27G401N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27G402N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS729N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27KYM1N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RDN000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27RH41N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SJRH30N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKLMS1N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKUT1N000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE441TN000N
AKAP9TKQLEEQVQSOFT_TISSUE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27TE617TN000N
AKAP9ALTLGISELSOFT_TISSUE2603p.R2607Gc.7819A>GMissense_Mutation10.11G401Y10100N
AKAP9ATESLECQESOFT_TISSUE1889p.K1894Ec.5680A>GMissense_Mutation10.11RDN000N
AKAP9AVSESMVPPSOFT_TISSUE1374p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN000N
AKAP9DISALTLGISOFT_TISSUE2600p.R2607Gc.7819A>GMissense_Mutation10.11G401N300N
AKAP9EATESLECQSOFT_TISSUE1888p.K1894Ec.5680A>GMissense_Mutation10.11RDN000N
AKAP9ECQEELRERSOFT_TISSUE1894p.K1894Ec.5680A>GMissense_Mutation10.11RDN300Y
AKAP9ELMHESFRQSOFT_TISSUE1877p.R1880Hc.5639G>AMissense_Mutation10.11HS729N000N
AKAP9ESLECQEELSOFT_TISSUE1891p.K1894Ec.5680A>GMissense_Mutation10.11RDY15100N
AKAP9ESMVPPSLPSOFT_TISSUE1377p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN000N
AKAP9GISELESQVSOFT_TISSUE2607p.R2607Gc.7819A>GMissense_Mutation10.11G401N300N
AKAP9HESFRQKQESOFT_TISSUE1880p.R1880Hc.5639G>AMissense_Mutation10.11HS729N000N
AKAP9ISALTLGISSOFT_TISSUE2601p.R2607Gc.7819A>GMissense_Mutation10.11G401N000N
AKAP9KQEATESLESOFT_TISSUE1886p.K1894Ec.5680A>GMissense_Mutation10.11RDN000N
AKAP9KVTQTELMHSOFT_TISSUE1872p.R1880Hc.5639G>AMissense_Mutation10.11HS729N100N
AKAP9LECQEELRESOFT_TISSUE1893p.K1894Ec.5680A>GMissense_Mutation10.11RDN000Y
AKAP9LGISELESQSOFT_TISSUE2606p.R2607Gc.7819A>GMissense_Mutation10.11G401N006N
AKAP9LMHESFRQKSOFT_TISSUE1878p.R1880Hc.5639G>AMissense_Mutation10.11HS729N200N
AKAP9LQAVSESMVSOFT_TISSUE1372p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN800N
AKAP9LTLGISELESOFT_TISSUE2604p.R2607Gc.7819A>GMissense_Mutation10.11G401N000N
AKAP9MHESFRQKQSOFT_TISSUE1879p.R1880Hc.5639G>AMissense_Mutation10.11HS729N000N
AKAP9MVPPSLPVDSOFT_TISSUE1379p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN000N
AKAP9QAVSESMVPSOFT_TISSUE1373p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN000N
AKAP9QEATESLECSOFT_TISSUE1887p.K1894Ec.5680A>GMissense_Mutation10.11RDN500N
AKAP9QTELMHESFSOFT_TISSUE1875p.R1880Hc.5639G>AMissense_Mutation10.11HS729N300N
AKAP9RLQAVSESMSOFT_TISSUE1371p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN500N
AKAP9SALTLGISESOFT_TISSUE2602p.R2607Gc.7819A>GMissense_Mutation10.11G401N000N
AKAP9SDISALTLGSOFT_TISSUE2599p.R2607Gc.7819A>GMissense_Mutation10.11G401N200Y
AKAP9SESMVPPSLSOFT_TISSUE1376p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN700N
AKAP9SLECQEELRSOFT_TISSUE1892p.K1894Ec.5680A>GMissense_Mutation10.11RDN600N
AKAP9SMVPPSLPVSOFT_TISSUE1378p.T1379Mc.4136C>TMissense_Mutation10.11TE159TY890N
AKAP9TELMHESFRSOFT_TISSUE1876p.R1880Hc.5639G>AMissense_Mutation10.11HS729N000N
AKAP9TESLECQEESOFT_TISSUE1890p.K1894Ec.5680A>GMissense_Mutation10.11RDN000N
AKAP9TLGISELESSOFT_TISSUE2605p.R2607Gc.7819A>GMissense_Mutation10.11G401N000N
AKAP9TQTELMHESSOFT_TISSUE1874p.R1880Hc.5639G>AMissense_Mutation10.11HS729N000N
AKAP9VSESMVPPSSOFT_TISSUE1375p.T1379Mc.4136C>TMissense_Mutation10.11TE159TN100N
AKAP9VTQTELMHESOFT_TISSUE1873p.R1880Hc.5639G>AMissense_Mutation10.11HS729N000N
ALKGVSLQSLPQSOFT_TISSUE1184p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1N000N
ALKLPQFILLELSOFT_TISSUE1190p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1Y21103N
ALKLQSLPQFILSOFT_TISSUE1187p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1N1305N
ALKPQFILLELMSOFT_TISSUE1191p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1N200N
ALKQFILLELMASOFT_TISSUE1192p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1N100N
ALKQSLPQFILLSOFT_TISSUE1188p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1Y17100N
ALKSLPQFILLESOFT_TISSUE1189p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1N100N
ALKSLQSLPQFISOFT_TISSUE1186p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1N700N
ALKVSLQSLPQFSOFT_TISSUE1185p.R1192Qc.3575G>AMissense_Mutation10.11SKUT1N500N
ALPK2AADKRVGGRSOFT_TISSUE515p.K523fsc.1568_1568delAFrame_Shift_Del10.55SKUT1N400N
ALPK2ADKRVGGRTSOFT_TISSUE516p.K523fsc.1568_1568delAFrame_Shift_Del20.55SKUT1N200N
ALPK2ARGVQGNLPSOFT_TISSUE527p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1N100N
ALPK2DKRVGGRTYSOFT_TISSUE517p.K523fsc.1568_1568delAFrame_Shift_Del30.55SKUT1N200N
ALPK2GARGVQGNLSOFT_TISSUE526p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1Y10130N
ALPK2GGRTYGARGSOFT_TISSUE521p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1N000N
ALPK2GRTYGARGVSOFT_TISSUE522p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1N300N
ALPK2KRVGGRTYGSOFT_TISSUE518p.K523fsc.1568_1568delAFrame_Shift_Del40.55SKUT1Y2110Y
ALPK2RGVQGNLPGSOFT_TISSUE528p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1N100N
ALPK2RTYGARGVQSOFT_TISSUE523p.K523fsc.1568_1568delAFrame_Shift_Del60.55SKUT1N000N
ALPK2RVGGRTYGASOFT_TISSUE519p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1Y3120N
ALPK2TYGARGVQGSOFT_TISSUE524p.K523fsc.1568_1568delAFrame_Shift_Del60.55SKUT1N000N
ALPK2VGGRTYGARSOFT_TISSUE520p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1N100N
ALPK2YGARGVQGNSOFT_TISSUE525p.K523fsc.1568_1568delAFrame_Shift_Del50.55SKUT1N105N
ALPK2AFKKFLTCPSOFT_TISSUE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27GCTN000N
ALPK2AFKKFLTCPSOFT_TISSUE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HT1080N000N
ALPK2AFKKFLTCPSOFT_TISSUE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27RDN000N
ALPK2AFKKFLTCPSOFT_TISSUE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27RH41N000N
ALPK2AFKKFLTCPSOFT_TISSUE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SJRH30N000N
ALPK2AFKKFLTCPSOFT_TISSUE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SKUT1N000N
ALPK2DHTAFKKFLSOFT_TISSUE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27GCTN600N
ALPK2DHTAFKKFLSOFT_TISSUE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HT1080N600N
ALPK2DHTAFKKFLSOFT_TISSUE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27RDN600N
ALPK2DHTAFKKFLSOFT_TISSUE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27RH41N600N
ALPK2DHTAFKKFLSOFT_TISSUE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SJRH30N600N
ALPK2DHTAFKKFLSOFT_TISSUE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SKUT1N600N
ALPK2HTAFKKFLTSOFT_TISSUE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27GCTN100N
ALPK2HTAFKKFLTSOFT_TISSUE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HT1080N100N
ALPK2HTAFKKFLTSOFT_TISSUE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27RDN100N
ALPK2HTAFKKFLTSOFT_TISSUE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27RH41N100N
ALPK2HTAFKKFLTSOFT_TISSUE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SJRH30N100N
ALPK2HTAFKKFLTSOFT_TISSUE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27SKUT1N100N
ALPK2KMDHTAFKKSOFT_TISSUE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27GCTN600N
ALPK2KMDHTAFKKSOFT_TISSUE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HT1080N600N
ALPK2KMDHTAFKKSOFT_TISSUE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27RDN600N
ALPK2KMDHTAFKKSOFT_TISSUE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27RH41N600N
ALPK2KMDHTAFKKSOFT_TISSUE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SJRH30N600N
ALPK2KMDHTAFKKSOFT_TISSUE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SKUT1N600N
ALPK2LKMDHTAFKSOFT_TISSUE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27GCTN1017N
ALPK2LKMDHTAFKSOFT_TISSUE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HT1080N1017N
ALPK2LKMDHTAFKSOFT_TISSUE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27RDN1017N
ALPK2LKMDHTAFKSOFT_TISSUE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27RH41N1017N
ALPK2LKMDHTAFKSOFT_TISSUE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SJRH30N1017N
ALPK2LKMDHTAFKSOFT_TISSUE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27SKUT1N1017N
ALPK2MDHTAFKKFSOFT_TISSUE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27GCTN600N
ALPK2MDHTAFKKFSOFT_TISSUE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HT1080N600N
ALPK2MDHTAFKKFSOFT_TISSUE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27RDN600N
ALPK2MDHTAFKKFSOFT_TISSUE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27RH41N600N
ALPK2MDHTAFKKFSOFT_TISSUE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SJRH30N600N
ALPK2MDHTAFKKFSOFT_TISSUE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SKUT1N600N
ALPK2TAFKKFLTCSOFT_TISSUE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27GCTN600N
ALPK2TAFKKFLTCSOFT_TISSUE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HT1080N600N
ALPK2TAFKKFLTCSOFT_TISSUE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27RDN600N
ALPK2TAFKKFLTCSOFT_TISSUE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27RH41N600N
ALPK2TAFKKFLTCSOFT_TISSUE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SJRH30N600N
ALPK2TAFKKFLTCSOFT_TISSUE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27SKUT1N600N
ALPK2ATRETVTIASOFT_TISSUE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74G402Y1140N
ALPK2ATRETVTIASOFT_TISSUE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HS729Y1140N
ALPK2ATRETVTIASOFT_TISSUE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74S117Y1140N
ALPK2ATRETVTIASOFT_TISSUE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SJRH30Y1140N
ALPK2ATRETVTIASOFT_TISSUE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SKLMS1Y1140N
ALPK2ATRETVTIASOFT_TISSUE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74TE125TY1140N
ALPK2ATRETVTIASOFT_TISSUE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74TE617TY1140N
ALPK2CFQATRETVSOFT_TISSUE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74G402Y2110N
ALPK2CFQATRETVSOFT_TISSUE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS729Y2110N
ALPK2CFQATRETVSOFT_TISSUE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74S117Y2110N
ALPK2CFQATRETVSOFT_TISSUE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SJRH30Y2110N
ALPK2CFQATRETVSOFT_TISSUE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKLMS1Y2110N
ALPK2CFQATRETVSOFT_TISSUE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE125TY2110N
ALPK2CFQATRETVSOFT_TISSUE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE617TY2110N
ALPK2ETVTIATEVSOFT_TISSUE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74G402N400N
ALPK2ETVTIATEVSOFT_TISSUE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS729N400N
ALPK2ETVTIATEVSOFT_TISSUE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74S117N400N
ALPK2ETVTIATEVSOFT_TISSUE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SJRH30N400N
ALPK2ETVTIATEVSOFT_TISSUE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKLMS1N400N
ALPK2ETVTIATEVSOFT_TISSUE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE125TN400N
ALPK2ETVTIATEVSOFT_TISSUE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74TE617TN400N
ALPK2FQATRETVTSOFT_TISSUE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74G402N600N
ALPK2FQATRETVTSOFT_TISSUE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS729N600N
ALPK2FQATRETVTSOFT_TISSUE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74S117N600N
ALPK2FQATRETVTSOFT_TISSUE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SJRH30N600N
ALPK2FQATRETVTSOFT_TISSUE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKLMS1N600N
ALPK2FQATRETVTSOFT_TISSUE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE125TN600N
ALPK2FQATRETVTSOFT_TISSUE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE617TN600N
ALPK2QATRETVTISOFT_TISSUE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74G402N600N
ALPK2QATRETVTISOFT_TISSUE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS729N600N
ALPK2QATRETVTISOFT_TISSUE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74S117N600N
ALPK2QATRETVTISOFT_TISSUE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SJRH30N600N
ALPK2QATRETVTISOFT_TISSUE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKLMS1N600N
ALPK2QATRETVTISOFT_TISSUE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE125TN600N
ALPK2QATRETVTISOFT_TISSUE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE617TN600N
ALPK2RETVTIATESOFT_TISSUE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74G402N100N
ALPK2RETVTIATESOFT_TISSUE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS729N100N
ALPK2RETVTIATESOFT_TISSUE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74S117N100N
ALPK2RETVTIATESOFT_TISSUE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SJRH30N100N
ALPK2RETVTIATESOFT_TISSUE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKLMS1N100N
ALPK2RETVTIATESOFT_TISSUE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE125TN100N
ALPK2RETVTIATESOFT_TISSUE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74TE617TN100N
ALPK2TRETVTIATSOFT_TISSUE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74G402N200N
ALPK2TRETVTIATSOFT_TISSUE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS729N200N
ALPK2TRETVTIATSOFT_TISSUE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74S117N200N
ALPK2TRETVTIATSOFT_TISSUE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SJRH30N200N
ALPK2TRETVTIATSOFT_TISSUE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKLMS1N200N
ALPK2TRETVTIATSOFT_TISSUE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE125TN200N
ALPK2TRETVTIATSOFT_TISSUE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74TE617TN200N
ATMADNHHQVHMSOFT_TISSUE1079p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1Y390N
ATMDNHHQVHMLSOFT_TISSUE1080p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1Y7150N
ATMHHQVHMLAASOFT_TISSUE1082p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1N200N
ATMHMLAAESINSOFT_TISSUE1086p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1N000N
ATMHQVHMLAAESOFT_TISSUE1083p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1N000N
ATMHRLNNSLKESOFT_TISSUE269p.D273Nc.817G>AMissense_Mutation10.11RDN100N
ATMIWTQHRLNNSOFT_TISSUE265p.D273Nc.817G>AMissense_Mutation10.11RDN000N
ATMLADNHHQVHSOFT_TISSUE1078p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1N000N
ATMLNNSLKEVISOFT_TISSUE271p.D273Nc.817G>AMissense_Mutation10.11RDN5010N
ATMNHHQVHMLASOFT_TISSUE1081p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1N200N
ATMNNSLKEVIISOFT_TISSUE272p.D273Nc.817G>AMissense_Mutation10.11RDY2100N
ATMNSLKEVIIESOFT_TISSUE273p.D273Nc.817G>AMissense_Mutation10.11RDN000N
ATMQHRLNNSLKSOFT_TISSUE268p.D273Nc.817G>AMissense_Mutation10.11RDN000N
ATMQVHMLAAESSOFT_TISSUE1084p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1N000N
ATMRLNNSLKEVSOFT_TISSUE270p.D273Nc.817G>AMissense_Mutation10.11RDY6100N
ATMTQHRLNNSLSOFT_TISSUE267p.D273Nc.817G>AMissense_Mutation10.11RDY10130N
ATMVHMLAAESISOFT_TISSUE1085p.R1086Hc.3257G>AMissense_Mutation10.11SKUT1N6014N
ATMWTQHRLNNSSOFT_TISSUE266p.D273Nc.817G>AMissense_Mutation10.11RDN104N
BRAFATEKSRWSGSOFT_TISSUE598p.V600Ec.1799T>AMissense_Mutation16.08GCTN000N
BRAFDFGLATEKSSOFT_TISSUE594p.V600Ec.1799T>AMissense_Mutation16.08GCTN000N
BRAFEKSRWSGSHSOFT_TISSUE600p.V600Ec.1799T>AMissense_Mutation16.08GCTN100N
BRAFFGLATEKSRSOFT_TISSUE595p.V600Ec.1799T>AMissense_Mutation16.08GCTN302N
BRAFGDFGLATEKSOFT_TISSUE593p.V600Ec.1799T>AMissense_Mutation16.08GCTN100N
BRAFGLATEKSRWSOFT_TISSUE596p.V600Ec.1799T>AMissense_Mutation16.08GCTN400N
BRAFIGDFGLATESOFT_TISSUE592p.V600Ec.1799T>AMissense_Mutation16.08GCTN000N
BRAFLATEKSRWSSOFT_TISSUE597p.V600Ec.1799T>AMissense_Mutation16.08GCTN200N
BRAFTEKSRWSGSSOFT_TISSUE599p.V600Ec.1799T>AMissense_Mutation16.08GCTN300N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86A204N100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86G401N100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS729N100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RDN100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RH41N100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RKNN100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SJRH30N100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKLMS1N100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE125TN100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE441TN100N
CHD1DQRSYGSRSSOFT_TISSUE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE617TN100N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86A204N000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86G401N000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS729N000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RDN000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RH41N000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86RKNN000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SJRH30N000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKLMS1N000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE125TN000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE441TN000N
CHD1LDQRSYGSRSOFT_TISSUE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TE617TN000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86A204N000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86G401N000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS729N000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RDN000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RH41N000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RKNN000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SJRH30N000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKLMS1N000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE125TN000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE441TN000N
CHD1PLDQRSYGSSOFT_TISSUE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE617TN000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86A204N000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86G401N000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS729N000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RDN000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RH41N000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86RKNN000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SJRH30N000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKLMS1N000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE125TN000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE441TN000N
CHD1QRSYGSRSPSOFT_TISSUE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TE617TN000N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86A204N600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86G401N600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS729N600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RDN600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RH41N600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RKNN600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SJRH30N600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKLMS1N600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE125TN600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE441TN600N
CHD1RSPLDQRSYSOFT_TISSUE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE617TN600N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86A204N900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86G401N900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS729N900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RDN900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RH41N900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RKNN900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SJRH30N900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKLMS1N900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE125TN900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE441TN900N
CHD1RSYGSRSPFSOFT_TISSUE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE617TN900N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86A204N000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86G401N000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS729N000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RDN000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RH41N000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86RKNN000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SJRH30N000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKLMS1N000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE125TN000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE441TN000N
CHD1SPLDQRSYGSOFT_TISSUE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TE617TN000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86A204N000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86G401N000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS729N000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RDN000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RH41N000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86RKNN000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SJRH30N000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKLMS1N000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE125TN000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE441TN000N
CHD1SYGSRSPFESOFT_TISSUE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TE617TN000N
CHD1EQFKQWRKNSOFT_TISSUE1469p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1N000N
CHD1EYTNPEQFKSOFT_TISSUE1464p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1N100N
CHD1FKQWRKNLWSOFT_TISSUE1471p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1N505N
CHD1KEYTNPEQFSOFT_TISSUE1463p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1N1000N
CHD1NPEQFKQWRSOFT_TISSUE1467p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1Y490N
CHD1PEQFKQWRKSOFT_TISSUE1468p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1N000N
CHD1QFKQWRKNLSOFT_TISSUE1470p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1Y4100N
CHD1TNPEQFKQWSOFT_TISSUE1466p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1N300N
CHD1YTNPEQFKQSOFT_TISSUE1465p.I1471Fc.4411A>TMissense_Mutation10.11SKUT1N300N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47G401N801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47G402N801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47HT1080N801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47KYM1N801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47RDN801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47RH41N801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47RKNN801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47TE159TN801N
CREB3L2FTHITSDSFSOFT_TISSUE95p.T100delc.299_301delCCAIn_Frame_Del444.47TE617TN801N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47G401N000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47G402N000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47HT1080N000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47KYM1N000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47RDN000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47RH41N000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47RKNN000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47TE159TN000N
CREB3L2HITSDSFNDSOFT_TISSUE97p.T100delc.299_301delCCAIn_Frame_Del244.47TE617TN000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47G401N000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47G402N000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47HT1080N000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47KYM1N000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47RDN000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47RH41N000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47RKNN000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47TE159TN000N
CREB3L2ITSDSFNDDSOFT_TISSUE98p.T100delc.299_301delCCAIn_Frame_Del144.47TE617TN000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47G401N000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47G402N000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47HT1080N000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47KYM1N000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47RDN000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47RH41N000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47RKNN000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47TE159TN000N
CREB3L2PFTHITSDSSOFT_TISSUE94p.T100delc.299_301delCCAIn_Frame_Del344.47TE617TN000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47G401N000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47G402N000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47HT1080N000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47KYM1N000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47RDN000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47RH41N000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47RKNN000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47TE159TN000N
CREB3L2QSPFTHITSSOFT_TISSUE92p.T100delc.299_301delCCAIn_Frame_Del144.47TE617TN000N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47G401N100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47G402N100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47HT1080N100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47KYM1N100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47RDN100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47RH41N100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47RKNN100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47TE159TN100N
CREB3L2SPFTHITSDSOFT_TISSUE93p.T100delc.299_301delCCAIn_Frame_Del244.47TE617TN100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47G401N100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47G402N100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47HT1080N100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47KYM1N100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47RDN100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47RH41N100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47RKNN100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47TE159TN100N
CREB3L2THITSDSFNSOFT_TISSUE96p.T100delc.299_301delCCAIn_Frame_Del344.47TE617TN100N
CTBP2APSPNQPTNSOFT_TISSUE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HT1080N300N
CTBP2APSPNQPTNSOFT_TISSUE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34TE159TN300N
CTBP2GTIESTPTSSOFT_TISSUE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HT1080N100N
CTBP2GTIESTPTSSOFT_TISSUE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE159TN100N
CTBP2NQPTNTGTISOFT_TISSUE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HT1080N1000N
CTBP2NQPTNTGTISOFT_TISSUE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34TE159TN1000N
CTBP2NTGTIESTPSOFT_TISSUE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HT1080N000N
CTBP2NTGTIESTPSOFT_TISSUE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE159TN000N
CTBP2PNQPTNTGTSOFT_TISSUE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HT1080N000N
CTBP2PNQPTNTGTSOFT_TISSUE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34TE159TN000N
CTBP2PSPNQPTNTSOFT_TISSUE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HT1080N000N
CTBP2PSPNQPTNTSOFT_TISSUE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34TE159TN000N
CTBP2PTNTGTIESSOFT_TISSUE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HT1080N000N
CTBP2PTNTGTIESSOFT_TISSUE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE159TN000N
CTBP2QPTNTGTIESOFT_TISSUE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HT1080N000N
CTBP2QPTNTGTIESOFT_TISSUE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE159TN000N
CTBP2SPNQPTNTGSOFT_TISSUE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HT1080N000N
CTBP2SPNQPTNTGSOFT_TISSUE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34TE159TN000N
CTBP2TGTIESTPTSOFT_TISSUE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HT1080N000N
CTBP2TGTIESTPTSOFT_TISSUE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE159TN000N
CTBP2TIESTPTSNSOFT_TISSUE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HT1080N100N
CTBP2TIESTPTSNSOFT_TISSUE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE159TN100N
CTBP2TNTGTIESTSOFT_TISSUE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HT1080N000N
CTBP2TNTGTIESTSOFT_TISSUE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34TE159TN000N
ERBB2FQNLQVIWGSOFT_TISSUE425p.R432Wc.1294C>TMissense_Mutation10.11TE441TN2029N
ERBB2IWGRILHNGSOFT_TISSUE431p.R432Wc.1294C>TMissense_Mutation10.11TE441TN000N
ERBB2LQVIWGRILSOFT_TISSUE428p.R432Wc.1294C>TMissense_Mutation10.11TE441TN1306N
ERBB2NLQVIWGRISOFT_TISSUE427p.R432Wc.1294C>TMissense_Mutation10.11TE441TN600N
ERBB2QNLQVIWGRSOFT_TISSUE426p.R432Wc.1294C>TMissense_Mutation10.11TE441TN300N
ERBB2QVIWGRILHSOFT_TISSUE429p.R432Wc.1294C>TMissense_Mutation10.11TE441TN100N
ERBB2VFQNLQVIWSOFT_TISSUE424p.R432Wc.1294C>TMissense_Mutation10.11TE441TN400N
ERBB2VIWGRILHNSOFT_TISSUE430p.R432Wc.1294C>TMissense_Mutation10.11TE441TN000N
ERBB2WGRILHNGASOFT_TISSUE432p.R432Wc.1294C>TMissense_Mutation10.11TE441TN403N
FMN2LPPLPGAAISOFT_TISSUE934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HT1080N1401N
FMN2PLPPLPGAASOFT_TISSUE933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03HT1080N000N
FMN2AVSPQPRAFSOFT_TISSUE238p.G244Rc.730G>AMissense_Mutation10.11KYM1Y2100N
FMN2EPSLSRGSGSOFT_TISSUE448p.R456Gc.1366A>GMissense_Mutation10.11S117N000N
FMN2GSGTALASVSOFT_TISSUE454p.R456Gc.1366A>GMissense_Mutation10.11S117N400N
FMN2GTALASVAASOFT_TISSUE456p.R456Gc.1366A>GMissense_Mutation10.11S117N300N
FMN2LSRGSGTALSOFT_TISSUE451p.R456Gc.1366A>GMissense_Mutation10.11S117N800N
FMN2PQPRAFLGLSOFT_TISSUE241p.G244Rc.730G>AMissense_Mutation10.11KYM1N300N
FMN2PRAFLGLDRSOFT_TISSUE243p.G244Rc.730G>AMissense_Mutation10.11KYM1N100Y
FMN2PSLSRGSGTSOFT_TISSUE449p.R456Gc.1366A>GMissense_Mutation10.11S117N000N
FMN2PTAVSPQPRSOFT_TISSUE236p.G244Rc.730G>AMissense_Mutation10.11KYM1N100N
FMN2QPRAFLGLDSOFT_TISSUE242p.G244Rc.730G>AMissense_Mutation10.11KYM1N000N
FMN2RAFLGLDRFSOFT_TISSUE244p.G244Rc.730G>AMissense_Mutation10.11KYM1Y1090N
FMN2RGSGTALASSOFT_TISSUE453p.R456Gc.1366A>GMissense_Mutation10.11S117N000N
FMN2SGTALASVASOFT_TISSUE455p.R456Gc.1366A>GMissense_Mutation10.11S117N200Y
FMN2SLSRGSGTASOFT_TISSUE450p.R456Gc.1366A>GMissense_Mutation10.11S117N100N
FMN2SPQPRAFLGSOFT_TISSUE240p.G244Rc.730G>AMissense_Mutation10.11KYM1N000N
FMN2SRGSGTALASOFT_TISSUE452p.R456Gc.1366A>GMissense_Mutation10.11S117Y290N
FMN2TAVSPQPRASOFT_TISSUE237p.G244Rc.730G>AMissense_Mutation10.11KYM1Y590N
FMN2VSPQPRAFLSOFT_TISSUE239p.G244Rc.730G>AMissense_Mutation10.11KYM1Y1490N
GATA1ASTVCPTCESOFT_TISSUE106p.R113Cc.337C>TMissense_Mutation10.11SKUT1N000N
GATA1CEDSPPQAVSOFT_TISSUE113p.R113Cc.337C>TMissense_Mutation10.11SKUT1Y6100N
GATA1CPTCEDSPPSOFT_TISSUE110p.R113Cc.337C>TMissense_Mutation10.11SKUT1N000N
GATA1PASTVCPTCSOFT_TISSUE105p.R113Cc.337C>TMissense_Mutation10.11SKUT1N000N
GATA1PTCEDSPPQSOFT_TISSUE111p.R113Cc.337C>TMissense_Mutation10.11SKUT1N000N
GATA1STVCPTCEDSOFT_TISSUE107p.R113Cc.337C>TMissense_Mutation10.11SKUT1N000N
GATA1TCEDSPPQASOFT_TISSUE112p.R113Cc.337C>TMissense_Mutation10.11SKUT1N100N
GATA1TVCPTCEDSSOFT_TISSUE108p.R113Cc.337C>TMissense_Mutation10.11SKUT1N000N
GATA1VCPTCEDSPSOFT_TISSUE109p.R113Cc.337C>TMissense_Mutation10.11SKUT1N000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7G401N000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7G402N000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7KYM1N000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7RDN000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7RH41N000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7RKNN000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SKLMS1N000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SKUT1N000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE125TN000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE159TN000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE441TN000N
GPR112ASISDMFIQSOFT_TISSUE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7TE617TN000N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7G401Y11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7G402Y11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYM1Y11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7RDY11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7RH41Y11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7RKNY11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKLMS1Y11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKUT1Y11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE125TY11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE159TY11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE441TY11100N
GPR112ISDMFIQNLSOFT_TISSUE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE617TY11100N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7G401N700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7G402N700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYM1N700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7RDN700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7RH41N700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7RKNN700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKLMS1N700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKUT1N700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE125TN700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE159TN700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE441TN700N
GPR112SASISDMFISOFT_TISSUE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE617TN700N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7G401N400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7G402N400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYM1N400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7RDN400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7RH41N400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7RKNN400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKLMS1N400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKUT1N400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE125TN400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE159TN400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE441TN400N
GPR112SDMFIQNLASOFT_TISSUE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE617TN400N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7G401N000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7G402N000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7KYM1N000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7RDN000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7RH41N000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7RKNN000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKLMS1N000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKUT1N000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE125TN000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE159TN000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE441TN000N
GPR112SISDMFIQNSOFT_TISSUE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7TE617TN000N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7G401N900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7G402N900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7KYM1N900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7RDN900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7RH41N900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7RKNN900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKLMS1N900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKUT1N900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE125TN900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE159TN900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE441TN900N
GPR112VSASISDMFSOFT_TISSUE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7TE617TN900N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7G401N5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7G402N5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7KYM1N5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7RDN5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7RH41N5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7RKNN5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKLMS1N5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKUT1N5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE125TN5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE159TN5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE441TN5020N
GPR112VVSASISDMSOFT_TISSUE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7TE617TN5020N
HSP90B1DEEETAKESSOFT_TISSUE787p.E791delc.2362_2364delGAAIn_Frame_Del121.79RKNN300N
HSP90B1DEEETAKESSOFT_TISSUE787p.E791delc.2362_2364delGAAIn_Frame_Del121.79TE617TN300N
HSP90B1DVGTDEEETSOFT_TISSUE783p.E791delc.2362_2364delGAAIn_Frame_Del121.79RKNN200N
HSP90B1DVGTDEEETSOFT_TISSUE783p.E791delc.2362_2364delGAAIn_Frame_Del121.79TE617TN200N
HSP90B1GTDEEETAKSOFT_TISSUE785p.E791delc.2362_2364delGAAIn_Frame_Del321.79RKNN400N
HSP90B1GTDEEETAKSOFT_TISSUE785p.E791delc.2362_2364delGAAIn_Frame_Del321.79TE617TN400N
HSP90B1TDEEETAKESOFT_TISSUE786p.E791delc.2362_2364delGAAIn_Frame_Del221.79RKNN000N
HSP90B1TDEEETAKESOFT_TISSUE786p.E791delc.2362_2364delGAAIn_Frame_Del221.79TE617TN000N
HSP90B1VGTDEEETASOFT_TISSUE784p.E791delc.2362_2364delGAAIn_Frame_Del221.79RKNN100N
HSP90B1VGTDEEETASOFT_TISSUE784p.E791delc.2362_2364delGAAIn_Frame_Del221.79TE617TN100N
MAML2EYSLGLTQGSOFT_TISSUE367p.P370Lc.1109C>TMissense_Mutation10.11GCTN000N
MAML2IKSEYSLGLSOFT_TISSUE364p.P370Lc.1109C>TMissense_Mutation10.11GCTN608N
MAML2IVIKSEYSLSOFT_TISSUE362p.P370Lc.1109C>TMissense_Mutation10.11GCTY121014N
MAML2KSEYSLGLTSOFT_TISSUE365p.P370Lc.1109C>TMissense_Mutation10.11GCTN200N
MAML2LGLTQGPSGSOFT_TISSUE370p.P370Lc.1109C>TMissense_Mutation10.11GCTN000N
MAML2SEYSLGLTQSOFT_TISSUE366p.P370Lc.1109C>TMissense_Mutation10.11GCTN000N
MAML2SLGLTQGPSSOFT_TISSUE369p.P370Lc.1109C>TMissense_Mutation10.11GCTN000N
MAML2VIKSEYSLGSOFT_TISSUE363p.P370Lc.1109C>TMissense_Mutation10.11GCTN000N
MAML2YSLGLTQGPSOFT_TISSUE368p.P370Lc.1109C>TMissense_Mutation10.11GCTN200N
MAML2GLNQSRMGISOFT_TISSUE1068p.T1074Mc.3221C>TMissense_Mutation10.22S117N500N
MAML2GTGLNQSRMSOFT_TISSUE1066p.T1074Mc.3221C>TMissense_Mutation10.22S117Y490N
MAML2LNQSRMGINSOFT_TISSUE1069p.T1074Mc.3221C>TMissense_Mutation10.22S117N000N
MAML2MGINQPPSLSOFT_TISSUE1074p.T1074Mc.3221C>TMissense_Mutation10.22S117N1304Y
MAML2NQSRMGINQSOFT_TISSUE1070p.T1074Mc.3221C>TMissense_Mutation10.22S117N000N
MAML2QSRMGINQPSOFT_TISSUE1071p.T1074Mc.3221C>TMissense_Mutation10.22S117N000N
MAML2RMGINQPPSSOFT_TISSUE1073p.T1074Mc.3221C>TMissense_Mutation10.22S117N100N
MAML2SRMGINQPPSOFT_TISSUE1072p.T1074Mc.3221C>TMissense_Mutation10.22S117N100N
MAML2TGLNQSRMGSOFT_TISSUE1067p.T1074Mc.3221C>TMissense_Mutation10.22S117N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44A204N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44G401N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44G402N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44GCTN000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS729N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HT1080N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44KYM1N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44RDN000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44RH41N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44S117N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SKLMS1N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SKUT1N000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE125TN000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE159TN000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE441TN000N
MAP3K1STTTTTTTESOFT_TISSUE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44TE617TN000N
MAP3K1APSHNTIQKSOFT_TISSUE402p.R405Hc.1214G>AMissense_Mutation10.11SKUT1Y1120N
MAP3K1HNTIQKFVSSOFT_TISSUE405p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N000N
MAP3K1IKAPSHNTISOFT_TISSUE400p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N200N
MAP3K1KAPSHNTIQSOFT_TISSUE401p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N000N
MAP3K1PSHNTIQKFSOFT_TISSUE403p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N100N
MAP3K1RIKAPSHNTSOFT_TISSUE399p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N000N
MAP3K1SHNTIQKFVSOFT_TISSUE404p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N300N
MAP3K1SRIKAPSHNSOFT_TISSUE398p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N200N
MAP3K1SSRIKAPSHSOFT_TISSUE397p.R405Hc.1214G>AMissense_Mutation10.11SKUT1N000N
METEECKEALAKSOFT_TISSUE24p.G24Ec.71G>AMissense_Mutation10.22TE441TN000N
METFTLVQRSNESOFT_TISSUE16p.G24Ec.71G>AMissense_Mutation10.22TE441TN202N
METLVQRSNEECSOFT_TISSUE18p.G24Ec.71G>AMissense_Mutation10.22TE441TN002N
METNEECKEALASOFT_TISSUE23p.G24Ec.71G>AMissense_Mutation10.22TE441TN600N
METQRSNEECKESOFT_TISSUE20p.G24Ec.71G>AMissense_Mutation10.22TE441TN100N
METRSNEECKEASOFT_TISSUE21p.G24Ec.71G>AMissense_Mutation10.22TE441TN300N
METSNEECKEALSOFT_TISSUE22p.G24Ec.71G>AMissense_Mutation10.22TE441TN500N
METTLVQRSNEESOFT_TISSUE17p.G24Ec.71G>AMissense_Mutation10.22TE441TN000N
METVQRSNEECKSOFT_TISSUE19p.G24Ec.71G>AMissense_Mutation10.22TE441TN300N
MLL3AKQHTAKKASOFT_TISSUE3214p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N100N
MLL3ALSAKQHTASOFT_TISSUE3211p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1Y390N
MLL3DQSPMTPGSSOFT_TISSUE2300p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN000N
MLL3GSQSDSFGTSOFT_TISSUE2307p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN100N
MLL3HTAKKAGRESOFT_TISSUE3217p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N000N
MLL3KALSAKQHTSOFT_TISSUE3210p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N300N
MLL3KKALSAKQHSOFT_TISSUE3209p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N100N
MLL3KQHTAKKAGSOFT_TISSUE3215p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N100N
MLL3LSAKQHTAKSOFT_TISSUE3212p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N100N
MLL3MTPGSQSDSSOFT_TISSUE2304p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN000N
MLL3PGSQSDSFGSOFT_TISSUE2306p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN000N
MLL3PMTPGSQSDSOFT_TISSUE2303p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN000N
MLL3QHTAKKAGRSOFT_TISSUE3216p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N100N
MLL3QSPMTPGSQSOFT_TISSUE2301p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN000Y
MLL3SAKQHTAKKSOFT_TISSUE3213p.R3217Hc.9650G>AMissense_Mutation10.11SKUT1N100N
MLL3SPMTPGSQSSOFT_TISSUE2302p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN200Y
MLL3TPGSQSDSFSOFT_TISSUE2305p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN1100N
MLL3YDQSPMTPGSOFT_TISSUE2299p.R2307Gc.6919A>GMissense_Mutation10.11TE617TN200N
MSH2ATHFHELSLSOFT_TISSUE781p.T788fsc.2363_2364delCTFrame_Shift_Del20.11SKUT1Y6120N
MSH2ELSLGQSDTSOFT_TISSUE786p.T788fsc.2363_2364delCTFrame_Shift_Del50.11SKUT1N100N
MSH2FATHFHELSSOFT_TISSUE780p.T788fsc.2363_2364delCTFrame_Shift_Del10.11SKUT1N300N
MSH2FHELSLGQSSOFT_TISSUE784p.T788fsc.2363_2364delCTFrame_Shift_Del50.11SKUT1N402N
MSH2HELSLGQSDSOFT_TISSUE785p.T788fsc.2363_2364delCTFrame_Shift_Del50.11SKUT1N000N
MSH2HFHELSLGQSOFT_TISSUE783p.T788fsc.2363_2364delCTFrame_Shift_Del40.11SKUT1N000N
MSH2LSLGQSDTNSOFT_TISSUE787p.T788fsc.2363_2364delCTFrame_Shift_Del50.11SKUT1N000N
MSH2SLGQSDTNCSOFT_TISSUE788p.T788fsc.2363_2364delCTFrame_Shift_Del60.11SKUT1N200N
MSH2THFHELSLGSOFT_TISSUE782p.T788fsc.2363_2364delCTFrame_Shift_Del30.11SKUT1N000N
MSH3GAAAAAAPPSOFT_TISSUE50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94SKUT1N000N
MSH3GAAAAAAPPSOFT_TISSUE50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94TE617TN000N
MSH3PGAAAAAAPSOFT_TISSUE49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94SKUT1N000N
MSH3PGAAAAAAPSOFT_TISSUE49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94TE617TN000N
MSH3AAAAPPAPASOFT_TISSUE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23G402N200N
MSH3AAAAPPAPASOFT_TISSUE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS729N200N
MSH3AAAAPPAPASOFT_TISSUE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HT1080N200N
MSH3AAAAPPAPASOFT_TISSUE53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23SKUT1N200N
MSH3AAAAPPAPASOFT_TISSUE53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23TE617TN200N
MSH3AAAAPPAPASOFT_TISSUE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23TE617TN200N
MSH3AAAPPAPAFSOFT_TISSUE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23G402Y8100N
MSH3AAAPPAPAFSOFT_TISSUE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HS729Y8100N
MSH3AAAPPAPAFSOFT_TISSUE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HT1080Y8100N
MSH3AAAPPAPAFSOFT_TISSUE54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23SKUT1Y8100N
MSH3AAAPPAPAFSOFT_TISSUE54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23TE617TY8100N
MSH3AAAPPAPAFSOFT_TISSUE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23TE617TY8100N
MSH3AAPPAPAFPSOFT_TISSUE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23G402N000N
MSH3AAPPAPAFPSOFT_TISSUE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS729N000N
MSH3AAPPAPAFPSOFT_TISSUE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HT1080N000N
MSH3AAPPAPAFPSOFT_TISSUE55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23SKUT1N000N
MSH3AAPPAPAFPSOFT_TISSUE55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23TE617TN000N
MSH3AAPPAPAFPSOFT_TISSUE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23TE617TN000N
MSH3AAAAAAAPASOFT_TISSUE56p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN300N
MSH3AAAAAAPAASOFT_TISSUE57p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN300N
MSH3AAAAAPAAPSOFT_TISSUE58p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN000N
MSH3AAAAPAAPPSOFT_TISSUE59p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN000N
MSH3AAAPAAPPASOFT_TISSUE60p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN500N
MSH3AAPAAPPAPSOFT_TISSUE61p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN000N
MSH3APAAPPAPPSOFT_TISSUE62p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN000N
MSH3PAAPPAPPASOFT_TISSUE63p.63_64insAAPc.178_179insCCGCAGCGCIn_Frame_Ins11.77RKNN000N
MYLKASKELKKDVSOFT_TISSUE1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYM1N400N
MYLKASKELKKDVSOFT_TISSUE1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02RKNN400N
MYLKKELKKDVKNSOFT_TISSUE1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYM1N500N
MYLKKELKKDVKNSOFT_TISSUE1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02RKNN500N
MYLKKSASKELKKSOFT_TISSUE1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYM1N400N
MYLKKSASKELKKSOFT_TISSUE1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02RKNN400N
MYLKLKSASKELKSOFT_TISSUE1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYM1N105N
MYLKLKSASKELKSOFT_TISSUE1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02RKNN105N
MYLKNLKSASKELSOFT_TISSUE1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02KYM1Y5100N
MYLKNLKSASKELSOFT_TISSUE1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02RKNY5100N
MYLKSASKELKKDSOFT_TISSUE1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02KYM1N000N
MYLKSASKELKKDSOFT_TISSUE1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02RKNN000N
MYLKSKELKKDVKSOFT_TISSUE1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02KYM1N200N
MYLKSKELKKDVKSOFT_TISSUE1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02RKNN200N
NF1ADSMQTLFESOFT_TISSUE1268p.F1275fsc.3825_3825delCFrame_Shift_Del10.11SKLMS1N100N
NF1DSMQTLFEASOFT_TISSUE1269p.F1275fsc.3825_3825delCFrame_Shift_Del20.11SKLMS1N100N
NF1FEATAWPVKSOFT_TISSUE1275p.F1275fsc.3825_3825delCFrame_Shift_Del60.11SKLMS1N300N
NF1LFEATAWPVSOFT_TISSUE1274p.F1275fsc.3825_3825delCFrame_Shift_Del50.11SKLMS1N400N
NF1MQTLFEATASOFT_TISSUE1271p.F1275fsc.3825_3825delCFrame_Shift_Del40.11SKLMS1N600N
NF1QTLFEATAWSOFT_TISSUE1272p.F1275fsc.3825_3825delCFrame_Shift_Del40.11SKLMS1N100N
NF1SMQTLFEATSOFT_TISSUE1270p.F1275fsc.3825_3825delCFrame_Shift_Del30.11SKLMS1N300N
NF1TLFEATAWPSOFT_TISSUE1273p.F1275fsc.3825_3825delCFrame_Shift_Del50.11SKLMS1N100N
NF1ADSMQTFFRSOFT_TISSUE1268p.L1274Fc.3820C>TMissense_Mutation10.11A204N100N
NF1AKRQRVIAISOFT_TISSUE1966p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1Y4140Y
NF1DAKRQRVIASOFT_TISSUE1965p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1Y4100Y
NF1DDAKRQRVISOFT_TISSUE1964p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1N600Y
NF1DSMQTFFRGSOFT_TISSUE1269p.L1274Fc.3820C>TMissense_Mutation10.11A204N000N
NF1EFSPQLRSVSOFT_TISSUE1356p.P1358Sc.4072C>TMissense_Mutation10.11G402N200N
NF1ELADSMQTFSOFT_TISSUE1266p.L1274Fc.3820C>TMissense_Mutation10.11A204Y6110N
NF1EYMTPWLLNSOFT_TISSUE1947p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1N200N
NF1FFRGNSLASSOFT_TISSUE1274p.L1274Fc.3820C>TMissense_Mutation10.11A204N2015N
NF1FSPQLRSVCSOFT_TISSUE1357p.P1358Sc.4072C>TMissense_Mutation10.11G402N300N
NF1IAILDKLITSOFT_TISSUE1972p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1N4030N
NF1IISSSSEFSSOFT_TISSUE1350p.P1358Sc.4072C>TMissense_Mutation10.11G402N008Y
NF1ISSSSEFSPSOFT_TISSUE1351p.P1358Sc.4072C>TMissense_Mutation10.11G402N000Y
NF1KRQRVIAILSOFT_TISSUE1967p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1Y10100N
NF1LADSMQTFFSOFT_TISSUE1267p.L1274Fc.3820C>TMissense_Mutation10.11A204N600N
NF1LEYMTPWLLSOFT_TISSUE1946p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1N1706N
NF1LLNLVRFCKSOFT_TISSUE1953p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1N5021N
NF1LNLVRFCKHSOFT_TISSUE1954p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1N000N
NF1MQTFFRGNSSOFT_TISSUE1271p.L1274Fc.3820C>TMissense_Mutation10.11A204N0020N
NF1MTPWLLNLVSOFT_TISSUE1949p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1N600N
NF1PWLLNLVRFSOFT_TISSUE1951p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1N000N
NF1QRVIAILDKSOFT_TISSUE1969p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1N200Y
NF1QTFFRGNSLSOFT_TISSUE1272p.L1274Fc.3820C>TMissense_Mutation10.11A204N1200N
NF1RQRVIAILDSOFT_TISSUE1968p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1N100Y
NF1RVIAILDKLSOFT_TISSUE1970p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1N1800N
NF1SEFSPQLRSSOFT_TISSUE1355p.P1358Sc.4072C>TMissense_Mutation10.11G402N400N
NF1SMQTFFRGNSOFT_TISSUE1270p.L1274Fc.3820C>TMissense_Mutation10.11A204N100N
NF1SPQLRSVCHSOFT_TISSUE1358p.P1358Sc.4072C>TMissense_Mutation10.11G402N000N
NF1SSEFSPQLRSOFT_TISSUE1354p.P1358Sc.4072C>TMissense_Mutation10.11G402N400N
NF1SSSEFSPQLSOFT_TISSUE1353p.P1358Sc.4072C>TMissense_Mutation10.11G402Y1290N
NF1SSSSEFSPQSOFT_TISSUE1352p.P1358Sc.4072C>TMissense_Mutation10.11G402N000N
NF1TFFRGNSLASOFT_TISSUE1273p.L1274Fc.3820C>TMissense_Mutation10.11A204N100N
NF1TPWLLNLVRSOFT_TISSUE1950p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1N900N
NF1VIAILDKLISOFT_TISSUE1971p.T1972Ic.5915C>TMissense_Mutation10.11SKLMS1N500N
NF1WLLNLVRFCSOFT_TISSUE1952p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1Y61029N
NF1YMTPWLLNLSOFT_TISSUE1948p.S1954Lc.5861C>TMissense_Mutation10.11SKLMS1Y15103N
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13A204N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13A204N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13G401N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13G402N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13G402N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13GCTN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS729N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HT1080N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HT1080N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYM1N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13RDN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13RH41N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13RH41N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13RKNN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13RKNN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13S117N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SJRH30N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SJRH30N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKLMS1N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKUT1N101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE125TN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE125TN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE159TN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE441TN101Y
NR1H2IRKQQQQQESOFT_TISSUE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE617TN101Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13A204N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13A204N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13G401N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13G402N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13G402N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13GCTN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS729N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HT1080N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HT1080N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYM1N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13RDN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13RH41N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13RH41N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13RKNN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13RKNN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13S117N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SJRH30N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SJRH30N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKLMS1N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKUT1N000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE125TN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE125TN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE159TN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE441TN000Y
NR1H2KIRKQQQQQSOFT_TISSUE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE617TN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13A204N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13A204N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13G401N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13G402N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13G402N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13GCTN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS729N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HT1080N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HT1080N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13KYM1N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13RDN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13RH41N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13RH41N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13RKNN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13RKNN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13S117N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SJRH30N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SJRH30N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKLMS1N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKUT1N000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE125TN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE125TN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13TE159TN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE441TN000Y
NR1H2KQQQQQESQSOFT_TISSUE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13TE617TN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13A204N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13A204N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13G401N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13G402N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13G402N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13GCTN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS729N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HT1080N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HT1080N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13KYM1N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13RDN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13RH41N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13RH41N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13RKNN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13RKNN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13S117N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SJRH30N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SJRH30N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKLMS1N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKUT1N000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE125TN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE125TN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13TE159TN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE441TN000Y
NR1H2QQQQQESQSSOFT_TISSUE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13TE617TN000Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13A204N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13A204N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13G401N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13G402N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13G402N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13GCTN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HS729N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HT1080N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HT1080N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13KYM1N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13RDN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13RH41N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13RH41N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13RKNN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13RKNN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13S117N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SJRH30N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SJRH30N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SKLMS1N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SKUT1N100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE125TN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13TE125TN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13TE159TN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13TE441TN100Y
NR1H2RKQQQQQESSOFT_TISSUE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13TE617TN100Y
NRASAGKEEYSAMSOFT_TISSUE59p.Q61Kc.181C>AMissense_Mutation11.66HT1080Y6100N
NRASDILDTAGKESOFT_TISSUE54p.Q61Kc.181C>AMissense_Mutation11.66HT1080N000N
NRASDTAGKEEYSSOFT_TISSUE57p.Q61Kc.181C>AMissense_Mutation11.66HT1080N000N
NRASGKEEYSAMRSOFT_TISSUE60p.Q61Kc.181C>AMissense_Mutation11.66HT1080N200N
NRASILDTAGKEESOFT_TISSUE55p.Q61Kc.181C>AMissense_Mutation11.66HT1080N000N
NRASKEEYSAMRDSOFT_TISSUE61p.Q61Kc.181C>AMissense_Mutation11.66HT1080N000N
NRASLDILDTAGKSOFT_TISSUE53p.Q61Kc.181C>AMissense_Mutation11.66HT1080N006N
NRASLDTAGKEEYSOFT_TISSUE56p.Q61Kc.181C>AMissense_Mutation11.66HT1080N500N
NRASTAGKEEYSASOFT_TISSUE58p.Q61Kc.181C>AMissense_Mutation11.66HT1080N300N
NRASAGHEEYSAMSOFT_TISSUE59p.Q61Hc.183A>TMissense_Mutation10.44RDY6100N
NRASDILDTAGHESOFT_TISSUE54p.Q61Hc.183A>TMissense_Mutation10.44RDN000N
NRASDTAGHEEYSSOFT_TISSUE57p.Q61Hc.183A>TMissense_Mutation10.44RDN000N
NRASGHEEYSAMRSOFT_TISSUE60p.Q61Hc.183A>TMissense_Mutation10.44RDN300N
NRASHEEYSAMRDSOFT_TISSUE61p.Q61Hc.183A>TMissense_Mutation10.44RDN000N
NRASILDTAGHEESOFT_TISSUE55p.Q61Hc.183A>TMissense_Mutation10.44RDN000N
NRASLDILDTAGHSOFT_TISSUE53p.Q61Hc.183A>TMissense_Mutation10.44RDN0017N
NRASLDTAGHEEYSOFT_TISSUE56p.Q61Hc.183A>TMissense_Mutation10.44RDN400N
NRASTAGHEEYSASOFT_TISSUE58p.Q61Hc.183A>TMissense_Mutation10.44RDN200N
PDE4DIPANLDQGRVRSOFT_TISSUE603p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYM1Y2110N
PDE4DIPATCSANLDQSOFT_TISSUE599p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYM1N000N
PDE4DIPCSANLDQGRSOFT_TISSUE601p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYM1N300N
PDE4DIPDLSATCSANSOFT_TISSUE596p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYM1N000N
PDE4DIPEDLSATCSASOFT_TISSUE595p.L601fsc.1801_1801delCFrame_Shift_Del315.49KYM1N400N
PDE4DIPEVEDLSATCSOFT_TISSUE593p.L601fsc.1801_1801delCFrame_Shift_Del115.49KYM1N200N
PDE4DIPLSATCSANLSOFT_TISSUE597p.L601fsc.1801_1801delCFrame_Shift_Del415.49KYM1N1102N
PDE4DIPSANLDQGRVSOFT_TISSUE602p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYM1N400N
PDE4DIPSATCSANLDSOFT_TISSUE598p.L601fsc.1801_1801delCFrame_Shift_Del515.49KYM1N000N
PDE4DIPTCSANLDQGSOFT_TISSUE600p.L601fsc.1801_1801delCFrame_Shift_Del615.49KYM1N100N
PDE4DIPVEDLSATCSSOFT_TISSUE594p.L601fsc.1801_1801delCFrame_Shift_Del215.49KYM1N300N
PDE4DIPADSRKKSSKSOFT_TISSUE242p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1N000Y
PDE4DIPDSHLADSRKSOFT_TISSUE238p.E243fsc.729_729delAFrame_Shift_Del417.59KYM1N200N
PDE4DIPDSRKKSSKQSOFT_TISSUE243p.E243fsc.729_729delAFrame_Shift_Del417.59KYM1N200Y
PDE4DIPHLADSRKKSSOFT_TISSUE240p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1N000N
PDE4DIPKKSSKQRPPSOFT_TISSUE246p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1N100Y
PDE4DIPKQRPPTRFFSOFT_TISSUE250p.E243fsc.729_729delAFrame_Shift_Del617.59KYM1Y7100Y
PDE4DIPKSSKQRPPTSOFT_TISSUE247p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1N200Y
PDE4DIPLADSRKKSSSOFT_TISSUE241p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1N100N
PDE4DIPPPTRFFKRNSOFT_TISSUE253p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1N000Y
PDE4DIPPTRFFKRNLSOFT_TISSUE254p.E243fsc.729_729delAFrame_Shift_Del617.59KYM1Y2110Y
PDE4DIPQRPPTRFFKSOFT_TISSUE251p.E243fsc.729_729delAFrame_Shift_Del617.59KYM1Y2100Y
PDE4DIPRFFKRNLMKSOFT_TISSUE256p.E243fsc.729_729delAFrame_Shift_Del617.59KYM1Y2130N
PDE4DIPRKKSSKQRPSOFT_TISSUE245p.E243fsc.729_729delAFrame_Shift_Del417.59KYM1N100Y
PDE4DIPRPPTRFFKRSOFT_TISSUE252p.E243fsc.729_729delAFrame_Shift_Del617.59KYM1Y590Y
PDE4DIPSDSHLADSRSOFT_TISSUE237p.E243fsc.729_729delAFrame_Shift_Del317.59KYM1N000N
PDE4DIPSHLADSRKKSOFT_TISSUE239p.E243fsc.729_729delAFrame_Shift_Del417.59KYM1N000N
PDE4DIPSKQRPPTRFSOFT_TISSUE249p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1N200Y
PDE4DIPSRKKSSKQRSOFT_TISSUE244p.E243fsc.729_729delAFrame_Shift_Del417.59KYM1Y390Y
PDE4DIPSSKQRPPTRSOFT_TISSUE248p.E243fsc.729_729delAFrame_Shift_Del517.59KYM1Y390Y
PDE4DIPSVSDSHLADSOFT_TISSUE235p.E243fsc.729_729delAFrame_Shift_Del117.59KYM1N000N
PDE4DIPTRFFKRNLMSOFT_TISSUE255p.E243fsc.729_729delAFrame_Shift_Del617.59KYM1Y390Y
PDE4DIPVSDSHLADSSOFT_TISSUE236p.E243fsc.729_729delAFrame_Shift_Del217.59KYM1N100N
PDE4DIPDKAVLWSGLSOFT_TISSUE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58A204N400N
PDE4DIPDKAVLWSGLSOFT_TISSUE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58GCTN400N
PDE4DIPDKAVLWSGLSOFT_TISSUE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58HS729N400N
PDE4DIPDKAVLWSGLSOFT_TISSUE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58RDN400N
PDE4DIPDKAVLWSGLSOFT_TISSUE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58RH41N400N
PDE4DIPDKAVLWSGLSOFT_TISSUE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58SKLMS1N400N
PDE4DIPDKAVLWSGLSOFT_TISSUE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58SKUT1N400N
PDE4DIPHDKAVLWSGSOFT_TISSUE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58A204N000N
PDE4DIPHDKAVLWSGSOFT_TISSUE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58GCTN000N
PDE4DIPHDKAVLWSGSOFT_TISSUE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58HS729N000N
PDE4DIPHDKAVLWSGSOFT_TISSUE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58RDN000N
PDE4DIPHDKAVLWSGSOFT_TISSUE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58RH41N000N
PDE4DIPHDKAVLWSGSOFT_TISSUE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58SKLMS1N000N
PDE4DIPHDKAVLWSGSOFT_TISSUE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58SKUT1N000N
PDE4DIPIHDKAVLWSSOFT_TISSUE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58A204N2020N
PDE4DIPIHDKAVLWSSOFT_TISSUE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58GCTN2020N
PDE4DIPIHDKAVLWSSOFT_TISSUE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58HS729N2020N
PDE4DIPIHDKAVLWSSOFT_TISSUE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58RDN2020N
PDE4DIPIHDKAVLWSSOFT_TISSUE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58RH41N2020N
PDE4DIPIHDKAVLWSSOFT_TISSUE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58SKLMS1N2020N
PDE4DIPIHDKAVLWSSOFT_TISSUE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58SKUT1N2020N
PDE4DIPQRIHDKAVLSOFT_TISSUE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58A204N600N
PDE4DIPQRIHDKAVLSOFT_TISSUE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58GCTN600N
PDE4DIPQRIHDKAVLSOFT_TISSUE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58HS729N600N
PDE4DIPQRIHDKAVLSOFT_TISSUE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58RDN600N
PDE4DIPQRIHDKAVLSOFT_TISSUE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58RH41N600N
PDE4DIPQRIHDKAVLSOFT_TISSUE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58SKLMS1N600N
PDE4DIPQRIHDKAVLSOFT_TISSUE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58SKUT1N600N
PDE4DIPRIHDKAVLWSOFT_TISSUE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58A204N400N
PDE4DIPRIHDKAVLWSOFT_TISSUE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58GCTN400N
PDE4DIPRIHDKAVLWSOFT_TISSUE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58HS729N400N
PDE4DIPRIHDKAVLWSOFT_TISSUE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58RDN400N
PDE4DIPRIHDKAVLWSOFT_TISSUE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58RH41N400N
PDE4DIPRIHDKAVLWSOFT_TISSUE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58SKLMS1N400N
PDE4DIPRIHDKAVLWSOFT_TISSUE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58SKUT1N400N
PDE4DIPAAVRHQWSPSOFT_TISSUE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N000N
PDE4DIPAAVRHQWSPSOFT_TISSUE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN000N
PDE4DIPAAVRHQWSPSOFT_TISSUE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N000N
PDE4DIPAAVRHQWSPSOFT_TISSUE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N000N
PDE4DIPAAVRHQWSPSOFT_TISSUE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N000N
PDE4DIPACQLPRIPPSOFT_TISSUE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N000N
PDE4DIPACQLPRIPPSOFT_TISSUE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN000N
PDE4DIPACQLPRIPPSOFT_TISSUE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N000N
PDE4DIPACQLPRIPPSOFT_TISSUE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N000N
PDE4DIPACQLPRIPPSOFT_TISSUE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N000N
PDE4DIPAFIFTPYPSSOFT_TISSUE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPAFIFTPYPSSOFT_TISSUE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPAFIFTPYPSSOFT_TISSUE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPAFIFTPYPSSOFT_TISSUE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPAFIFTPYPSSOFT_TISSUE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPAFLRHHCPQSOFT_TISSUE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPAFLRHHCPQSOFT_TISSUE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPAFLRHHCPQSOFT_TISSUE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPAFLRHHCPQSOFT_TISSUE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPAFLRHHCPQSOFT_TISSUE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPALFLLLPQLSOFT_TISSUE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y16110N
PDE4DIPALFLLLPQLSOFT_TISSUE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY16110N
PDE4DIPALFLLLPQLSOFT_TISSUE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y16110N
PDE4DIPALFLLLPQLSOFT_TISSUE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y16110N
PDE4DIPALFLLLPQLSOFT_TISSUE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y16110N
PDE4DIPALSSLAAVRSOFT_TISSUE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204Y6100N
PDE4DIPALSSLAAVRSOFT_TISSUE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTY6100N
PDE4DIPALSSLAAVRSOFT_TISSUE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41Y6100N
PDE4DIPALSSLAAVRSOFT_TISSUE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1Y6100N
PDE4DIPALSSLAAVRSOFT_TISSUE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1Y6100N
PDE4DIPAPLALSSLASOFT_TISSUE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N1000N
PDE4DIPAPLALSSLASOFT_TISSUE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN1000N
PDE4DIPAPLALSSLASOFT_TISSUE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N1000N
PDE4DIPAPLALSSLASOFT_TISSUE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N1000N
PDE4DIPAPLALSSLASOFT_TISSUE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N1000N
PDE4DIPASCLSAPLASOFT_TISSUE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N100N
PDE4DIPASCLSAPLASOFT_TISSUE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN100N
PDE4DIPASCLSAPLASOFT_TISSUE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N100N
PDE4DIPASCLSAPLASOFT_TISSUE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N100N
PDE4DIPASCLSAPLASOFT_TISSUE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N100N
PDE4DIPASRGLRPNPSOFT_TISSUE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000Y
PDE4DIPASRGLRPNPSOFT_TISSUE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000Y
PDE4DIPASRGLRPNPSOFT_TISSUE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000Y
PDE4DIPASRGLRPNPSOFT_TISSUE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000Y
PDE4DIPASRGLRPNPSOFT_TISSUE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000Y
PDE4DIPATPSACQLPSOFT_TISSUE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPATPSACQLPSOFT_TISSUE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPATPSACQLPSOFT_TISSUE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPATPSACQLPSOFT_TISSUE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPATPSACQLPSOFT_TISSUE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPAVRHQWSPWSOFT_TISSUE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N100N
PDE4DIPAVRHQWSPWSOFT_TISSUE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN100N
PDE4DIPAVRHQWSPWSOFT_TISSUE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N100N
PDE4DIPAVRHQWSPWSOFT_TISSUE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N100N
PDE4DIPAVRHQWSPWSOFT_TISSUE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N100N
PDE4DIPCCRSSWEKVSOFT_TISSUE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100N
PDE4DIPCCRSSWEKVSOFT_TISSUE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100N
PDE4DIPCCRSSWEKVSOFT_TISSUE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100N
PDE4DIPCCRSSWEKVSOFT_TISSUE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100N
PDE4DIPCCRSSWEKVSOFT_TISSUE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100N
PDE4DIPCLSAPLALSSOFT_TISSUE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPCLSAPLALSSOFT_TISSUE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPCLSAPLALSSOFT_TISSUE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPCLSAPLALSSOFT_TISSUE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPCLSAPLALSSOFT_TISSUE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPCPQLHPASCSOFT_TISSUE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N400N
PDE4DIPCPQLHPASCSOFT_TISSUE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN400N
PDE4DIPCPQLHPASCSOFT_TISSUE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N400N
PDE4DIPCPQLHPASCSOFT_TISSUE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N400N
PDE4DIPCPQLHPASCSOFT_TISSUE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N400N
PDE4DIPCQLPRIPPRSOFT_TISSUE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N600Y
PDE4DIPCQLPRIPPRSOFT_TISSUE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN600Y
PDE4DIPCQLPRIPPRSOFT_TISSUE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N600Y
PDE4DIPCQLPRIPPRSOFT_TISSUE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N600Y
PDE4DIPCQLPRIPPRSOFT_TISSUE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N600Y
PDE4DIPCRSSWEKVPSOFT_TISSUE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPCRSSWEKVPSOFT_TISSUE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPCRSSWEKVPSOFT_TISSUE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPCRSSWEKVPSOFT_TISSUE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPCRSSWEKVPSOFT_TISSUE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPEKVPALFLLSOFT_TISSUE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N800N
PDE4DIPEKVPALFLLSOFT_TISSUE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN800N
PDE4DIPEKVPALFLLSOFT_TISSUE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N800N
PDE4DIPEKVPALFLLSOFT_TISSUE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N800N
PDE4DIPEKVPALFLLSOFT_TISSUE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N800N
PDE4DIPFIFTPYPSWSOFT_TISSUE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N500N
PDE4DIPFIFTPYPSWSOFT_TISSUE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN500N
PDE4DIPFIFTPYPSWSOFT_TISSUE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N500N
PDE4DIPFIFTPYPSWSOFT_TISSUE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N500N
PDE4DIPFIFTPYPSWSOFT_TISSUE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N500N
PDE4DIPFLLLPQLHCSOFT_TISSUE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N7023N
PDE4DIPFLLLPQLHCSOFT_TISSUE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN7023N
PDE4DIPFLLLPQLHCSOFT_TISSUE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N7023N
PDE4DIPFLLLPQLHCSOFT_TISSUE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N7023N
PDE4DIPFLLLPQLHCSOFT_TISSUE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N7023N
PDE4DIPFLRHHCPQLSOFT_TISSUE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y1399N
PDE4DIPFLRHHCPQLSOFT_TISSUE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY1399N
PDE4DIPFLRHHCPQLSOFT_TISSUE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y1399N
PDE4DIPFLRHHCPQLSOFT_TISSUE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y1399N
PDE4DIPFLRHHCPQLSOFT_TISSUE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y1399N
PDE4DIPFTPYPSWLASOFT_TISSUE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N602N
PDE4DIPFTPYPSWLASOFT_TISSUE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN602N
PDE4DIPFTPYPSWLASOFT_TISSUE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N602N
PDE4DIPFTPYPSWLASOFT_TISSUE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N602N
PDE4DIPFTPYPSWLASOFT_TISSUE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N602N
PDE4DIPGLRPNPTATSOFT_TISSUE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N200N
PDE4DIPGLRPNPTATSOFT_TISSUE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN200N
PDE4DIPGLRPNPTATSOFT_TISSUE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N200N
PDE4DIPGLRPNPTATSOFT_TISSUE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N200N
PDE4DIPGLRPNPTATSOFT_TISSUE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N200N
PDE4DIPHCPQLHPASSOFT_TISSUE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100N
PDE4DIPHCPQLHPASSOFT_TISSUE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100N
PDE4DIPHCPQLHPASSOFT_TISSUE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100N
PDE4DIPHCPQLHPASSOFT_TISSUE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100N
PDE4DIPHCPQLHPASSOFT_TISSUE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100N
PDE4DIPHHCPQLHPASOFT_TISSUE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N200N
PDE4DIPHHCPQLHPASOFT_TISSUE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN200N
PDE4DIPHHCPQLHPASOFT_TISSUE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N200N
PDE4DIPHHCPQLHPASOFT_TISSUE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N200N
PDE4DIPHHCPQLHPASOFT_TISSUE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N200N
PDE4DIPHPASCLSAPSOFT_TISSUE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100N
PDE4DIPHPASCLSAPSOFT_TISSUE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100N
PDE4DIPHPASCLSAPSOFT_TISSUE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100N
PDE4DIPHPASCLSAPSOFT_TISSUE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100N
PDE4DIPHPASCLSAPSOFT_TISSUE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100N
PDE4DIPHQWSPWLRLSOFT_TISSUE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y14120Y
PDE4DIPHQWSPWLRLSOFT_TISSUE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY14120Y
PDE4DIPHQWSPWLRLSOFT_TISSUE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y14120Y
PDE4DIPHQWSPWLRLSOFT_TISSUE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y14120Y
PDE4DIPHQWSPWLRLSOFT_TISSUE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y14120Y
PDE4DIPIFTPYPSWLSOFT_TISSUE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N900N
PDE4DIPIFTPYPSWLSOFT_TISSUE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN900N
PDE4DIPIFTPYPSWLSOFT_TISSUE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N900N
PDE4DIPIFTPYPSWLSOFT_TISSUE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N900N
PDE4DIPIFTPYPSWLSOFT_TISSUE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N900N
PDE4DIPIPPRRPTRPSOFT_TISSUE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100N
PDE4DIPIPPRRPTRPSOFT_TISSUE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100N
PDE4DIPIPPRRPTRPSOFT_TISSUE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100N
PDE4DIPIPPRRPTRPSOFT_TISSUE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100N
PDE4DIPIPPRRPTRPSOFT_TISSUE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100N
PDE4DIPIQAFIFTPYSOFT_TISSUE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N900N
PDE4DIPIQAFIFTPYSOFT_TISSUE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN900N
PDE4DIPIQAFIFTPYSOFT_TISSUE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N900N
PDE4DIPIQAFIFTPYSOFT_TISSUE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N900N
PDE4DIPIQAFIFTPYSOFT_TISSUE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N900N
PDE4DIPKPSSTSASRSOFT_TISSUE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35A204Y490N
PDE4DIPKPSSTSASRSOFT_TISSUE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35GCTY490N
PDE4DIPKPSSTSASRSOFT_TISSUE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35RH41Y490N
PDE4DIPKPSSTSASRSOFT_TISSUE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKLMS1Y490N
PDE4DIPKPSSTSASRSOFT_TISSUE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKUT1Y490N
PDE4DIPKVPALFLLLSOFT_TISSUE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y1890N
PDE4DIPKVPALFLLLSOFT_TISSUE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY1890N
PDE4DIPKVPALFLLLSOFT_TISSUE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y1890N
PDE4DIPKVPALFLLLSOFT_TISSUE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y1890N
PDE4DIPKVPALFLLLSOFT_TISSUE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y1890N
PDE4DIPLAAVRHQWSSOFT_TISSUE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100N
PDE4DIPLAAVRHQWSSOFT_TISSUE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100N
PDE4DIPLAAVRHQWSSOFT_TISSUE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100N
PDE4DIPLAAVRHQWSSOFT_TISSUE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100N
PDE4DIPLAAVRHQWSSOFT_TISSUE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100N
PDE4DIPLAFLRHHCPSOFT_TISSUE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N000N
PDE4DIPLAFLRHHCPSOFT_TISSUE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN000N
PDE4DIPLAFLRHHCPSOFT_TISSUE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N000N
PDE4DIPLAFLRHHCPSOFT_TISSUE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N000N
PDE4DIPLAFLRHHCPSOFT_TISSUE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N000N
PDE4DIPLALSSLAAVSOFT_TISSUE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N1000N
PDE4DIPLALSSLAAVSOFT_TISSUE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN1000N
PDE4DIPLALSSLAAVSOFT_TISSUE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N1000N
PDE4DIPLALSSLAAVSOFT_TISSUE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N1000N
PDE4DIPLALSSLAAVSOFT_TISSUE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N1000N
PDE4DIPLFLLLPQLHSOFT_TISSUE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N0032N
PDE4DIPLFLLLPQLHSOFT_TISSUE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN0032N
PDE4DIPLFLLLPQLHSOFT_TISSUE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N0032N
PDE4DIPLFLLLPQLHSOFT_TISSUE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N0032N
PDE4DIPLFLLLPQLHSOFT_TISSUE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N0032N
PDE4DIPLHPASCLSASOFT_TISSUE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N307N
PDE4DIPLHPASCLSASOFT_TISSUE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN307N
PDE4DIPLHPASCLSASOFT_TISSUE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N307N
PDE4DIPLHPASCLSASOFT_TISSUE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N307N
PDE4DIPLHPASCLSASOFT_TISSUE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N307N
PDE4DIPLPRIPPRRPSOFT_TISSUE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100N
PDE4DIPLPRIPPRRPSOFT_TISSUE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100N
PDE4DIPLPRIPPRRPSOFT_TISSUE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100N
PDE4DIPLPRIPPRRPSOFT_TISSUE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100N
PDE4DIPLPRIPPRRPSOFT_TISSUE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100N
PDE4DIPLRHHCPQLHSOFT_TISSUE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N2020N
PDE4DIPLRHHCPQLHSOFT_TISSUE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN2020N
PDE4DIPLRHHCPQLHSOFT_TISSUE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N2020N
PDE4DIPLRHHCPQLHSOFT_TISSUE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N2020N
PDE4DIPLRHHCPQLHSOFT_TISSUE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N2020N
PDE4DIPLRLSRSYRCSOFT_TISSUE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N3033N
PDE4DIPLRLSRSYRCSOFT_TISSUE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN3033N
PDE4DIPLRLSRSYRCSOFT_TISSUE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N3033N
PDE4DIPLRLSRSYRCSOFT_TISSUE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N3033N
PDE4DIPLRLSRSYRCSOFT_TISSUE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N3033N
PDE4DIPLRPNPTATPSOFT_TISSUE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N1029N
PDE4DIPLRPNPTATPSOFT_TISSUE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN1029N
PDE4DIPLRPNPTATPSOFT_TISSUE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N1029N
PDE4DIPLRPNPTATPSOFT_TISSUE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N1029N
PDE4DIPLRPNPTATPSOFT_TISSUE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N1029N
PDE4DIPLSAPLALSSSOFT_TISSUE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N200N
PDE4DIPLSAPLALSSSOFT_TISSUE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN200N
PDE4DIPLSAPLALSSSOFT_TISSUE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N200N
PDE4DIPLSAPLALSSSOFT_TISSUE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N200N
PDE4DIPLSAPLALSSSOFT_TISSUE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N200N
PDE4DIPLSRSYRCCRSOFT_TISSUE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N300N
PDE4DIPLSRSYRCCRSOFT_TISSUE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN300N
PDE4DIPLSRSYRCCRSOFT_TISSUE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N300N
PDE4DIPLSRSYRCCRSOFT_TISSUE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N300N
PDE4DIPLSRSYRCCRSOFT_TISSUE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N300N
PDE4DIPLSSLAAVRHSOFT_TISSUE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPLSSLAAVRHSOFT_TISSUE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPLSSLAAVRHSOFT_TISSUE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPLSSLAAVRHSOFT_TISSUE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPLSSLAAVRHSOFT_TISSUE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPNPTATPSACSOFT_TISSUE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N400N
PDE4DIPNPTATPSACSOFT_TISSUE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN400N
PDE4DIPNPTATPSACSOFT_TISSUE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N400N
PDE4DIPNPTATPSACSOFT_TISSUE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N400N
PDE4DIPNPTATPSACSOFT_TISSUE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N400N
PDE4DIPPALFLLLPQSOFT_TISSUE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPALFLLLPQSOFT_TISSUE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPALFLLLPQSOFT_TISSUE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPALFLLLPQSOFT_TISSUE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPALFLLLPQSOFT_TISSUE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPASCLSAPLSOFT_TISSUE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N000N
PDE4DIPPASCLSAPLSOFT_TISSUE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN000N
PDE4DIPPASCLSAPLSOFT_TISSUE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N000N
PDE4DIPPASCLSAPLSOFT_TISSUE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N000N
PDE4DIPPASCLSAPLSOFT_TISSUE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N000N
PDE4DIPPIQAFIFTPSOFT_TISSUE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N000N
PDE4DIPPIQAFIFTPSOFT_TISSUE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN000N
PDE4DIPPIQAFIFTPSOFT_TISSUE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N000N
PDE4DIPPIQAFIFTPSOFT_TISSUE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N000N
PDE4DIPPIQAFIFTPSOFT_TISSUE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N000N
PDE4DIPPLALSSLAASOFT_TISSUE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N100N
PDE4DIPPLALSSLAASOFT_TISSUE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN100N
PDE4DIPPLALSSLAASOFT_TISSUE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N100N
PDE4DIPPLALSSLAASOFT_TISSUE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N100N
PDE4DIPPLALSSLAASOFT_TISSUE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N100N
PDE4DIPPNPTATPSASOFT_TISSUE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPNPTATPSASOFT_TISSUE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPNPTATPSASOFT_TISSUE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPNPTATPSASOFT_TISSUE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPNPTATPSASOFT_TISSUE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPPRRPTRPISOFT_TISSUE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N900N
PDE4DIPPPRRPTRPISOFT_TISSUE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN900N
PDE4DIPPPRRPTRPISOFT_TISSUE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N900N
PDE4DIPPPRRPTRPISOFT_TISSUE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N900N
PDE4DIPPPRRPTRPISOFT_TISSUE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N900N
PDE4DIPPQLHPASCLSOFT_TISSUE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N200N
PDE4DIPPQLHPASCLSOFT_TISSUE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN200N
PDE4DIPPQLHPASCLSOFT_TISSUE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N200N
PDE4DIPPQLHPASCLSOFT_TISSUE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N200N
PDE4DIPPQLHPASCLSOFT_TISSUE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N200N
PDE4DIPPRIPPRRPTSOFT_TISSUE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPRIPPRRPTSOFT_TISSUE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPRIPPRRPTSOFT_TISSUE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPRIPPRRPTSOFT_TISSUE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPRIPPRRPTSOFT_TISSUE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPRRPTRPIQSOFT_TISSUE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPRRPTRPIQSOFT_TISSUE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPRRPTRPIQSOFT_TISSUE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPRRPTRPIQSOFT_TISSUE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPRRPTRPIQSOFT_TISSUE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPSACQLPRISOFT_TISSUE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPSACQLPRISOFT_TISSUE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPSACQLPRISOFT_TISSUE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPSACQLPRISOFT_TISSUE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPSACQLPRISOFT_TISSUE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPSSTSASRGSOFT_TISSUE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35A204N000Y
PDE4DIPPSSTSASRGSOFT_TISSUE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35GCTN000Y
PDE4DIPPSSTSASRGSOFT_TISSUE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35RH41N000Y
PDE4DIPPSSTSASRGSOFT_TISSUE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKLMS1N000Y
PDE4DIPPSSTSASRGSOFT_TISSUE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKUT1N000Y
PDE4DIPPSWLAFLRHSOFT_TISSUE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPSWLAFLRHSOFT_TISSUE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPSWLAFLRHSOFT_TISSUE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPSWLAFLRHSOFT_TISSUE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPSWLAFLRHSOFT_TISSUE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPTATPSACQSOFT_TISSUE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPTATPSACQSOFT_TISSUE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPTATPSACQSOFT_TISSUE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPTATPSACQSOFT_TISSUE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPTATPSACQSOFT_TISSUE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPTRPIQAFISOFT_TISSUE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPPTRPIQAFISOFT_TISSUE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPPTRPIQAFISOFT_TISSUE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPPTRPIQAFISOFT_TISSUE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPPTRPIQAFISOFT_TISSUE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPPWLRLSRSYSOFT_TISSUE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N000N
PDE4DIPPWLRLSRSYSOFT_TISSUE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN000N
PDE4DIPPWLRLSRSYSOFT_TISSUE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N000N
PDE4DIPPWLRLSRSYSOFT_TISSUE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N000N
PDE4DIPPWLRLSRSYSOFT_TISSUE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N000N
PDE4DIPPYPSWLAFLSOFT_TISSUE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y4100N
PDE4DIPPYPSWLAFLSOFT_TISSUE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY4100N
PDE4DIPPYPSWLAFLSOFT_TISSUE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y4100N
PDE4DIPPYPSWLAFLSOFT_TISSUE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y4100N
PDE4DIPPYPSWLAFLSOFT_TISSUE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y4100N
PDE4DIPQAFIFTPYPSOFT_TISSUE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N000N
PDE4DIPQAFIFTPYPSOFT_TISSUE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN000N
PDE4DIPQAFIFTPYPSOFT_TISSUE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N000N
PDE4DIPQAFIFTPYPSOFT_TISSUE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N000N
PDE4DIPQAFIFTPYPSOFT_TISSUE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N000N
PDE4DIPQLHPASCLSSOFT_TISSUE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPQLHPASCLSSOFT_TISSUE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPQLHPASCLSSOFT_TISSUE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPQLHPASCLSSOFT_TISSUE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPQLHPASCLSSOFT_TISSUE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPQLPRIPPRRSOFT_TISSUE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N500Y
PDE4DIPQLPRIPPRRSOFT_TISSUE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN500Y
PDE4DIPQLPRIPPRRSOFT_TISSUE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N500Y
PDE4DIPQLPRIPPRRSOFT_TISSUE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N500Y
PDE4DIPQLPRIPPRRSOFT_TISSUE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N500Y
PDE4DIPQWSPWLRLSSOFT_TISSUE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPQWSPWLRLSSOFT_TISSUE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPQWSPWLRLSSOFT_TISSUE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPQWSPWLRLSSOFT_TISSUE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPQWSPWLRLSSOFT_TISSUE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPRCCRSSWEKSOFT_TISSUE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y4100N
PDE4DIPRCCRSSWEKSOFT_TISSUE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY4100N
PDE4DIPRCCRSSWEKSOFT_TISSUE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y4100N
PDE4DIPRCCRSSWEKSOFT_TISSUE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y4100N
PDE4DIPRCCRSSWEKSOFT_TISSUE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y4100N
PDE4DIPRGLRPNPTASOFT_TISSUE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N400N
PDE4DIPRGLRPNPTASOFT_TISSUE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN400N
PDE4DIPRGLRPNPTASOFT_TISSUE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N400N
PDE4DIPRGLRPNPTASOFT_TISSUE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N400N
PDE4DIPRGLRPNPTASOFT_TISSUE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N400N
PDE4DIPRHHCPQLHPSOFT_TISSUE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N000N
PDE4DIPRHHCPQLHPSOFT_TISSUE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN000N
PDE4DIPRHHCPQLHPSOFT_TISSUE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N000N
PDE4DIPRHHCPQLHPSOFT_TISSUE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N000N
PDE4DIPRHHCPQLHPSOFT_TISSUE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N000N
PDE4DIPRHQWSPWLRSOFT_TISSUE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100Y
PDE4DIPRHQWSPWLRSOFT_TISSUE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100Y
PDE4DIPRHQWSPWLRSOFT_TISSUE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100Y
PDE4DIPRHQWSPWLRSOFT_TISSUE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100Y
PDE4DIPRHQWSPWLRSOFT_TISSUE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100Y
PDE4DIPRIPPRRPTRSOFT_TISSUE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204Y790N
PDE4DIPRIPPRRPTRSOFT_TISSUE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTY790N
PDE4DIPRIPPRRPTRSOFT_TISSUE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41Y790N
PDE4DIPRIPPRRPTRSOFT_TISSUE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1Y790N
PDE4DIPRIPPRRPTRSOFT_TISSUE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1Y790N
PDE4DIPRLSRSYRCCSOFT_TISSUE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y290N
PDE4DIPRLSRSYRCCSOFT_TISSUE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY290N
PDE4DIPRLSRSYRCCSOFT_TISSUE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y290N
PDE4DIPRLSRSYRCCSOFT_TISSUE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y290N
PDE4DIPRLSRSYRCCSOFT_TISSUE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y290N
PDE4DIPRPIQAFIFTSOFT_TISSUE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N500N
PDE4DIPRPIQAFIFTSOFT_TISSUE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN500N
PDE4DIPRPIQAFIFTSOFT_TISSUE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N500N
PDE4DIPRPIQAFIFTSOFT_TISSUE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N500N
PDE4DIPRPIQAFIFTSOFT_TISSUE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N500N
PDE4DIPRPNPTATPSSOFT_TISSUE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N300N
PDE4DIPRPNPTATPSSOFT_TISSUE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN300N
PDE4DIPRPNPTATPSSOFT_TISSUE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N300N
PDE4DIPRPNPTATPSSOFT_TISSUE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N300N
PDE4DIPRPNPTATPSSOFT_TISSUE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N300N
PDE4DIPRPTRPIQAFSOFT_TISSUE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y12100N
PDE4DIPRPTRPIQAFSOFT_TISSUE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY12100N
PDE4DIPRPTRPIQAFSOFT_TISSUE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y12100N
PDE4DIPRPTRPIQAFSOFT_TISSUE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y12100N
PDE4DIPRPTRPIQAFSOFT_TISSUE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y12100N
PDE4DIPRRPTRPIQASOFT_TISSUE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N500N
PDE4DIPRRPTRPIQASOFT_TISSUE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN500N
PDE4DIPRRPTRPIQASOFT_TISSUE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N500N
PDE4DIPRRPTRPIQASOFT_TISSUE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N500N
PDE4DIPRRPTRPIQASOFT_TISSUE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N500N
PDE4DIPRSSWEKVPASOFT_TISSUE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N200N
PDE4DIPRSSWEKVPASOFT_TISSUE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN200N
PDE4DIPRSSWEKVPASOFT_TISSUE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N200N
PDE4DIPRSSWEKVPASOFT_TISSUE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N200N
PDE4DIPRSSWEKVPASOFT_TISSUE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N200N
PDE4DIPRSYRCCRSSSOFT_TISSUE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100N
PDE4DIPRSYRCCRSSSOFT_TISSUE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100N
PDE4DIPRSYRCCRSSSOFT_TISSUE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100N
PDE4DIPRSYRCCRSSSOFT_TISSUE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100N
PDE4DIPRSYRCCRSSSOFT_TISSUE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100N
PDE4DIPSACQLPRIPSOFT_TISSUE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPSACQLPRIPSOFT_TISSUE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPSACQLPRIPSOFT_TISSUE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPSACQLPRIPSOFT_TISSUE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPSACQLPRIPSOFT_TISSUE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPSAPLALSSLSOFT_TISSUE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y15100N
PDE4DIPSAPLALSSLSOFT_TISSUE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY15100N
PDE4DIPSAPLALSSLSOFT_TISSUE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y15100N
PDE4DIPSAPLALSSLSOFT_TISSUE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y15100N
PDE4DIPSAPLALSSLSOFT_TISSUE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y15100N
PDE4DIPSASRGLRPNSOFT_TISSUE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N100Y
PDE4DIPSASRGLRPNSOFT_TISSUE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN100Y
PDE4DIPSASRGLRPNSOFT_TISSUE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N100Y
PDE4DIPSASRGLRPNSOFT_TISSUE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N100Y
PDE4DIPSASRGLRPNSOFT_TISSUE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N100Y
PDE4DIPSCLSAPLALSOFT_TISSUE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N1000N
PDE4DIPSCLSAPLALSOFT_TISSUE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN1000N
PDE4DIPSCLSAPLALSOFT_TISSUE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N1000N
PDE4DIPSCLSAPLALSOFT_TISSUE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N1000N
PDE4DIPSCLSAPLALSOFT_TISSUE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N1000N
PDE4DIPSLAAVRHQWSOFT_TISSUE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N300N
PDE4DIPSLAAVRHQWSOFT_TISSUE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN300N
PDE4DIPSLAAVRHQWSOFT_TISSUE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N300N
PDE4DIPSLAAVRHQWSOFT_TISSUE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N300N
PDE4DIPSLAAVRHQWSOFT_TISSUE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N300N
PDE4DIPSPWLRLSRSSOFT_TISSUE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N500Y
PDE4DIPSPWLRLSRSSOFT_TISSUE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN500Y
PDE4DIPSPWLRLSRSSOFT_TISSUE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N500Y
PDE4DIPSPWLRLSRSSOFT_TISSUE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N500Y
PDE4DIPSPWLRLSRSSOFT_TISSUE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N500Y
PDE4DIPSRGLRPNPTSOFT_TISSUE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N300Y
PDE4DIPSRGLRPNPTSOFT_TISSUE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN300Y
PDE4DIPSRGLRPNPTSOFT_TISSUE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N300Y
PDE4DIPSRGLRPNPTSOFT_TISSUE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N300Y
PDE4DIPSRGLRPNPTSOFT_TISSUE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N300Y
PDE4DIPSRSYRCCRSSOFT_TISSUE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N300N
PDE4DIPSRSYRCCRSSOFT_TISSUE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN300N
PDE4DIPSRSYRCCRSSOFT_TISSUE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N300N
PDE4DIPSRSYRCCRSSOFT_TISSUE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N300N
PDE4DIPSRSYRCCRSSOFT_TISSUE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N300N
PDE4DIPSSLAAVRHQSOFT_TISSUE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N000Y
PDE4DIPSSLAAVRHQSOFT_TISSUE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN000Y
PDE4DIPSSLAAVRHQSOFT_TISSUE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N000Y
PDE4DIPSSLAAVRHQSOFT_TISSUE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N000Y
PDE4DIPSSLAAVRHQSOFT_TISSUE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N000Y
PDE4DIPSSTSASRGLSOFT_TISSUE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35A204N700N
PDE4DIPSSTSASRGLSOFT_TISSUE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35GCTN700N
PDE4DIPSSTSASRGLSOFT_TISSUE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35RH41N700N
PDE4DIPSSTSASRGLSOFT_TISSUE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35SKLMS1N700N
PDE4DIPSSTSASRGLSOFT_TISSUE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35SKUT1N700N
PDE4DIPSSWEKVPALSOFT_TISSUE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y1990N
PDE4DIPSSWEKVPALSOFT_TISSUE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY1990N
PDE4DIPSSWEKVPALSOFT_TISSUE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y1990N
PDE4DIPSSWEKVPALSOFT_TISSUE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y1990N
PDE4DIPSSWEKVPALSOFT_TISSUE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y1990N
PDE4DIPSTSASRGLRSOFT_TISSUE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35A204N400N
PDE4DIPSTSASRGLRSOFT_TISSUE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35GCTN400N
PDE4DIPSTSASRGLRSOFT_TISSUE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35RH41N400N
PDE4DIPSTSASRGLRSOFT_TISSUE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35SKLMS1N400N
PDE4DIPSTSASRGLRSOFT_TISSUE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35SKUT1N400N
PDE4DIPSWEKVPALFSOFT_TISSUE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N300N
PDE4DIPSWEKVPALFSOFT_TISSUE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN300N
PDE4DIPSWEKVPALFSOFT_TISSUE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N300N
PDE4DIPSWEKVPALFSOFT_TISSUE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N300N
PDE4DIPSWEKVPALFSOFT_TISSUE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N300N
PDE4DIPSWLAFLRHHSOFT_TISSUE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N000N
PDE4DIPSWLAFLRHHSOFT_TISSUE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN000N
PDE4DIPSWLAFLRHHSOFT_TISSUE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N000N
PDE4DIPSWLAFLRHHSOFT_TISSUE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N000N
PDE4DIPSWLAFLRHHSOFT_TISSUE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N000N
PDE4DIPSYRCCRSSWSOFT_TISSUE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204Y2100N
PDE4DIPSYRCCRSSWSOFT_TISSUE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTY2100N
PDE4DIPSYRCCRSSWSOFT_TISSUE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41Y2100N
PDE4DIPSYRCCRSSWSOFT_TISSUE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1Y2100N
PDE4DIPSYRCCRSSWSOFT_TISSUE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1Y2100N
PDE4DIPTATPSACQLSOFT_TISSUE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N1100N
PDE4DIPTATPSACQLSOFT_TISSUE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN1100N
PDE4DIPTATPSACQLSOFT_TISSUE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N1100N
PDE4DIPTATPSACQLSOFT_TISSUE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N1100N
PDE4DIPTATPSACQLSOFT_TISSUE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N1100N
PDE4DIPTPSACQLPRSOFT_TISSUE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N500N
PDE4DIPTPSACQLPRSOFT_TISSUE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN500N
PDE4DIPTPSACQLPRSOFT_TISSUE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N500N
PDE4DIPTPSACQLPRSOFT_TISSUE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N500N
PDE4DIPTPSACQLPRSOFT_TISSUE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N500N
PDE4DIPTPYPSWLAFSOFT_TISSUE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204Y19100N
PDE4DIPTPYPSWLAFSOFT_TISSUE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTY19100N
PDE4DIPTPYPSWLAFSOFT_TISSUE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41Y19100N
PDE4DIPTPYPSWLAFSOFT_TISSUE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1Y19100N
PDE4DIPTPYPSWLAFSOFT_TISSUE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1Y19100N
PDE4DIPTRPIQAFIFSOFT_TISSUE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N400N
PDE4DIPTRPIQAFIFSOFT_TISSUE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN400N
PDE4DIPTRPIQAFIFSOFT_TISSUE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N400N
PDE4DIPTRPIQAFIFSOFT_TISSUE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N400N
PDE4DIPTRPIQAFIFSOFT_TISSUE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N400N
PDE4DIPTSASRGLRPSOFT_TISSUE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N000N
PDE4DIPTSASRGLRPSOFT_TISSUE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN000N
PDE4DIPTSASRGLRPSOFT_TISSUE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N000N
PDE4DIPTSASRGLRPSOFT_TISSUE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N000N
PDE4DIPTSASRGLRPSOFT_TISSUE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N000N
PDE4DIPVPALFLLLPSOFT_TISSUE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N200N
PDE4DIPVPALFLLLPSOFT_TISSUE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN200N
PDE4DIPVPALFLLLPSOFT_TISSUE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N200N
PDE4DIPVPALFLLLPSOFT_TISSUE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N200N
PDE4DIPVPALFLLLPSOFT_TISSUE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N200N
PDE4DIPVRHQWSPWLSOFT_TISSUE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204N905Y
PDE4DIPVRHQWSPWLSOFT_TISSUE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTN905Y
PDE4DIPVRHQWSPWLSOFT_TISSUE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41N905Y
PDE4DIPVRHQWSPWLSOFT_TISSUE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1N905Y
PDE4DIPVRHQWSPWLSOFT_TISSUE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1N905Y
PDE4DIPWEKVPALFLSOFT_TISSUE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204Y12125N
PDE4DIPWEKVPALFLSOFT_TISSUE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTY12125N
PDE4DIPWEKVPALFLSOFT_TISSUE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41Y12125N
PDE4DIPWEKVPALFLSOFT_TISSUE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1Y12125N
PDE4DIPWEKVPALFLSOFT_TISSUE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1Y12125N
PDE4DIPWLAFLRHHCSOFT_TISSUE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35A204Y41017N
PDE4DIPWLAFLRHHCSOFT_TISSUE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35GCTY41017N
PDE4DIPWLAFLRHHCSOFT_TISSUE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35RH41Y41017N
PDE4DIPWLAFLRHHCSOFT_TISSUE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKLMS1Y41017N
PDE4DIPWLAFLRHHCSOFT_TISSUE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKUT1Y41017N
PDE4DIPWLRLSRSYRSOFT_TISSUE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204Y71012N
PDE4DIPWLRLSRSYRSOFT_TISSUE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTY71012N
PDE4DIPWLRLSRSYRSOFT_TISSUE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41Y71012N
PDE4DIPWLRLSRSYRSOFT_TISSUE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1Y71012N
PDE4DIPWLRLSRSYRSOFT_TISSUE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1Y71012N
PDE4DIPWSPWLRLSRSOFT_TISSUE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35A204N605Y
PDE4DIPWSPWLRLSRSOFT_TISSUE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35GCTN605Y
PDE4DIPWSPWLRLSRSOFT_TISSUE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35RH41N605Y
PDE4DIPWSPWLRLSRSOFT_TISSUE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKLMS1N605Y
PDE4DIPWSPWLRLSRSOFT_TISSUE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKUT1N605Y
PDE4DIPYPSWLAFLRSOFT_TISSUE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N702N
PDE4DIPYPSWLAFLRSOFT_TISSUE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN702N
PDE4DIPYPSWLAFLRSOFT_TISSUE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N702N
PDE4DIPYPSWLAFLRSOFT_TISSUE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N702N
PDE4DIPYPSWLAFLRSOFT_TISSUE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N702N
PDE4DIPYRCCRSSWESOFT_TISSUE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35A204N305N
PDE4DIPYRCCRSSWESOFT_TISSUE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35GCTN305N
PDE4DIPYRCCRSSWESOFT_TISSUE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35RH41N305N
PDE4DIPYRCCRSSWESOFT_TISSUE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKLMS1N305N
PDE4DIPYRCCRSSWESOFT_TISSUE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKUT1N305N
PDE4DIPASPSNSDSISOFT_TISSUE1637p.H1641Nc.4921C>AMissense_Mutation10.11A204Y6130N
PDE4DIPEEKKASPSNSOFT_TISSUE1633p.H1641Nc.4921C>AMissense_Mutation10.11A204N300N
PDE4DIPEKKASPSNSSOFT_TISSUE1634p.H1641Nc.4921C>AMissense_Mutation10.11A204N100N
PDE4DIPKASPSNSDSSOFT_TISSUE1636p.H1641Nc.4921C>AMissense_Mutation10.11A204N200N
PDE4DIPKKASPSNSDSOFT_TISSUE1635p.H1641Nc.4921C>AMissense_Mutation10.11A204N000N
PDE4DIPNSDSIHHSSSOFT_TISSUE1641p.H1641Nc.4921C>AMissense_Mutation10.11A204N100N
PDE4DIPPSNSDSIHHSOFT_TISSUE1639p.H1641Nc.4921C>AMissense_Mutation10.11A204N000N
PDE4DIPSNSDSIHHSSOFT_TISSUE1640p.H1641Nc.4921C>AMissense_Mutation10.11A204N000N
PDE4DIPSPSNSDSIHSOFT_TISSUE1638p.H1641Nc.4921C>AMissense_Mutation10.11A204N000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23A204N000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23HS729N000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23KYM1N000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23RDN000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23RH41N000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23RKNN000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23SJRH30N000N
PIK3C2GCSWGSIGKHSOFT_TISSUE124p.P129delc.384_386delCCCIn_Frame_Del447.23SKUT1N000N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23A204N100N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23HS729N100N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23KYM1N100N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23RDN100N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23RH41N100N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23RKNN100N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23SJRH30N100N
PIK3C2GECSWGSIGKSOFT_TISSUE123p.P129delc.384_386delCCCIn_Frame_Del347.23SKUT1N100N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23A204N300N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23HS729N300N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23KYM1N300N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23RDN300N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23RH41N300N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23RKNN300N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23SJRH30N300N
PIK3C2GGSIGKHHGASOFT_TISSUE127p.P129delc.384_386delCCCIn_Frame_Del247.23SKUT1N300N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23A204N000N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23HS729N000N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23KYM1N000N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23RDN000N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23RH41N000N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23RKNN000N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23SJRH30N000N
PIK3C2GKECSWGSIGSOFT_TISSUE122p.P129delc.384_386delCCCIn_Frame_Del247.23SKUT1N000N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23A204N100N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23HS729N100N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23KYM1N100N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23RDN100N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23RH41N100N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23RKNN100N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23SJRH30N100N
PIK3C2GNKECSWGSISOFT_TISSUE121p.P129delc.384_386delCCCIn_Frame_Del147.23SKUT1N100N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23A204N000N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23HS729N000N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23KYM1N000N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23RDN000N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23RH41N000N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23RKNN000N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23SJRH30N000N
PIK3C2GSIGKHHGADSOFT_TISSUE128p.P129delc.384_386delCCCIn_Frame_Del147.23SKUT1N000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23A204N000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23HS729N000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23KYM1N000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23RDN000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23RH41N000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23RKNN000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23SJRH30N000N
PIK3C2GSWGSIGKHHSOFT_TISSUE125p.P129delc.384_386delCCCIn_Frame_Del447.23SKUT1N000N
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23A204N107Y
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23HS729N107Y
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23KYM1N107Y
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23RDN107Y
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23RH41N107Y
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23RKNN107Y
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23SJRH30N107Y
PIK3C2GWGSIGKHHGSOFT_TISSUE126p.P129delc.384_386delCCCIn_Frame_Del347.23SKUT1N107Y
PIK3CADETRQLCDLSOFT_TISSUE84p.R88Qc.263G>AMissense_Mutation10.44SKUT1Y6100N
PIK3CAEEFFDETRQSOFT_TISSUE80p.R88Qc.263G>AMissense_Mutation10.44SKUT1N200N
PIK3CAEFFDETRQLSOFT_TISSUE81p.R88Qc.263G>AMissense_Mutation10.44SKUT1Y790N
PIK3CAETRQLCDLRSOFT_TISSUE85p.R88Qc.263G>AMissense_Mutation10.44SKUT1N400N
PIK3CAFDETRQLCDSOFT_TISSUE83p.R88Qc.263G>AMissense_Mutation10.44SKUT1N200N
PIK3CAFFDETRQLCSOFT_TISSUE82p.R88Qc.263G>AMissense_Mutation10.44SKUT1Y290N
PIK3CAQLCDLRLFQSOFT_TISSUE88p.R88Qc.263G>AMissense_Mutation10.44SKUT1N000N
PIK3CARQLCDLRLFSOFT_TISSUE87p.R88Qc.263G>AMissense_Mutation10.44SKUT1N1000N
PIK3CATRQLCDLRLSOFT_TISSUE86p.R88Qc.263G>AMissense_Mutation10.44SKUT1N500Y
PRKDCACRPRYAGWSOFT_TISSUE1249p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1Y3110N
PRKDCAGWTCSWPRSOFT_TISSUE1255p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N200N
PRKDCASPRASWPSSOFT_TISSUE1230p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000N
PRKDCASWPSPPSCSOFT_TISSUE1234p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCATTRSLARESOFT_TISSUE1266p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N000N
PRKDCAVASPRASWSOFT_TISSUE1228p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1Y0100N
PRKDCCRPRYAGWTSOFT_TISSUE1250p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N200N
PRKDCCSWPRWSATSOFT_TISSUE1259p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCCTFGGHSACSOFT_TISSUE1242p.G1227fsc.3680_3680delGFrame_Shift_Del60.11SKUT1N100N
PRKDCEGVAVASPRSOFT_TISSUE1225p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCFEGVAVASPSOFT_TISSUE1224p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N301N
PRKDCFGGHSACRPSOFT_TISSUE1244p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCFLINTFEGVSOFT_TISSUE1219p.G1227fsc.3680_3680delGFrame_Shift_Del10.11SKUT1Y10114N
PRKDCGGHSACRPRSOFT_TISSUE1245p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCGHSACRPRYSOFT_TISSUE1246p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N200N
PRKDCGVAVASPRASOFT_TISSUE1226p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCGWTCSWPRWSOFT_TISSUE1256p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000N
PRKDCHSACRPRYASOFT_TISSUE1247p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1Y2120N
PRKDCINTFEGVAVSOFT_TISSUE1221p.G1227fsc.3680_3680delGFrame_Shift_Del30.11SKUT1N205N
PRKDCLINTFEGVASOFT_TISSUE1220p.G1227fsc.3680_3680delGFrame_Shift_Del20.11SKUT1N300N
PRKDCNTFEGVAVASOFT_TISSUE1222p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N600N
PRKDCPPSCTFGGHSOFT_TISSUE1239p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000N
PRKDCPRASWPSPPSOFT_TISSUE1232p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000N
PRKDCPRWSATTRSSOFT_TISSUE1262p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N200N
PRKDCPRYAGWTCSSOFT_TISSUE1252p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N200N
PRKDCPSCTFGGHSSOFT_TISSUE1240p.G1227fsc.3680_3680delGFrame_Shift_Del60.11SKUT1N000N
PRKDCPSPPSCTFGSOFT_TISSUE1237p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000N
PRKDCRASWPSPPSSOFT_TISSUE1233p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCRPRYAGWTCSOFT_TISSUE1251p.G1227fsc.3680_3680delGFrame_Shift_Del60.11SKUT1N500N
PRKDCRWSATTRSLSOFT_TISSUE1263p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N700N
PRKDCRYAGWTCSWSOFT_TISSUE1253p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1Y4110N
PRKDCSACRPRYAGSOFT_TISSUE1248p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N000N
PRKDCSATTRSLARSOFT_TISSUE1265p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N400N
PRKDCSCTFGGHSASOFT_TISSUE1241p.G1227fsc.3680_3680delGFrame_Shift_Del60.11SKUT1N000N
PRKDCSPPSCTFGGSOFT_TISSUE1238p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000Y
PRKDCSPRASWPSPSOFT_TISSUE1231p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000N
PRKDCSWPRWSATTSOFT_TISSUE1260p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCSWPSPPSCTSOFT_TISSUE1235p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N100N
PRKDCTCSWPRWSASOFT_TISSUE1258p.G1227fsc.3680_3680delGFrame_Shift_Del60.11SKUT1N000N
PRKDCTFEGVAVASSOFT_TISSUE1223p.G1227fsc.3680_3680delGFrame_Shift_Del40.11SKUT1N000N
PRKDCTFGGHSACRSOFT_TISSUE1243p.G1227fsc.3680_3680delGFrame_Shift_Del60.11SKUT1N200N
PRKDCTTRSLARELSOFT_TISSUE1267p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1Y6110N
PRKDCVASPRASWPSOFT_TISSUE1229p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N000N
PRKDCVAVASPRASSOFT_TISSUE1227p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N2012N
PRKDCWPRWSATTRSOFT_TISSUE1261p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1Y790N
PRKDCWPSPPSCTFSOFT_TISSUE1236p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N1200Y
PRKDCWSATTRSLASOFT_TISSUE1264p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N400N
PRKDCWTCSWPRWSSOFT_TISSUE1257p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N204N
PRKDCYAGWTCSWPSOFT_TISSUE1254p.G1227fsc.3680_3680delGFrame_Shift_Del50.11SKUT1N200N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN000N
PRKDCAGHAMLAGPSOFT_TISSUE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN000N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN100N
PRKDCAGPAPGRVGSOFT_TISSUE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN100N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTY290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDY290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNY290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1Y290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TY290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TY290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TY290N
PRKDCAIQPAGHAMSOFT_TISSUE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TY290N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN000N
PRKDCAMLAGPAPGSOFT_TISSUE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN000N
PRKDCAPGRVGVLQSOFT_TISSUE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN000N
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48A204N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48G401N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48G402N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48GCTN000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HS729N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HT1080N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48KYM1N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48RDN000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48RH41N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48RKNN000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48S117N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SJRH30N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKLMS1N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKUT1N000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TE125TN000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TE159TN000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TE441TN000Y
PRKDCAQPTLLYPSSOFT_TISSUE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TE617TN000Y
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN300N
PRKDCCRSAPGPRYSOFT_TISSUE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN300N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48A204N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48G401N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48G402N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48GCTN000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS729N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HT1080N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KYM1N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48RDN000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48RH41N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48RKNN000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48S117N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SJRH30N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKLMS1N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKUT1N000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE125TN000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE159TN000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE441TN000N
PRKDCENCRSAPGPSOFT_TISSUE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE617TN000N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN400N
PRKDCGAIQPAGHASOFT_TISSUE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN400N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN100N
PRKDCGHAMLAGPASOFT_TISSUE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN100N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTY13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDY13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNY13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1Y13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TY13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TY13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TY13150N
PRKDCGPAPGRVGVSOFT_TISSUE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TY13150N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTY490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDY490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNY490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1Y490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TY490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TY490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TY490N
PRKDCGRVGVLQHVSOFT_TISSUE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TY490N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTY690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDY690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNY690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1Y690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TY690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TY690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TY690N
PRKDCGVLQHVHWRSOFT_TISSUE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TY690N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN000N
PRKDCHAMLAGPAPSOFT_TISSUE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN000N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48A204Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48G401Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48G402Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48GCTY690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS729Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HT1080Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KYM1Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48RDY690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48RH41Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48RKNY690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48S117Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SJRH30Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKLMS1Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKUT1Y690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE125TY690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE159TY690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE441TY690N
PRKDCHVHWRENCRSOFT_TISSUE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE617TY690N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48A204N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48G401N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48G402N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48GCTN100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS729N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HT1080N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48KYM1N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48RDN100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48RH41N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48RKNN100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48S117N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SJRH30N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKLMS1N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKUT1N100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE125TN100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE159TN100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE441TN100N
PRKDCHWRENCRSASOFT_TISSUE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TE617TN100N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN1400N
PRKDCIQPAGHAMLSOFT_TISSUE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN1400N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48A204N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48G401N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48G402N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48GCTN500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS729N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HT1080N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48KYM1N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48RDN500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48RH41N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48RKNN500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48S117N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SJRH30N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKLMS1N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKUT1N500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE125TN500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE159TN500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE441TN500N
PRKDCLAGPAPGRVSOFT_TISSUE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TE617TN500N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48A204N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48G401N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48G402N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48GCTN000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HS729N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HT1080N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48KYM1N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48RDN000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48RH41N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48RKNN000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48S117N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SJRH30N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKLMS1N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKUT1N000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48TE125TN000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48TE159TN000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48TE441TN000N
PRKDCLAQPTLLYPSOFT_TISSUE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48TE617TN000N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN100N
PRKDCLLYPSGAIQSOFT_TISSUE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN100N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN000N
PRKDCLQHVHWRENSOFT_TISSUE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN000N
PRKDCLYPSGAIQPSOFT_TISSUE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN000N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RDN500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RH41N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48RKNN500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48S117N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJRH30N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKLMS1N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKUT1N500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE125TN500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE159TN500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE441TN500N
PRKDCMLAGPAPGRSOFT_TISSUE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TE617TN500N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A204N300N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G401N300N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48G402N300N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48GCTN300N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS729N300N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HT1080N300N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48KYM1N300N
PRKDCNCRSAPGPRSOFT_TISSUE1275p.L1244fsc.3730_373