VIRmiRNA | Resource for experimental viral miRNA and their targets

VIRmiRNA -A database of viral miRNA
Total number of Results for MDV1 are 35

VMR_ID	miRNA	Virus	miRNA_Seq	Length	GC	Seed analysis miRBase	Seed analysis VIRmiRNA	Experimental Method	Target (if any)	PMID
VMR_ID	miRNA	Virus	miRNA_Seq	Length	GC	Seed analysis miRBase	Seed analysis VIRmiRNA	Experimental Method	Target (if any)	PMID
VMR_0452	mdv1-miR-m1*	MDV1	ugcugcgcaugaaagagcga	20	55			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18842708, 21645299, 24449754
VMR_0455	mdv1-miR-m11-3p	MDV1	ugaguuacauggucaggggauu	22	45			Northern blot analysis	Expt. Pred.	18256158, 24449754
VMR_0457	mdv1-miR-m12	MDV1	ugcauaauacggaggguucu	20	45			Northern blot analysis, Solexa(NGS)	Expt. Pred.	18256158, 18842708, 21645299, 24449754
VMR_0459	mdv1-miR-m12-3p	MDV1	ugcauaauacggaggguucu	20	45			Next Generation Sequencing	Expt. Pred.	21645299, 24449754
VMR_0460	mdv1-miR-m12-3p_+1_5	MDV1	ugcauaauacggaggguucugu	22	45			Deep sequencing	Expt. Pred.	24449754
VMR_0461	mdv1-miR-m13	MDV1	gcauggaaacguccugggaaa	21	52			Northern blot analysis	Expt. Pred.	18256158, 24449754
VMR_0462	mdv1-miR-m2-3p	MDV1	cggacugccgcagaauagcuu	21	57			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0465	mdv1-miR-m3*	MDV1	ugggggguucacauuuuuaagu	22	41			Northern blot analysis	Expt. Pred.	16912324, 18842708, 21645299, 24449754
VMR_0470	mdv1-miR-m4*	MDV1	aaugguucugacagcaugacc	21	48			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0472	mdv1-miR-m5	MDV1	uguguaucguggucgucuacugu	23	48			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0474	mdv1-miR-m5-3p	MDV1	uguguaucguggucgucuacugu	23	48			Next Generation Sequencing	Expt. Pred.	21645299, 24449754
VMR_0475	mdv1-miR-m6-3p	MDV1	gagaucccugcgaaaugacagu	22	50			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0478	mdv1-miR-m7*	MDV1	uguuaucucggggagaucccgau	23	52			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0479	mdv1-miR-m7-3p	MDV1	ucgagaucucuacgagauuacag	23	43			Next Generation Sequencing	Expt. Pred.	21645299, 24449754
VMR_0482	mdv1-miR-m8-3p	MDV1	gugaccucuacggaacaauagu	22	45			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0451	mdv1-miR-m1	MDV1	ugcuuguucacugugcggca	20	55			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18842708, 21645299, 24449754
VMR_0456	mdv1-miR-m11-5p	MDV1	uuuuccuuaccguguagcuuaga	23	39			Northern blot analysis	Expt. Pred.	18256158, 24449754
VMR_0458	mdv1-miR-m12*	MDV1	aggcccuccguauaauguaaaugu	24	42			Northern blot analysis, Solexa(NGS)	Expt. Pred.	18256158, 18842708, 21645299, 24449754
VMR_0463	mdv1-miR-m2-5p	MDV1	guuguauucugcccgguaguccg	23	57			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0464	mdv1-miR-m3	MDV1	augaaaaugugaaaccucucccgc	24	46			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0467	mdv1-miR-m3-5p	MDV1	augaaaaugugaaaccucucccgc	24	46			Next Generation Sequencing	Expt. Pred.	21645299, 24449754
VMR_0468	mdv1-miR-m3-5p_-1_5	MDV1	ugaaaaugugaaaccucucccgc	23	48			Deep sequencing	Expt. Pred.	24449754
VMR_0469	mdv1-miR-m4	MDV1	uuaaugcuguaucggaacccuuc	23	43			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0471	mdv1-miR-m4-5p	MDV1	uuaaugcuguaucggaacccuuc	23	43			Next Generation Sequencing	Expt. Pred.	21645299, 24449754
VMR_0473	mdv1-miR-m5*	MDV1	aaccguaugcgaucacauugac	22	45			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0476	mdv1-miR-m6-5p	MDV1	ucuguuguuccguaguguucuc	22	45			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0477	mdv1-miR-m7	MDV1	ucgagaucucuacgagauuacag	23	43			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18842708, 21645299, 24449754
VMR_0480	mdv1-miR-m7-5p	MDV1	uguuaucucggggagaucccgau	23	52			Next Generation Sequencing	Expt. Pred.	21645299, 24449754
VMR_0481	mdv1-miR-m7-5p_-1_5	MDV1	uguuaucucggggagaucucga	22	50			Deep sequencing	Expt. Pred.	24449754
VMR_0483	mdv1-miR-m8-5p	MDV1	uauuguucugugguugguuucg	22	41			Northern blot analysis, Solexa(NGS)	Expt. Pred.	16912324, 18256158, 18842708, 24449754
VMR_0466	mdv1-miR-m31	MDV1	ugcuacagucgugagcagaucaa	23	48			Northern blot analysis	Expt. Pred.	18430245, 24449754
VMR_0453	mdv1-miR-m10-3p	MDV1	ucgaaaucucuacgagauaaca	22	36			Northern blot analysis, Solexa(NGS)	Expt. Pred.	18256158, 18842708, 21645299, 24449754
VMR_0454	mdv1-miR-m10-5p	MDV1	gcguugucucguagagguccag	22	59			Northern blot analysis, Solexa(NGS)	Expt. Pred.	18256158, 18842708, 21645299, 24449754
VMR_0484	mdv1-miR-m9-3p	MDV1	aaacuccgagggcaggaaaaag	22	50			Northern blot analysis, Solexa(NGS)	Expt. Pred.	18256158, 18842708, 21645299, 24449754
VMR_0485	mdv1-miR-m9-5p	MDV1	uuuucuccuuccccccggaguu	22	55			Northern blot analysis, Solexa(NGS)	Expt. Pred.	18256158, 18842708, 21645299, 24449754