Field | Sense | Antisense |
siRNA chemical modification | 0 | 2-O-Methyl |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 11 |
Position of modifications | 0 | 9,11,13,15,17,19,21,23,25,26,27 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
COC1C(O)OC(CO)C1O |
siRNA Sequence | GCCAGUAAUUCAGCAGUUUGAACAA | UUGUUCAAACUGCUGAAUUACUGGCUG |
siRNA length base-pair | 25 | 27 |
siRNA name in paper | mF3-14 ASm | mF3-14 ASm |
Biological activity | 75 percent target mRNA inhibition | |
Experiment used to check activity | Luciferase reporter assay | |
Melting temperature (oC) | NA | |
Target gene | Luciferase gene | |
siRNA concentration | 0.05 nM | |
Cell or Organism used | HCT116 cells | |
Transfection method | TriFECTin (Integrated DNA Technologies, Coralville, IA) | |
Duration after transfection | 24 Hours | |
Article title | Chemical modification patterns compatible with high potency dicer-substrate small interfering RNAs |
|
Reference | 18637735 |