../../tmp/servers/virsirnadb/2134660733
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi15011aaaaacagcatattgacgctg21
M29095.1DEN2CGA Dengue virus type 2 complete genome 10613.....................10633100
M20558.1DEN2JAMCG Dengue virus type 2 Jamaica/N.1409, complete genome 10613.....................10633100
M93130.1DENCME Dengue type 3 virus complete genome RNA, complete cds 10586.....................10606100
M84728.1DENCMEMSA Dengue virus type 2 strain 16681-PDK53 capsid protein (C) ge10613.....................10633100
M84727.1DENCMEMSB Dengue virus type 2 strain 16681 capsid protein (C) gene, ma10613.....................10633100
M19197.1DENRCG Dengue virus type 2 (S1 vaccine strain), complete genome 10593.....................10613100
U87412.1 Dengue virus type 2 polyprotein mRNA, complete cds 10613.....................10633100
AF038402.1 Dengue virus type 2 strain New Guinea C/PUO-218 hybrid polyprotein ge10614.....................10634100
AF038403.1 Dengue virus type 2 strain New Guinea C polyprotein mRNA, complete cd10614.....................10634100
AF022435.1 Dengue virus type 2 strain ThNH-28/93, complete genome 10613.....................10633100
AF022436.1 Dengue virus type 2 strain ThNH-52/93, complete genome 10613.....................10633100
AF022437.1 Dengue virus type 2 strain ThNH-p11/93, complete genome 10613.....................10633100
AF022438.1 Dengue virus type 2 strain ThNH-p12/93, complete genome 10613.....................10633100
AF022439.1 Dengue virus type 2 strain ThNH-p14/93, complete genome 10613.....................10633100
AF022441.1 Dengue virus type 2 strain ThNH-p36/93, complete genome 10613.....................10633100
AF100459.1 Dengue virus type 2 strain K0008 polyprotein gene, complete cds 10603.....................10623100
AF100460.1 Dengue virus type 2 strain K0010 polyprotein gene, complete cds 10603.....................10623100
AF100461.1 Dengue virus type 2 strain C0371 polyprotein gene, complete cds 10603.....................10623100
AF100462.1 Dengue virus type 2 strain C0390 polyprotein gene, complete cds 10602.....................10622100
AF100463.1 Dengue virus type 2 strain C0166 polyprotein gene, complete cds 10603.....................10623100
AF100464.1 Dengue virus type 2 strain C0167 polyprotein gene, complete cds 10603.....................10623100
AF100465.1 Dengue virus type 2 strain Ven2 polyprotein gene, complete cds 10592.....................10612100
AF100467.1 Dengue virus type 2 strain IQT1797 polyprotein gene, complete cds 10592.....................10612100
AF100468.1 Dengue virus type 2 strain IQT2913 polyprotein gene, complete cds 10592.....................10612100
AF100469.1 Dengue virus type 2 strain 131 polyprotein gene, complete cds 10592.....................10612100
AF204177.1 Dengue virus type 2 strain 44, complete genome 10613.....................10633100
AF204178.1 Dengue virus type 2 strain 43, complete genome 10613.....................10633100
AF169678.1 Dengue virus type 2 strain ThNH29/93, complete genome 10613.....................10633100
AF169679.1 Dengue virus type 2 strain ThNH36/93, complete genome 10613.....................10633100
AF169680.1 Dengue virus type 2 strain ThNH45/93, complete genome 10613.....................10633100
AF169681.1 Dengue virus type 2 strain ThNH55/93, complete genome 10613.....................10633100
AF169682.1 Dengue virus type 2 strain ThNH54/93, complete genome 10613.....................10633100
AF169683.1 Dengue virus type 2 strain ThNH62/93, complete genome 10613.....................10633100
AF169684.1 Dengue virus type 2 strain ThNH63/93, complete genome 10613.....................10633100
AF169685.1 Dengue virus type 2 strain ThNH69/93, complete genome 10613.....................10633100
AF169686.1 Dengue virus type 2 strain ThNH73/93, complete genome 10613.....................10633100
AF169687.1 Dengue virus type 2 strain ThNH76/93, complete genome 10613.....................10633100
AF169688.1 Dengue virus type 2 strain ThNH81/93, complete genome 10613.....................10633100
AF276619.1 Dengue virus type 2 strain FJ-10, complete genome 10613.....................10633100
AF289029.1 dengue virus type 4 China Guangzhou B5 strain genomic RNA,complete cd10555.....................10575100
AF208496.1 Dengue virus type 2 strain DEN2/H/IMTSSA-MART/98-703, complete genome10612.....................10632100
AF326826.1 Dengue virus type 4 recombinant clone 2Adel30, complete sequence 10508.....................10528100
AF326827.1 Dengue virus type 4 recombinant clone rDEN4del30, complete sequence 10508.....................10528100
AF326573.1 Dengue virus type 4 strain 814669, complete genome 10539.....................10559100
AF317645.1 Dengue virus type 3 strain 80-2, complete genome 10586.....................10606100
AF100466.2 Dengue virus type 2 strain Mara4 polyprotein gene, complete cds 10604.....................10624100
AF359579.1 Dengue virus type 2 strain FJ11/99, complete genome 10613.....................10633100
AF375822.1 Dengue virus type 4 recombinant clone 2A, complete genome 10539.....................10559100
AY037116.1 Dengue virus type 2 strain TSV01, complete genome 10613.....................10633100
AF489932.1 Dengue Virus Type 2 strain BR64022, complete genome 10612.....................10632100
AY099337.1 Dengue virus type 3 isolate D3/H/IMTSSA-MART/1999/1243, complete geno10597.....................10617100
AJ487271.1 Dengue Virus type 2 partial gene for DEN2 polyprotein, genomic RNA 10556.....................10576100
AY648961.1 Dengue virus type 3 strain Sleman/78, complete genome 10597.....................10617100
AY679147.1 Dengue virus type 3 strain BR74886/02, complete genome 10597.....................10617100
AB122020.1 Dengue virus 2 genomic RNA, complete genome, strain: DR23/01 10613.....................10633100
AB122021.1 Dengue virus 2 genomic RNA, complete genome, strain: DR31/01 10613.....................10633100
AB122022.1 Dengue virus 2 genomic RNA, complete genome, strain: DR59/01 10613.....................10633100
AB189122.1 Dengue virus 2 genomic RNA, complete genome, strain: 98900663 DHF DV-10613.....................10633100
AB189123.1 Dengue virus 2 genomic RNA, complete genome, strain: 98900665 DF DV-210613.....................10633100
AB189124.1 Dengue virus 2 genomic RNA, complete genome, strain: 98900666 DSS DV-10613.....................10633100
AB189125.1 Dengue virus 3 genomic RNA, complete genome, strain: 98901403 DSS DV-10597.....................10617100
AB189126.1 Dengue virus 3 genomic RNA, complete genome, strain: 98901437 DSS DV-10597.....................10617100
AB189127.1 Dengue virus 3 genomic RNA, complete genome, strain: 98901517 DHF DV-10597.....................10617100
AB189128.1 Dengue virus 3 genomic RNA, complete genome, strain: 98902890 DF DV-310597.....................10617100
AY618988.1 Dengue virus type 4 strain ThD4_0476_97, complete genome 10543.....................10563100
AY618989.1 Dengue virus type 4 strain ThD4_0017_97, complete genome 10543.....................10563100
AY618990.1 Dengue virus type 4 strain ThD4_0348_91, complete genome 10540.....................10560100
AY618991.1 Dengue virus type 4 strain ThD4_0087_77, complete genome 10540.....................10560100
AY618992.1 Dengue virus type 4 strain ThD4_0485_01, complete genome 10539.....................10559100
AY618993.1 Dengue virus type 4 strain ThD4_0734_00, complete genome 10543.....................10563100
AY762085.1 Dengue virus type 4 strain Singapore 8976/95, complete genome 10539.....................10559100
AY766104.1 Dengue virus type 3 strain Singapore 8120/95, complete genome 10586.....................10606100
AY744147.1 Dengue virus type 2, complete genome 10603.....................10623100
AY676348.1 Dengue virus type 3 strain ThD3_1687_98, complete genome 10592.....................10612100
AY676349.1 Dengue virus type 3 strain ThD3_1283_98, complete genome 10597.....................10617100
AY676350.1 Dengue virus type 3 strain ThD3_0104_93, complete genome 10597.....................10617100
AY676351.1 Dengue virus type 3 strain ThD3_0055_93, complete genome 10597.....................10617100
AY676352.1 Dengue virus type 3 strain ThD3_0010_87, complete genome 10599.....................10619100
AY676353.1 Dengue virus type 3 strain ThD3_0007_87, complete genome 10597.....................10617100
AY702034.1 Dengue virus type 2 strain Cuba13/97, complete genome 10612.....................10632100
AY702035.1 Dengue virus type 2 strain Cuba58/97, complete genome 10612.....................10632100
AY702036.1 Dengue virus type 2 strain Cuba115/97, complete genome 10612.....................10632100
AY702037.1 Dengue virus type 2 strain Cuba89/97, complete genome 10612.....................10632100
AY702038.1 Dengue virus type 2 strain Cuba165/97, complete genome 10612.....................10632100
AY702039.1 Dengue virus type 2 strain Cuba205/97, complete genome 10612.....................10632100
AY702040.1 Dengue virus type 2 strain I348600, complete genome 10593.....................10613100
AY858050.1 Dengue virus 4 strain SW38i polyprotein gene, partial cds 10431.....................10451100
AY744677.1 Dengue virus type 3 isolate PF89/27643, complete genome 10597.....................10617100
AY744678.1 Dengue virus type 3 isolate PF89/320219, complete genome 10597.....................10617100
AY744679.1 Dengue virus type 3 isolate PF90/3050, complete genome 10597.....................10617100
AY744680.1 Dengue virus type 3 isolate PF90/3056, complete genome 10597.....................10617100
AY744681.1 Dengue virus type 3 isolate PF90/6056, complete genome 10597.....................10617100
AY744682.1 Dengue virus type 3 isolate PF92/2956, complete genome 10597.....................10617100
AY744683.1 Dengue virus type 3 isolate PF92/2986, complete genome 10597.....................10617100
AY744684.1 Dengue virus type 3 isolate PF92/4190, complete genome 10597.....................10617100
AY744685.1 Dengue virus type 3 isolate PF94/136116, complete genome 10597.....................10617100
AY876494.1 Dengue virus type 3 strain C0331/94, complete genome 10597.....................10617100
AY923865.1 Dengue virus type 3 strain C0360/94, complete genome 10597.....................10617100
AY947539.1 Dengue virus type 4 strain H241, complete genome 10546.....................10566100
DQ181797.1 Dengue virus type 2 strain ThD2_0078_01, complete genome 10613.....................10633100
DQ181798.1 Dengue virus type 2 strain ThD2_0055_99, complete genome 10613.....................10633100
DQ181799.1 Dengue virus type 2 strain ThD2_0017_98, complete genome 10613.....................10633100
DQ181800.1 Dengue virus type 2 strain ThD2_0263_95, complete genome 10613.....................10633100
DQ181801.1 Dengue virus type 2 strain ThD2_0284_90, complete genome 10613.....................10633100
DQ181802.1 Dengue virus type 2 strain ThD2_0026_88, complete genome 10613.....................10633100
DQ181803.1 Dengue virus type 2 strain ThD2_0433_85, complete genome 10613.....................10633100
DQ181804.1 Dengue virus type 2 strain ThD2_0498_84, complete genome 10613.....................10633100
DQ181805.1 Dengue virus type 2 strain ThD2_0168_79, complete genome 10613.....................10633100
DQ181806.1 Dengue virus type 2 strain ThD2_0038_74, complete genome 10613.....................10633100
AB214879.1 Dengue virus 3 genomic RNA, nearly complete genome, strain: D3/Hu/TL010597.....................10617100
AB214880.1 Dengue virus 3 genomic RNA, nearly complete genome, strain: D3/Hu/TL010597.....................10617100
AB214881.1 Dengue virus 3 genomic RNA, nearly complete genome, strain: D3/Hu/TL110597.....................10617100
AB214882.1 Dengue virus 3 genomic RNA, nearly complete genome, strain: D3/Hu/TL110597.....................10617100
DQ675519.1 Dengue virus type 3 isolate 95TW466, complete genome 10597.....................10617100
DQ675520.1 Dengue virus type 3 isolate 98TW182, complete genome 10596.....................10616100
DQ675521.1 Dengue virus type 3 isolate 98TW349, complete genome 10597.....................10617100
DQ675522.1 Dengue virus type 3 isolate 98TW358, complete genome 10597.....................10617100
DQ675523.1 Dengue virus type 3 isolate 98TW360, complete genome 10597.....................10617100
DQ675524.1 Dengue virus type 3 isolate 98TW364, complete genome 10597.....................10617100
DQ675525.1 Dengue virus type 3 isolate 98TW368, complete genome 10597.....................10617100
DQ675526.1 Dengue virus type 3 isolate 98TW388, complete genome 10597.....................10617100
DQ675527.1 Dengue virus type 3 isolate 98TW390, complete genome 10597.....................10617100
DQ675528.1 Dengue virus type 3 isolate 98TW407, complete genome 10597.....................10617100
DQ675529.1 Dengue virus type 3 isolate 98TW414, complete genome 10597.....................10617100
DQ675530.1 Dengue virus type 3 isolate 98TW434, complete genome 10597.....................10617100
DQ675532.1 Dengue virus type 3 isolate 98TWmosq, complete genome 10597.....................10617100
DQ675531.1 Dengue virus type 3 isolate 98TW503, complete genome 10597.....................10617100
DQ675533.1 Dengue virus type 3 isolate 99TW628, complete genome 10597.....................10617100
EF051521.1 Dengue virus type 2 strain ZS01/01, complete genome 10613.....................10633100
DQ863638.1 Dengue virus 3 strain CH53489, complete genome 10597.....................10617100
CS477302.1 Sequence 40 from Patent WO2006134433 10613.....................10633100
CS477304.1 Sequence 42 from Patent WO2006134433 10613.....................10633100
CS477305.1 Sequence 43 from Patent WO2006134433 10586.....................10606100
CS477306.1 Sequence 44 from Patent WO2006134433 10538.....................10558100
CS479165.1 Sequence 1 from Patent WO2006134443 10613.....................10633100
CS479167.1 Sequence 3 from Patent WO2006134443 10613.....................10633100
CS479202.1 Sequence 38 from Patent WO2006134443 10613.....................10633100
CS479205.1 Sequence 41 from Patent WO2006134443 10586.....................10606100
CS479206.1 Sequence 42 from Patent WO2006134443 10538.....................10558100
AY858035.2 Dengue virus 2 strain BA05i, complete genome 10613.....................10633100
AY858036.2 Dengue virus 2 strain TB16i, complete genome 10613.....................10633100
AY858037.2 Dengue virus 3 strain BA51, complete genome 10597.....................10617100
AY858038.2 Dengue virus 3 strain den3_88, complete genome 10597.....................10617100
AY858039.2 Dengue virus 3 strain den3_98, complete genome 10597.....................10617100
AY858040.2 Dengue virus 3 strain FW01, complete genome 10597.....................10617100
AY858041.2 Dengue virus 3 strain FW06, complete genome 10597.....................10617100
AY858042.2 Dengue virus 3 strain KJ30i, complete genome 10597.....................10617100
AY858044.2 Dengue virus 3 strain KJ71, complete genome 10597.....................10617100
AY858045.2 Dengue virus 3 strain PH86, complete genome 10597.....................10617100
AY858046.2 Dengue virus 3 strain PI64, complete genome 10597.....................10617100
AY858047.2 Dengue virus 3 strain TB16, complete genome 10597.....................10617100
AY858048.2 Dengue virus 3 strain TB55i, complete genome 10597.....................10617100
AJ968413.1 Dengue virus 2 gene for polyprotein, genomic RNA 10613.....................10633100
EF457906.1 Dengue virus type 4 isolate P75-215, complete genome 10557.....................10577100
EF643017.1 Dengue virus type 3 D3BR/RP1/2003 from Brazil, complete genome 10597.....................10617100
EF629366.1 Dengue virus type 3 strain BR DEN3 95-04, complete genome 10597.....................10617100
EF629367.1 Dengue virus type 3 strain BR DEN3 97-04, complete genome 10597.....................10617100
EF629369.1 Dengue virus type 3 strain BR DEN3 290-02, complete genome 10597.....................10617100
EF629370.1 Dengue virus type 3 strain BR DEN3 RO1-02, complete genome 10586.....................10606100
EF629373.1 Dengue virus type 3 strain BR DEN3 RO2-02 polyprotein gene, partial c10214.....................10234100
EU179857.1 Dengue virus type 2 isolate DS31-291005, complete genome 10613.....................10633100
EU179858.1 Dengue virus type 2 isolate DS04-221205, complete genome 10613.....................10633100
EU179859.1 Dengue virus type 2 isolate DS09-280106, complete genome 10613.....................10633100
EU056810.1 Dengue virus type 2 isolate 1349, complete genome 10613.....................10633100
EU056811.1 Dengue virus type 2 isolate IQT-1950, complete genome 10603.....................10623100
EU056812.1 Dengue virus type 2 isolate 1328, complete genome 10604.....................10624100
EU081177.1 Dengue virus type 2 strain D2/SG/05K3295DK1/2005, complete genome 10613.....................10633100
EU081178.1 Dengue virus type 2 strain D2/SG/05K3330DK1/2005, complete genome 10613.....................10633100
EU081179.1 Dengue virus type 2 strain D2/SG/05K4137DK1/2005, complete genome 10613.....................10633100
EU081180.1 Dengue virus type 2 strain D2/SG/05K4155DK1/2005, complete genome 10613.....................10633100
EU081181.1 Dengue virus type 3 strain D3/SG/SS710/2004, complete genome 10597.....................10617100
EU081182.1 Dengue virus type 3 strain D3/SG/05K791DK1/2005, complete genome 10597.....................10617100
EU081183.1 Dengue virus type 3 strain D3/SG/05K797DK1/2005, complete genome 10597.....................10617100
EU081184.1 Dengue virus type 3 strain D3/SG/05K802DK1/2005, complete genome 10597.....................10617100
EU081185.1 Dengue virus type 3 strain D3/SG/05K805DK1/2005, complete genome 10597.....................10617100
EU081186.1 Dengue virus type 3 strain D3/SG/05K827DK1/2005, complete genome 10597.....................10617100
EU081187.1 Dengue virus type 3 strain D3/SG/05K843DK1/2005, complete genome 10597.....................10617100
EU081188.1 Dengue virus type 3 strain D3/SG/05K845DK1/2005, complete genome 10597.....................10617100
EU081189.1 Dengue virus type 3 strain D3/SG/05K852DK1/2005, complete genome 10597.....................10617100
EU081190.1 Dengue virus type 3 strain D3/SG/05K863DK1/2005, complete genome 10597.....................10617100
EU081191.1 Dengue virus type 3 strain D3/SG/05K868DK1/2005, complete genome 10597.....................10617100
EU081192.1 Dengue virus type 3 strain D3/SG/05K871DK1/2005, complete genome 10597.....................10617100
EU081193.1 Dengue virus type 3 strain D3/SG/05K2400DK1/2005, complete genome 10597.....................10617100
EU081194.1 Dengue virus type 3 strain D3/SG/05K2406DK1/2005, complete genome 10597.....................10617100
EU081195.1 Dengue virus type 3 strain D3/SG/05K2418DK1/2005, complete genome 10597.....................10617100
EU081196.1 Dengue virus type 3 strain D3/SG/05K2899DK1/2005, complete genome 10597.....................10617100
EU081197.1 Dengue virus type 3 strain D3/SG/05K2918DK1/2005, complete genome 10597.....................10617100
EU081198.1 Dengue virus type 3 strain D3/SG/05K2933DK1/2005, complete genome 10597.....................10617100
EU081199.1 Dengue virus type 3 strain D3/SG/05K3305DK1/2005, complete genome 10597.....................10617100
EU081200.1 Dengue virus type 3 strain D3/SG/05K3312DK1/2005, complete genome 10597.....................10617100
EU081201.1 Dengue virus type 3 strain D3/SG/05K3314DK1/2005, complete genome 10597.....................10617100
EU081202.1 Dengue virus type 3 strain D3/SG/05K3316DK1/2005, complete genome 10597.....................10617100
EU081203.1 Dengue virus type 3 strain D3/SG/05K3324DK1/2005, complete genome 10597.....................10617100
EU081204.1 Dengue virus type 3 strain D3/SG/05K3325DK1/2005, complete genome 10597.....................10617100
EU081205.1 Dengue virus type 3 strain D3/SG/05K3329DK1/2005, complete genome 10597.....................10617100
EU081206.1 Dengue virus type 3 strain D3/SG/05K3887DK1/2005, complete genome 10597.....................10617100
EU081207.1 Dengue virus type 3 strain D3/SG/05K3897DK1/2005, complete genome 10597.....................10617100
EU081208.1 Dengue virus type 3 strain D3/SG/05K3900DK1/2005, complete genome 10597.....................10617100
EU081209.1 Dengue virus type 3 strain D3/SG/05K3912DK1/2005, complete genome 10597.....................10617100
EU081210.1 Dengue virus type 3 strain D3/SG/05K3913DK1/2005, complete genome 10597.....................10617100
EU081211.1 Dengue virus type 3 strain D3/SG/05K3923DK1/2005, complete genome 10597.....................10617100
EU081212.1 Dengue virus type 3 strain D3/SG/05K3927DK1/2005, complete genome 10597.....................10617100
EU081213.1 Dengue virus type 3 strain D3/SG/05K3928DK1/2005, complete genome 10597.....................10617100
EU081214.1 Dengue virus type 3 strain D3/SG/05K4141DK1/2005, complete genome 10597.....................10617100
EU081215.1 Dengue virus type 3 strain D3/SG/05K4144DK1/2005, complete genome 10597.....................10617100
EU081216.1 Dengue virus type 3 strain D3/SG/05K4157DK1/2005, complete genome 10597.....................10617100
EU081217.1 Dengue virus type 3 strain D3/SG/05K4159DK1/2005, complete genome 10597.....................10617100
EU081218.1 Dengue virus type 3 strain D3/SG/05K4168DK1/2005, complete genome 10597.....................10617100
EU081219.1 Dengue virus type 3 strain D3/SG/05K4176DK1/2005, complete genome 10597.....................10617100
EU081220.1 Dengue virus type 3 strain D3/SG/05K4182DK1/2005, complete genome 10597.....................10617100
EU081221.1 Dengue virus type 3 strain D3/SG/05K4440DK1/2005, complete genome 10596.....................10616100
EU081222.1 Dengue virus type 3 strain D3/SG/05K4454DK1/2005, complete genome 10597.....................10617100
EU081223.1 Dengue virus type 3 strain D3/SG/05K4477DK1/2005, complete genome 10596.....................10616100
EU081224.1 Dengue virus type 3 strain D3/SG/05K4647DK1/2005, complete genome 10597.....................10617100
EU081225.1 Dengue virus type 3 strain D3/SG/05K4648DK1/2005, complete genome 10597.....................10617100
CS805342.1 Sequence 8 from Patent WO2007093472 10597.....................10617100
CS805344.1 Sequence 10 from Patent WO2007093472 10613.....................10633100
CS805345.1 Sequence 11 from Patent WO2007093472 10586.....................10606100
CS805346.1 Sequence 12 from Patent WO2007093472 10538.....................10558100
CS805348.1 Sequence 14 from Patent WO2007093472 10613.....................10633100
EU359009.1 Dengue virus 2 isolate ZH1340, complete genome 10613.....................10633100
EU367962.1 Dengue virus 3 isolate 07CHLS001, complete genome 10597.....................10617100
EU482444.1 Dengue virus 2 isolate DENV-2/NI/BID-V563/2006, complete genome 10592.....................10612100
EU482445.1 Dengue virus 2 isolate DENV-2/VN/BID-V1000/2006, complete genome 10582.....................10602100
EU482446.1 Dengue virus 2 isolate DENV-2/VN/BID-V1001/2006, complete genome 10591.....................10611100
EU482447.1 Dengue virus 2 isolate DENV-2/VN/BID-V1002/2006, complete genome 10591.....................10611100
EU482448.1 Dengue virus 2 isolate DENV-2/VN/BID-V1003/2006, complete genome 10591.....................10611100
EU482449.1 Dengue virus 2 isolate DENV-2/VN/BID-V1004/2006, complete genome 10591.....................10611100
EU482450.1 Dengue virus 2 isolate DENV-2/VN/BID-V1005/2006, complete genome 10591.....................10611100
EU482451.1 Dengue virus 2 isolate DENV-2/VN/BID-V1007/2006, complete genome 10591.....................10611100
EU482452.1 Dengue virus 3 isolate DENV-3/VN/BID-V1008/2006, complete genome 10577.....................10597100
EU482453.1 Dengue virus 3 isolate DENV-3/VN/BID-V1009/2006, complete genome 10566.....................10586100
EU482454.1 Dengue virus 3 isolate DENV-3/VN/BID-V1010/2006, complete genome 10576.....................10596100
EU482455.1 Dengue virus 3 isolate DENV-3/VN/BID-V1011/2006, complete genome 10566.....................10586100
EU482456.1 Dengue virus 3 isolate DENV-3/VN/BID-V1012/2006, complete genome 10561.....................10581100
EU482457.1 Dengue virus 3 isolate DENV-3/VN/BID-V1013/2006, complete genome 10576.....................10596100
EU482458.1 Dengue virus 3 isolate DENV-3/VN/BID-V1014/2006, complete genome 10566.....................10586100
EU482459.1 Dengue virus 3 isolate DENV-3/VN/BID-V1015/2006, complete genome 10566.....................10586100
EU482460.1 Dengue virus 3 isolate DENV-3/VN/BID-V1016/2006, complete genome 10551.....................10571100
EU482461.1 Dengue virus 3 isolate DENV-3/VN/BID-V1017/2007, complete genome 10566.....................10586100
EU482462.1 Dengue virus 3 isolate DENV-3/VN/BID-V1018/2007, complete genome 10566.....................10586100
EU482463.1 Dengue virus 2 isolate DENV-2/VN/BID-V917/2006, complete genome 10591.....................10611100
EU482464.1 Dengue virus 2 isolate DENV-2/VN/BID-V918/2006, complete genome 10591.....................10611100
EU482465.1 Dengue virus 2 isolate DENV-2/VN/BID-V919/2006, complete genome 10591.....................10611100
EU482466.1 Dengue virus 2 isolate DENV-2/VN/BID-V920/2006, complete genome 10591.....................10611100
EU482467.1 Dengue virus 2 isolate DENV-2/VN/BID-V921/2006, complete genome 10591.....................10611100
EU482468.1 Dengue virus 2 isolate DENV-2/VN/BID-V923/2006, complete genome 10591.....................10611100
EU482469.1 Dengue virus 2 isolate DENV-2/VN/BID-V924/2006, complete genome 10581.....................10601100
EU482470.1 Dengue virus 2 isolate DENV-2/VN/BID-V925/2006, complete genome 10591.....................10611100
EU482471.1 Dengue virus 2 isolate DENV-2/VN/BID-V926/2006, complete genome 10591.....................10611100
EU482472.1 Dengue virus 2 isolate DENV-2/VN/BID-V927/2004, complete genome 10591.....................10611100
EU482473.1 Dengue virus 2 isolate DENV-2/VN/BID-V928/2006, complete genome 10591.....................10611100
EU482474.1 Dengue virus 2 isolate DENV-2/VN/BID-V929/2007, complete genome 10591.....................10611100
EU482475.1 Dengue virus 2 isolate DENV-2/VN/BID-V930/2007, complete genome 10591.....................10611100
EU482541.1 Dengue virus 2 isolate DENV-2/VN/BID-V997/2006, complete genome 10591.....................10611100
EU482542.1 Dengue virus 2 isolate DENV-2/VN/BID-V998/2006, complete genome 10591.....................10611100
EU482543.1 Dengue virus 2 isolate DENV-2/VN/BID-V999/2006, complete genome 10581.....................10601100
EU482544.1 Dengue virus 2 isolate DENV-2/US/BID-V1031/2006, complete genome 10591.....................10611100
EU482545.1 Dengue virus 2 isolate DENV-2/US/BID-V1032/1998, complete genome 10591.....................10611100
EU482546.1 Dengue virus 2 isolate DENV-2/US/BID-V1033/1998, complete genome 10591.....................10611100
EU482547.1 Dengue virus 2 isolate DENV-2/US/BID-V1034/1998, complete genome 10591.....................10611100
EU482548.1 Dengue virus 2 isolate DENV-2/US/BID-V1035/2006, complete genome 10575.....................10595100
EU482549.1 Dengue virus 2 isolate DENV-2/US/BID-V1036/2006, complete genome 10592.....................10612100
EU482550.1 Dengue virus 2 isolate DENV-2/US/BID-V1038/1998, complete genome 10591.....................10611100
EU482551.1 Dengue virus 2 isolate DENV-2/US/BID-V1039/2006, complete genome 10591.....................10611100
EU482553.1 Dengue virus 2 isolate DENV-2/US/BID-V1041/2006, complete genome 10591.....................10611100
EU482554.1 Dengue virus 2 isolate DENV-2/US/BID-V1042/1998, complete genome 10591.....................10611100
EU482555.1 Dengue virus 3 isolate DENV-3/US/BID-V1043/2006, complete genome 10561.....................10581100
EU482556.1 Dengue virus 2 isolate DENV-2/US/BID-V1045/2005, complete genome 10593.....................10613100
EU482557.1 Dengue virus 2 isolate DENV-2/US/BID-V1048/1999, complete genome 10591.....................10611100
EU482558.1 Dengue virus 3 isolate DENV-3/US/BID-V1049/1998, complete genome 10561.....................10581100
EU482559.1 Dengue virus 3 isolate DENV-3/US/BID-V1050/1998, complete genome 10561.....................10581100
EU482560.1 Dengue virus 2 isolate DENV-2/US/BID-V1052/1998, complete genome 10591.....................10611100
EU482561.1 Dengue virus 2 isolate DENV-2/US/BID-V1054/1996, complete genome 10591.....................10611100
EU482562.1 Dengue virus 2 isolate DENV-2/US/BID-V1060/1989, complete genome 10593.....................10613100
EU482563.1 Dengue virus 3 isolate DENV-3/US/BID-V1075/1998, complete genome 10561.....................10581100
EU482564.1 Dengue virus 3 isolate DENV-3/US/BID-V1078/2003, complete genome 10561.....................10581100
EU482565.1 Dengue virus 2 isolate DENV-2/US/BID-V1084/1998, complete genome 10591.....................10611100
EU482566.1 Dengue virus 3 isolate DENV-3/US/BID-V1088/1998, complete genome 10561.....................10581100
EU482568.1 Dengue virus 2 isolate DENV-2/US/BID-V1164/1986, complete genome 10591.....................10611100
EU482569.1 Dengue virus 2 isolate DENV-2/US/BID-V1165/1987, complete genome 10591.....................10611100
EU482570.1 Dengue virus 2 isolate DENV-2/US/BID-V1166/1987, complete genome 10591.....................10611100
EU482571.1 Dengue virus 2 isolate DENV-2/US/BID-V1167/1987, complete genome 10591.....................10611100
EU482572.1 Dengue virus 2 isolate DENV-2/US/BID-V1168/1987, complete genome 10591.....................10611100
EU482573.1 Dengue virus 2 isolate DENV-2/US/BID-V1169/1987, complete genome 10573.....................10593100
EU482574.1 Dengue virus 2 isolate DENV-2/US/BID-V1170/1987, complete genome 10591.....................10611100
EU482575.1 Dengue virus 2 isolate DENV-2/US/BID-V1171/1987, complete genome 10580.....................10600100
EU482576.1 Dengue virus 2 isolate DENV-2/US/BID-V1172/1987, complete genome 10591.....................10611100
EU482577.1 Dengue virus 2 isolate DENV-2/US/BID-V1174/1987, complete genome 10591.....................10611100
EU482578.1 Dengue virus 2 isolate DENV-2/US/BID-V1175/1988, complete genome 10591.....................10611100
EU482579.1 Dengue virus 2 isolate DENV-2/US/BID-V1176/1988, complete genome 10591.....................10611100
EU482580.1 Dengue virus 2 isolate DENV-2/US/BID-V1177/1989, complete genome 10591.....................10611100
EU482581.1 Dengue virus 2 isolate DENV-2/US/BID-V1178/1989, complete genome 10592.....................10612100
EU482582.1 Dengue virus 2 isolate DENV-2/US/BID-V1179/1989, complete genome 10592.....................10612100
EU482583.1 Dengue virus 2 isolate DENV-2/US/BID-V1180/1989, complete genome 10591.....................10611100
EU482584.1 Dengue virus 2 isolate DENV-2/US/BID-V1181/1989, complete genome 10575.....................10595100
EU482585.1 Dengue virus 2 isolate DENV-2/US/BID-V1182/1989, complete genome 10591.....................10611100
EU482586.1 Dengue virus 2 isolate DENV-2/US/BID-V1183/1990, complete genome 10591.....................10611100
EU482587.1 Dengue virus 2 isolate DENV-2/US/BID-V1188/1990, complete genome 10591.....................10611100
EU482588.1 Dengue virus 2 isolate DENV-2/US/BID-V1189/1990, complete genome 10591.....................10611100
EU482589.1 Dengue virus 2 isolate DENV-2/US/BID-V1360/1993, complete genome 10591.....................10611100
EU482590.1 Dengue virus 2 isolate DENV-2/US/BID-V851/1990, complete genome 10591.....................10611100
EU482593.1 Dengue virus 2 isolate DENV-2/US/BID-V854/2001, complete genome 10591.....................10611100
EU482594.1 Dengue virus 2 isolate DENV-2/US/BID-V855/1992, complete genome 10591.....................10611100
EU482595.1 Dengue virus 3 isolate DENV-3/US/BID-V858/2003, complete genome 10576.....................10596100
EU482596.1 Dengue virus 3 isolate DENV-3/US/BID-V859/1998, complete genome 10576.....................10596100
EU482597.1 Dengue virus 2 isolate DENV-2/NI/BID-V609/2005, complete genome 10592.....................10612100
EU482598.1 Dengue virus 2 isolate DENV-2/NI/BID-V613/2005, complete genome 10592.....................10612100
EU482599.1 Dengue virus 2 isolate DENV-2/NI/BID-V618/2005, complete genome 10592.....................10612100
EU482600.1 Dengue virus 2 isolate DENV-2/NI/BID-V623/2005, complete genome 10592.....................10612100
EU482601.1 Dengue virus 2 isolate DENV-2/NI/BID-V663/2007, complete genome 10593.....................10613100
EU482602.1 Dengue virus 2 isolate DENV-2/NI/BID-V672/2005, complete genome 10592.....................10612100
EU482603.1 Dengue virus 2 isolate DENV-2/NI/BID-V615/2007, complete genome 10593.....................10613100
EU482604.1 Dengue virus 2 isolate DENV-2/VE/BID-V1095/2007, complete genome 10591.....................10611100
EU482605.1 Dengue virus 2 isolate DENV-2/VE/BID-V1104/2007, complete genome 10591.....................10611100
EU482606.1 Dengue virus 2 isolate DENV-2/VE/BID-V1105/2007, complete genome 10581.....................10601100
EU482608.1 Dengue virus 2 isolate DENV-2/VE/BID-V1111/2007, complete genome 10576.....................10596100
EU482612.1 Dengue virus 3 isolate DENV-3/VE/BID-V904/2001, complete genome 10562.....................10582100
EU482613.1 Dengue virus 3 isolate DENV-3/VE/BID-V906/2001, complete genome 10561.....................10581100
EU482614.1 Dengue virus 3 isolate DENV-3/VE/BID-V913/2001, complete genome 10561.....................10581100
EU482620.1 Dengue virus 2 isolate DENV-2/NI/BID-V1074/2006, complete genome 10593.....................10613100
EU482621.1 Dengue virus 2 isolate DENV-2/NI/BID-V1191/2007, complete genome 10593.....................10613100
EU482622.1 Dengue virus 2 isolate DENV-2/NI/BID-V1198/2007, complete genome 10593.....................10613100
EU482623.1 Dengue virus 2 isolate DENV-2/NI/BID-V1210/2007, complete genome 10593.....................10613100
EU482624.1 Dengue virus 2 isolate DENV-2/NI/BID-V1229/2007, complete genome 10593.....................10613100
EU482625.1 Dengue virus 2 isolate DENV-2/NI/BID-V1232/2007, complete genome 10593.....................10613100
EU482626.1 Dengue virus 2 isolate DENV-2/NI/BID-V1234/2007, complete genome 10593.....................10613100
EU482627.1 Dengue virus 2 isolate DENV-2/NI/BID-V1235/2007, complete genome 10593.....................10613100
EU482628.1 Dengue virus 2 isolate DENV-2/NI/BID-V1236/2007, complete genome 10593.....................10613100
EU482629.1 Dengue virus 2 isolate DENV-2/NI/BID-V1297/2007, complete genome 10592.....................10612100
EU482630.1 Dengue virus 2 isolate DENV-2/NI/BID-V1312/2007, complete genome 10593.....................10613100
EU482631.1 Dengue virus 2 isolate DENV-2/NI/BID-V670/2005, complete genome 10592.....................10612100
EU482632.1 Dengue virus 2 isolate DENV-2/NI/BID-V620/2005, complete genome 10592.....................10612100
EU482633.1 Dengue virus 2 isolate DENV-2/NI/BID-V631/2006, complete genome 10592.....................10612100
EU482634.1 Dengue virus 2 isolate DENV-2/NI/BID-V633/2006, complete genome 10593.....................10613100
EU482635.1 Dengue virus 2 isolate DENV-2/NI/BID-V640/2005, complete genome 10592.....................10612100
EU482636.1 Dengue virus 2 isolate DENV-2/NI/BID-V654/2005, complete genome 10592.....................10612100
EU482637.1 Dengue virus 2 isolate DENV-2/NI/BID-V658/2005, complete genome 10592.....................10612100
EU482638.1 Dengue virus 2 isolate DENV-2/NI/BID-V662/2007, complete genome 10593.....................10613100
EU482639.1 Dengue virus 2 isolate DENV-2/NI/BID-V673/2006, complete genome 10592.....................10612100
EU482640.1 Dengue virus 2 isolate DENV-2/VN/BID-V703/2006, complete genome 10591.....................10611100
EU482641.1 Dengue virus 2 isolate DENV-2/VN/BID-V704/2006, complete genome 10591.....................10611100
EU482642.1 Dengue virus 2 isolate DENV-2/VN/BID-V705/2006, complete genome 10591.....................10611100
EU482643.1 Dengue virus 2 isolate DENV-2/VN/BID-V706/2006, complete genome 10591.....................10611100
EU482644.1 Dengue virus 2 isolate DENV-2/VN/BID-V707/2006, complete genome 10591.....................10611100
EU482645.1 Dengue virus 2 isolate DENV-2/VN/BID-V708/2006, complete genome 10591.....................10611100
EU482646.1 Dengue virus 2 isolate DENV-2/VN/BID-V709/2006, complete genome 10573.....................10593100
EU482647.1 Dengue virus 2 isolate DENV-2/VN/BID-V710/2006, complete genome 10591.....................10611100
EU482648.1 Dengue virus 2 isolate DENV-2/VN/BID-V711/2006, complete genome 10591.....................10611100
EU482649.1 Dengue virus 2 isolate DENV-2/VN/BID-V712/2006, complete genome 10591.....................10611100
EU482650.1 Dengue virus 2 isolate DENV-2/VN/BID-V713/2006, complete genome 10591.....................10611100
EU482651.1 Dengue virus 2 isolate DENV-2/VN/BID-V714/2006, complete genome 10591.....................10611100
EU482652.1 Dengue virus 2 isolate DENV-2/VN/BID-V715/2006, complete genome 10591.....................10611100
EU482653.1 Dengue virus 2 isolate DENV-2/VN/BID-V716/2006, complete genome 10591.....................10611100
EU482654.1 Dengue virus 2 isolate DENV-2/VN/BID-V717/2006, complete genome 10591.....................10611100
EU482655.1 Dengue virus 2 isolate DENV-2/VN/BID-V718/2006, complete genome 10591.....................10611100
EU482656.1 Dengue virus 2 isolate DENV-2/VN/BID-V719/2006, complete genome 10586.....................10606100
EU482657.1 Dengue virus 2 isolate DENV-2/VN/BID-V720/2006, complete genome 10591.....................10611100
EU482658.1 Dengue virus 2 isolate DENV-2/VN/BID-V721/2006, complete genome 10591.....................10611100
EU482659.1 Dengue virus 2 isolate DENV-2/VN/BID-V722/2006, complete genome 10591.....................10611100
EU482660.1 Dengue virus 2 isolate DENV-2/VN/BID-V723/2006, complete genome 10579.....................10599100
EU482661.1 Dengue virus 2 isolate DENV-2/VN/BID-V724/2006, complete genome 10591.....................10611100
EU482662.1 Dengue virus 2 isolate DENV-2/VN/BID-V725/2006, complete genome 10582.....................10602100
EU482663.1 Dengue virus 2 isolate DENV-2/VN/BID-V726/2006, complete genome 10591.....................10611100
EU482664.1 Dengue virus 2 isolate DENV-2/VN/BID-V727/2006, complete genome 10591.....................10611100
EU482665.1 Dengue virus 2 isolate DENV-2/VN/BID-V728/2006, complete genome 10584.....................10604100
EU482666.1 Dengue virus 2 isolate DENV-2/VN/BID-V729/2006, complete genome 10591.....................10611100
EU482667.1 Dengue virus 2 isolate DENV-2/VN/BID-V730/2006, complete genome 10574.....................10594100
EU482668.1 Dengue virus 2 isolate DENV-2/VN/BID-V731/2006, complete genome 10591.....................10611100
EU482669.1 Dengue virus 2 isolate DENV-2/VN/BID-V732/2006, complete genome 10578.....................10598100
EU482670.1 Dengue virus 2 isolate DENV-2/VN/BID-V733/2006, complete genome 10591.....................10611100
EU482671.1 Dengue virus 2 isolate DENV-2/VN/BID-V734/2006, complete genome 10573.....................10593100
EU482672.1 Dengue virus 2 isolate DENV-2/VN/BID-V735/2006, complete genome 10591.....................10611100
EU482673.1 Dengue virus 2 isolate DENV-2/VN/BID-V736/2006, complete genome 10590.....................10610100
EU482674.1 Dengue virus 2 isolate DENV-2/VN/BID-V737/2006, complete genome 10591.....................10611100
EU482675.1 Dengue virus 2 isolate DENV-2/VN/BID-V738/2006, complete genome 10591.....................10611100
EU482676.1 Dengue virus 2 isolate DENV-2/VN/BID-V739/2006, complete genome 10591.....................10611100
EU482677.1 Dengue virus 2 isolate DENV-2/VN/BID-V740/2006, complete genome 10591.....................10611100
EU482678.1 Dengue virus 2 isolate DENV-2/VN/BID-V741/2006, complete genome 10591.....................10611100
EU482679.1 Dengue virus 2 isolate DENV-2/VN/BID-V742/2007, complete genome 10591.....................10611100
EU482680.1 Dengue virus 2 isolate DENV-2/NI/BID-V529/2005, complete genome 10593.....................10613100
EU482681.1 Dengue virus 2 isolate DENV-2/NI/BID-V549/2005, complete genome 10592.....................10612100
EU482682.1 Dengue virus 2 isolate DENV-2/NI/BID-V559/2006, complete genome 10593.....................10613100
EU482683.1 Dengue virus 2 isolate DENV-2/NI/BID-V570/2006, complete genome 10593.....................10613100
EU482684.1 Dengue virus 2 isolate DENV-2/NI/BID-V571/2006, complete genome 10593.....................10613100
EU482685.1 Dengue virus 2 isolate DENV-2/NI/BID-V572/2006, complete genome 10593.....................10613100
EU482686.1 Dengue virus 2 isolate DENV-2/NI/BID-V573/2006, complete genome 10593.....................10613100
EU482687.1 Dengue virus 2 isolate DENV-2/NI/BID-V574/2006, complete genome 10593.....................10613100
EU482688.1 Dengue virus 2 isolate DENV-2/NI/BID-V575/2006, complete genome 10592.....................10612100
EU482689.1 Dengue virus 2 isolate DENV-2/NI/BID-V576/2006, complete genome 10593.....................10613100
EU482690.1 Dengue virus 2 isolate DENV-2/NI/BID-V578/2006, complete genome 10593.....................10613100
EU482691.1 Dengue virus 2 isolate DENV-2/NI/BID-V579/2006, complete genome 10593.....................10613100
EU482692.1 Dengue virus 2 isolate DENV-2/NI/BID-V580/2006, complete genome 10593.....................10613100
EU482693.1 Dengue virus 2 isolate DENV-2/NI/BID-V581/2006, complete genome 10586.....................10606100
EU482694.1 Dengue virus 2 isolate DENV-2/NI/BID-V582/2007, complete genome 10593.....................10613100
EU482695.1 Dengue virus 2 isolate DENV-2/NI/BID-V743/2005, complete genome 10583.....................10603100
EU482696.1 Dengue virus 2 isolate DENV-2/NI/BID-V747/2006, complete genome 10580.....................10600100
EU482697.1 Dengue virus 2 isolate DENV-2/VN/BID-V771/2007, complete genome 10591.....................10611100
EU482698.1 Dengue virus 2 isolate DENV-2/VN/BID-V772/2007, complete genome 10591.....................10611100
EU482699.1 Dengue virus 2 isolate DENV-2/VN/BID-V773/2007, complete genome 10591.....................10611100
EU482700.1 Dengue virus 2 isolate DENV-2/VN/BID-V774/2007, complete genome 10591.....................10611100
EU482701.1 Dengue virus 2 isolate DENV-2/VN/BID-V775/2007, complete genome 10591.....................10611100
EU482702.1 Dengue virus 2 isolate DENV-2/VN/BID-V776/2007, complete genome 10591.....................10611100
EU482703.1 Dengue virus 2 isolate DENV-2/VN/BID-V777/2007, complete genome 10591.....................10611100
EU482704.1 Dengue virus 2 isolate DENV-2/VN/BID-V778/2007, complete genome 10591.....................10611100
EU482705.1 Dengue virus 2 isolate DENV-2/VN/BID-V779/2007, complete genome 10591.....................10611100
EU482719.1 Dengue virus 2 isolate DENV-2/US/BID-V587/2006, complete genome 10591.....................10611100
EU482720.1 Dengue virus 2 isolate DENV-2/US/BID-V588/2006, complete genome 10591.....................10611100
EU482721.1 Dengue virus 2 isolate DENV-2/US/BID-V589/2006, complete genome 10591.....................10611100
EU482722.1 Dengue virus 2 isolate DENV-2/US/BID-V591/2002, complete genome 10581.....................10601100
EU482723.1 Dengue virus 2 isolate DENV-2/US/BID-V592/2002, complete genome 10591.....................10611100
EU482724.1 Dengue virus 2 isolate DENV-2/US/BID-V593/2005, complete genome 10591.....................10611100
EU482725.1 Dengue virus 2 isolate DENV-2/US/BID-V594/2006, complete genome 10591.....................10611100
EU482726.1 Dengue virus 2 isolate DENV-2/US/BID-V595/2006, complete genome 10591.....................10611100
EU482727.1 Dengue virus 2 isolate DENV-2/US/BID-V596/1998, complete genome 10591.....................10611100
EU482728.1 Dengue virus 2 isolate DENV-2/US/BID-V597/1998, complete genome 10589.....................10609100
EU482729.1 Dengue virus 2 isolate DENV-2/US/BID-V598/1999, complete genome 10591.....................10611100
EU482730.1 Dengue virus 2 isolate DENV-2/US/BID-V599/1999, complete genome 10581.....................10601100
EU482731.1 Dengue virus 2 isolate DENV-2/US/BID-V600/2005, complete genome 10591.....................10611100
EU482732.1 Dengue virus 2 isolate DENV-2/US/BID-V675/1998, complete genome 10591.....................10611100
EU482733.1 Dengue virus 2 isolate DENV-2/US/BID-V676/1998, complete genome 10590.....................10610100
EU482734.1 Dengue virus 2 isolate DENV-2/US/BID-V677/1998, complete genome 10591.....................10611100
EU482735.1 Dengue virus 2 isolate DENV-2/US/BID-V678/1998, complete genome 10591.....................10611100
EU482736.1 Dengue virus 2 isolate DENV-2/US/BID-V679/1994, complete genome 10591.....................10611100
EU482737.1 Dengue virus 2 isolate DENV-2/US/BID-V680/1994, complete genome 10591.....................10611100
EU482738.1 Dengue virus 2 isolate DENV-2/US/BID-V681/1998, complete genome 10591.....................10611100
EU482739.1 Dengue virus 2 isolate DENV-2/US/BID-V682/1994, complete genome 10591.....................10611100
EU482740.1 Dengue virus 2 isolate DENV-2/US/BID-V683/1994, complete genome 10591.....................10611100
EU482741.1 Dengue virus 2 isolate DENV-2/US/BID-V684/1994, complete genome 10591.....................10611100
EU482742.1 Dengue virus 2 isolate DENV-2/US/BID-V685/1988, complete genome 10591.....................10611100
EU482743.1 Dengue virus 2 isolate DENV-2/US/BID-V686/1989, complete genome 10592.....................10612100
EU482744.1 Dengue virus 2 isolate DENV-2/US/BID-V687/1989, complete genome 10590.....................10610100
EU482745.1 Dengue virus 2 isolate DENV-2/US/BID-V688/1989, complete genome 10591.....................10611100
EU482746.1 Dengue virus 2 isolate DENV-2/US/BID-V689/1989, complete genome 10591.....................10611100
EU482747.1 Dengue virus 2 isolate DENV-2/US/BID-V690/1988, complete genome 10591.....................10611100
EU482748.1 Dengue virus 2 isolate DENV-2/NI/BID-V513/2005, complete genome 10594.....................10614100
EU482749.1 Dengue virus 2 isolate DENV-2/NI/BID-V514/2005, complete genome 10592.....................10612100
EU482750.1 Dengue virus 2 isolate DENV-2/NI/BID-V515/2005, complete genome 10592.....................10612100
EU482751.1 Dengue virus 2 isolate DENV-2/NI/BID-V517/2005, complete genome 10593.....................10613100
EU482752.1 Dengue virus 2 isolate DENV-2/NI/BID-V520/2005, complete genome 10592.....................10612100
EU482753.1 Dengue virus 2 isolate DENV-2/NI/BID-V524/2005, complete genome 10592.....................10612100
EU482754.1 Dengue virus 2 isolate DENV-2/NI/BID-V530/2005, complete genome 10583.....................10603100
EU482755.1 Dengue virus 2 isolate DENV-2/NI/BID-V531/2005, complete genome 10592.....................10612100
EU482756.1 Dengue virus 2 isolate DENV-2/NI/BID-V533/2005, complete genome 10592.....................10612100
EU482757.1 Dengue virus 2 isolate DENV-2/NI/BID-V535/2005, complete genome 10588.....................10608100
EU482758.1 Dengue virus 2 isolate DENV-2/NI/BID-V539/2005, complete genome 10592.....................10612100
EU482759.1 Dengue virus 2 isolate DENV-2/NI/BID-V544/2005, complete genome 10592.....................10612100
EU482760.1 Dengue virus 2 isolate DENV-2/NI/BID-V548/2005, complete genome 10592.....................10612100
EU482761.1 Dengue virus 2 isolate DENV-2/NI/BID-V553/2005, complete genome 10592.....................10612100
EU482762.1 Dengue virus 2 isolate DENV-2/NI/BID-V554/2005, complete genome 10592.....................10612100
EU482763.1 Dengue virus 2 isolate DENV-2/NI/BID-V556/2005, complete genome 10592.....................10612100
EU482764.1 Dengue virus 2 isolate DENV-2/NI/BID-V691/2005, complete genome 10593.....................10613100
EU482765.1 Dengue virus 2 isolate DENV-2/NI/BID-V692/2005, complete genome 10592.....................10612100
EU482766.1 Dengue virus 2 isolate DENV-2/NI/BID-V693/2005, complete genome 10593.....................10613100
EU482767.1 Dengue virus 2 isolate DENV-2/NI/BID-V694/2005, complete genome 10592.....................10612100
EU482768.1 Dengue virus 2 isolate DENV-2/NI/BID-V695/2005, complete genome 10592.....................10612100
EU482769.1 Dengue virus 2 isolate DENV-2/NI/BID-V744/2005, complete genome 10592.....................10612100
EU482770.1 Dengue virus 2 isolate DENV-2/NI/BID-V527/2005, complete genome 10592.....................10612100
EU482771.1 Dengue virus 2 isolate DENV-2/NI/BID-V557/2005, complete genome 10592.....................10612100
EU482772.1 Dengue virus 2 isolate DENV-2/NI/BID-V565/2006, complete genome 10593.....................10613100
EU482773.1 Dengue virus 2 isolate DENV-2/NI/BID-V566/2006, complete genome 10593.....................10613100
EU482774.1 Dengue virus 2 isolate DENV-2/VN/BID-V752/2004, complete genome 10591.....................10611100
EU482775.1 Dengue virus 2 isolate DENV-2/VN/BID-V753/2004, complete genome 10591.....................10611100
EU482776.1 Dengue virus 2 isolate DENV-2/VN/BID-V754/2005, complete genome 10591.....................10611100
EU482777.1 Dengue virus 2 isolate DENV-2/VN/BID-V755/2005, complete genome 10591.....................10611100
EU482778.1 Dengue virus 2 isolate DENV-2/VN/BID-V756/2003, complete genome 10590.....................10610100
EU482779.1 Dengue virus 2 isolate DENV-2/VN/BID-V757/2003, complete genome 10591.....................10611100
EU482780.1 Dengue virus 2 isolate DENV-2/VN/BID-V758/2003, complete genome 10591.....................10611100
EU482781.1 Dengue virus 2 isolate DENV-2/VN/BID-V759/2003, complete genome 10591.....................10611100
EU482782.1 Dengue virus 2 isolate DENV-2/VN/BID-V760/2003, complete genome 10591.....................10611100
EU482783.1 Dengue virus 2 isolate DENV-2/VN/BID-V761/2003, complete genome 10590.....................10610100
EU482784.1 Dengue virus 2 isolate DENV-2/VN/BID-V762/2003, complete genome 10592.....................10612100
EU482785.1 Dengue virus 2 isolate DENV-2/VN/BID-V763/2003, complete genome 10591.....................10611100
EU482786.1 Dengue virus 2 isolate DENV-2/VN/BID-V764/2003, complete genome 10591.....................10611100
EU482787.1 Dengue virus 2 isolate DENV-2/VN/BID-V765/2003, complete genome 10591.....................10611100
EU482788.1 Dengue virus 2 isolate DENV-2/VN/BID-V766/2003, complete genome 10591.....................10611100
EU529683.1 Dengue virus 3 isolate DENV-3/VE/BID-V1102/2007, complete genome 10562.....................10582100
EU529684.1 Dengue virus 3 isolate DENV-3/VE/BID-V1113/2001, complete genome 10575.....................10595100
EU529685.1 Dengue virus 3 isolate DENV-3/VE/BID-V1116/2001, complete genome 10561.....................10581100
EU529686.1 Dengue virus 3 isolate DENV-3/VE/BID-V1117/2001, complete genome 10561.....................10581100
EU529687.1 Dengue virus 3 isolate DENV-3/VE/BID-V1118/2001, complete genome 10561.....................10581100
EU529688.1 Dengue virus 3 isolate DENV-3/VE/BID-V903/2001, complete genome 10561.....................10581100
EU529689.1 Dengue virus 3 isolate DENV-3/VE/BID-V907/2001, complete genome 10561.....................10581100
EU529690.1 Dengue virus 3 isolate DENV-3/VE/BID-V908/2001, complete genome 10561.....................10581100
EU529691.1 Dengue virus 3 isolate DENV-3/VE/BID-V911/2001, complete genome 10561.....................10581100
EU529692.1 Dengue virus 3 isolate DENV-3/US/BID-V1044/2006, complete genome 10561.....................10581100
EU529693.1 Dengue virus 2 isolate DENV-2/US/BID-V1046/2004, complete genome 10591.....................10611100
EU529694.1 Dengue virus 2 isolate DENV-2/US/BID-V1057/1994, complete genome 10591.....................10611100
EU529695.1 Dengue virus 2 isolate DENV-2/US/BID-V1058/1994, complete genome 10579.....................10599100
EU529696.1 Dengue virus 3 isolate DENV-3/US/BID-V1076/1999, complete genome 10564.....................10584100
EU529697.1 Dengue virus 3 isolate DENV-3/US/BID-V1077/2000, complete genome 10561.....................10581100
EU529698.1 Dengue virus 3 isolate DENV-3/US/BID-V1079/2006, complete genome 10561.....................10581100
EU529699.1 Dengue virus 3 isolate DENV-3/US/BID-V1080/2006, complete genome 10561.....................10581100
EU529700.1 Dengue virus 2 isolate DENV-2/US/BID-V1085/1994, complete genome 10591.....................10611100
EU529701.1 Dengue virus 2 isolate DENV-2/US/BID-V1087/1991, complete genome 10591.....................10611100
EU529702.1 Dengue virus 3 isolate DENV-3/US/BID-V1089/2003, complete genome 10562.....................10582100
EU529703.1 Dengue virus 3 isolate DENV-3/US/BID-V1090/1998, complete genome 10562.....................10582100
EU529704.1 Dengue virus 3 isolate DENV-3/US/BID-V1091/2004, complete genome 10562.....................10582100
EU529705.1 Dengue virus 3 isolate DENV-3/US/BID-V1092/2004, complete genome 10561.....................10581100
EU529706.1 Dengue virus 2 isolate DENV-2/US/BID-V585/2006, complete genome 10581.....................10601100
EU569688.1 Dengue virus 3 isolate DENV-3/VE/BID-V1115/2001, complete genome 10561.....................10581100
EU569689.1 Dengue virus 3 isolate DENV-3/VE/BID-V912/2001, complete genome 10561.....................10581100
EU569690.1 Dengue virus 3 isolate DENV-3/VE/BID-V915/2001, complete genome 10561.....................10581100
EU569691.1 Dengue virus 3 isolate DENV-3/VE/BID-V916/2001, complete genome 10564.....................10584100
EU569692.1 Dengue virus 2 isolate DENV-2/NI/BID-V1192/2007, complete genome 10588.....................10608100
EU569693.1 Dengue virus 2 isolate DENV-2/NI/BID-V1193/2007, complete genome 10593.....................10613100
EU569694.1 Dengue virus 2 isolate DENV-2/NI/BID-V1199/2007, complete genome 10593.....................10613100
EU569695.1 Dengue virus 2 isolate DENV-2/NI/BID-V1203/2007, complete genome 10593.....................10613100
EU569696.1 Dengue virus 2 isolate DENV-2/NI/BID-V1206/2007, complete genome 10578.....................10598100
EU569697.1 Dengue virus 2 isolate DENV-2/NI/BID-V1208/2007, complete genome 10593.....................10613100
EU569698.1 Dengue virus 2 isolate DENV-2/NI/BID-V1212/2007, complete genome 10593.....................10613100
EU569699.1 Dengue virus 2 isolate DENV-2/NI/BID-V1217/2007, complete genome 10592.....................10612100
EU569700.1 Dengue virus 2 isolate DENV-2/NI/BID-V1219/2007, complete genome 10593.....................10613100
EU569701.1 Dengue virus 2 isolate DENV-2/NI/BID-V1224/2007, complete genome 10593.....................10613100
EU569702.1 Dengue virus 2 isolate DENV-2/NI/BID-V1228/2007, complete genome 10593.....................10613100
EU569703.1 Dengue virus 2 isolate DENV-2/US/BID-V1055/1996, complete genome 10577.....................10597100
EU569704.1 Dengue virus 2 isolate DENV-2/US/BID-V1163/1986, complete genome 10581.....................10601100
EU569705.1 Dengue virus 2 isolate DENV-2/US/BID-V1356/1993, complete genome 10576.....................10596100
EU569706.1 Dengue virus 2 isolate DENV-2/US/BID-V1367/1995, complete genome 10591.....................10611100
EU569707.1 Dengue virus 2 isolate DENV-2/US/BID-V1368/1995, complete genome 10591.....................10611100
EU569708.1 Dengue virus 2 isolate DENV-2/US/BID-V1373/1995, complete genome 10591.....................10611100
EU569709.1 Dengue virus 2 isolate DENV-2/US/BID-V1376/1996, complete genome 10590.....................10610100
EU569710.1 Dengue virus 2 isolate DENV-2/US/BID-V1383/1996, complete genome 10591.....................10611100
EU569711.1 Dengue virus 2 isolate DENV-2/US/BID-V1392/1998, complete genome 10591.....................10611100
EU569712.1 Dengue virus 2 isolate DENV-2/US/BID-V1393/1998, complete genome 10590.....................10610100
EU569713.1 Dengue virus 2 isolate DENV-2/US/BID-V1395/1997, complete genome 10590.....................10610100
EU569714.1 Dengue virus 2 isolate DENV-2/US/BID-V1396/1997, complete genome 10591.....................10611100
EU569715.1 Dengue virus 2 isolate DENV-2/US/BID-V1397/1997, complete genome 10591.....................10611100
EU569716.1 Dengue virus 2 isolate DENV-2/US/BID-V1398/1997, complete genome 10591.....................10611100
EU569717.1 Dengue virus 2 isolate DENV-2/US/BID-V1399/1997, complete genome 10591.....................10611100
EU569718.1 Dengue virus 2 isolate DENV-2/US/BID-V1401/1997, complete genome 10576.....................10596100
EU569719.1 Dengue virus 2 isolate DENV-2/US/BID-V1404/1997, complete genome 10591.....................10611100
EU569720.1 Dengue virus 2 isolate DENV-2/US/BID-V1409/1997, complete genome 10591.....................10611100
EU569721.1 Dengue virus 2 isolate DENV-2/VN/BID-V1006/2006, complete genome 10591.....................10611100
EU596483.1 Dengue virus 2 isolate DENV-2/NI/BID-V608/2006, complete genome 10593.....................10613100
EU596484.1 Dengue virus 2 isolate DENV-2/NI/BID-V660/2005, complete genome 10592.....................10612100
EU596485.1 Dengue virus 2 isolate DENV-2/US/BID-V1378/1996, complete genome 10591.....................10611100
EU596486.1 Dengue virus 2 isolate DENV-2/US/BID-V1385/1996, complete genome 10591.....................10611100
EU596487.1 Dengue virus 2 isolate DENV-2/US/BID-V1394/1998, complete genome 10579.....................10599100
EU596488.1 Dengue virus 2 isolate DENV-2/US/BID-V1410/2007, complete genome 10591.....................10611100
EU596489.1 Dengue virus 2 isolate DENV-2/US/BID-V1411/2007, complete genome 10591.....................10611100
EU596490.1 Dengue virus 2 isolate DENV-2/US/BID-V1412/2007, complete genome 10591.....................10611100
EU596491.1 Dengue virus 2 isolate DENV-2/US/BID-V1413/2007, complete genome 10591.....................10611100
EU596492.1 Dengue virus 3 isolate DENV-3/US/BID-V1415/2007, complete genome 10561.....................10581100
EU596493.1 Dengue virus 3 isolate DENV-3/US/BID-V1416/2007, complete genome 10561.....................10581100
EU596494.1 Dengue virus 3 isolate DENV-3/US/BID-V1417/2007, complete genome 10561.....................10581100
EU596495.1 Dengue virus 2 isolate DENV-2/NI/BID-V1195/2007, complete genome 10593.....................10613100
EU596496.1 Dengue virus 2 isolate DENV-2/NI/BID-V1200/2007, complete genome 10594.....................10614100
EU596497.1 Dengue virus 2 isolate DENV-2/NI/BID-V1202/2007, complete genome 10593.....................10613100
EU596498.1 Dengue virus 2 isolate DENV-2/NI/BID-V1211/2007, complete genome 10593.....................10613100
EU596499.1 Dengue virus 2 isolate DENV-2/NI/BID-V1215/2007, complete genome 10576.....................10596100
EU596500.1 Dengue virus 2 isolate DENV-2/NI/BID-V1230/2007, complete genome 10593.....................10613100
EU621672.1 Dengue virus 2 isolate DENV-2/NI/BID-V1225/2007, complete genome 10593.....................10613100
DQ448231.2 Dengue virus 2 isolate GWL18 INDI-01, complete genome 10613.....................10633100
AY770511.2 Dengue virus 3 strain GWL-25, complete genome 10597.....................10617100
EU660398.1 Dengue virus 2 isolate DENV-2/US/BID-V1061/1989, complete genome 10591.....................10611100
EU660399.1 Dengue virus 2 isolate DENV-2/US/BID-V1372/1995, complete genome 10591.....................10611100
EU660400.1 Dengue virus 2 isolate DENV-2/US/BID-V1388/1998, complete genome 10591.....................10611100
EU660404.1 Dengue virus 2 isolate DENV-2/NI/BID-V1196/2007, complete genome 10593.....................10613100
EU660405.1 Dengue virus 2 isolate DENV-2/NI/BID-V1201/2007, complete genome 10594.....................10614100
EU660406.1 Dengue virus 2 isolate DENV-2/NI/BID-V1207/2007, complete genome 10593.....................10613100
EU660407.1 Dengue virus 3 isolate DENV-3/VN/BID-V1326/2006, complete genome 10576.....................10596100
EU660408.1 Dengue virus 3 isolate DENV-3/VN/BID-V1327/2006, complete genome 10566.....................10586100
EU660409.1 Dengue virus 3 isolate DENV-3/VN/BID-V1329/2006, complete genome 10576.....................10596100
EU660410.1 Dengue virus 3 isolate DENV-3/VN/BID-V1330/2006, complete genome 10566.....................10586100
EU660411.1 Dengue virus 3 isolate DENV-3/VN/BID-V1331/2006, complete genome 10576.....................10596100
EU660413.1 Dengue virus 2 isolate DENV-2/VN/BID-V1507/2007, complete genome 10591.....................10611100
EU660414.1 Dengue virus 2 isolate DENV-2/VN/BID-V1508/2007, complete genome 10591.....................10611100
EU660415.1 Dengue virus 2 isolate DENV-2/VN/BID-V1511/2007, complete genome 10591.....................10611100
EU660416.1 Dengue virus 2 isolate DENV-2/VN/BID-V1513/2007, complete genome 10591.....................10611100
EU660417.1 Dengue virus 2 isolate DENV-2/VN/BID-V1515/2007, complete genome 10591.....................10611100
EU660420.1 Dengue virus 3 isolate DENV-3/VE/BID-V905/2001, complete genome 10576.....................10596100
EU677137.1 Dengue virus 2 isolate DENV-2/VN/BID-V1517/2007, complete genome 10574.....................10594100
EU677138.1 Dengue virus 2 isolate DENV-2/VN/BID-V1518/2007, complete genome 10591.....................10611100
EU677141.1 Dengue virus 2 isolate DENV-2/US/BID-V1424/1996, complete genome 10590.....................10610100
EU677142.1 Dengue virus 2 isolate DENV-2/US/BID-V1425/1999, complete genome 10591.....................10611100
EU677143.1 Dengue virus 2 isolate DENV-2/US/BID-V1426/1999, complete genome 10591.....................10611100
EU677144.1 Dengue virus 2 isolate DENV-2/US/BID-V1427/1999, complete genome 10591.....................10611100
EU677145.1 Dengue virus 2 isolate DENV-2/US/BID-V1428/1999, complete genome 10591.....................10611100
EU677146.1 Dengue virus 2 isolate DENV-2/US/BID-V1431/2004, complete genome 10591.....................10611100
EU677147.1 Dengue virus 2 isolate DENV-2/US/BID-V1432/2004, complete genome 10591.....................10611100
EU677148.1 Dengue virus 2 isolate DENV-2/VN/BID-V1519/2007, complete genome 10591.....................10611100
EU677149.1 Dengue virus 2 isolate DENV-2/VN/BID-V1520/2007, complete genome 10574.....................10594100
EU687196.1 Dengue virus 3 isolate DENV-3/US/BID-V1476/2002, complete genome 10566.....................10586100
EU687197.1 Dengue virus 3 isolate DENV-3/US/BID-V1480/2003, complete genome 10572.....................10592100
EU687198.1 Dengue virus 3 isolate DENV-3/US/BID-V1481/2003, complete genome 10588.....................10608100
EU687199.1 Dengue virus 2 isolate DENV-2/US/BID-V1482/2003, complete genome 10591.....................10611100
EU687212.1 Dengue virus 2 isolate DENV-2/US/BID-V1387/1998, complete genome 10581.....................10601100
EU687213.1 Dengue virus 2 isolate DENV-2/US/BID-V1434/2004, complete genome 10591.....................10611100
EU687214.1 Dengue virus 2 isolate DENV-2/US/BID-V1435/2004, complete genome 10591.....................10611100
EU687215.1 Dengue virus 2 isolate DENV-2/US/BID-V1436/2004, complete genome 10591.....................10611100
EU687216.1 Dengue virus 2 isolate DENV-2/US/BID-V1439/2005, complete genome 10591.....................10611100
EU687217.1 Dengue virus 2 isolate DENV-2/US/BID-V1441/2005, complete genome 10591.....................10611100
EU687218.1 Dengue virus 3 isolate DENV-3/US/BID-V1447/1998, complete genome 10561.....................10581100
EU687219.1 Dengue virus 3 isolate DENV-3/US/BID-V1455/1999, complete genome 10568.....................10588100
EU687220.1 Dengue virus 2 isolate DENV-2/VE/BID-V1456/1996, complete genome 10591.....................10611100
EU687221.1 Dengue virus 3 isolate DENV-3/US/BID-V1460/2000, complete genome 10561.....................10581100
EU687222.1 Dengue virus 2 isolate DENV-2/US/BID-V1461/2000, complete genome 10591.....................10611100
EU687223.1 Dengue virus 2 isolate DENV-2/US/BID-V1462/2000, complete genome 10591.....................10611100
EU687224.1 Dengue virus 2 isolate DENV-2/US/BID-V1463/2000, complete genome 10591.....................10611100
EU687225.1 Dengue virus 2 isolate DENV-2/US/BID-V1464/2000, complete genome 10591.....................10611100
EU687226.1 Dengue virus 3 isolate DENV-3/US/BID-V1466/1999, complete genome 10558.....................10578100
EU687227.1 Dengue virus 2 isolate DENV-2/US/BID-V1467/2001, complete genome 10591.....................10611100
EU687228.1 Dengue virus 2 isolate DENV-2/US/BID-V1468/2001, complete genome 10591.....................10611100
EU687229.1 Dengue virus 2 isolate DENV-2/US/BID-V1469/2001, complete genome 10591.....................10611100
EU687230.1 Dengue virus 2 isolate DENV-2/US/BID-V1470/2001, complete genome 10587.....................10607100
EU687231.1 Dengue virus 2 isolate DENV-2/US/BID-V1471/2001, complete genome 10591.....................10611100
EU687232.1 Dengue virus 2 isolate DENV-2/US/BID-V1472/2001, complete genome 10575.....................10595100
EU687233.1 Dengue virus 3 isolate DENV-3/US/BID-V1473/2002, complete genome 10566.....................10586100
EU687234.1 Dengue virus 3 isolate DENV-3/US/BID-V1475/2002, complete genome 10558.....................10578100
EU687235.1 Dengue virus 2 isolate DENV-2/US/BID-V1483/2003, complete genome 10592.....................10612100
EU687236.1 Dengue virus 2 isolate DENV-2/US/BID-V1484/2003, complete genome 10591.....................10611100
EU687237.1 Dengue virus 2 isolate DENV-2/US/BID-V1486/2003, complete genome 10591.....................10611100
EU687238.1 Dengue virus 2 isolate DENV-2/US/BID-V1487/2003, complete genome 10591.....................10611100
EU687239.1 Dengue virus 3 isolate DENV-3/US/BID-V1491/2003, complete genome 10561.....................10581100
EU687240.1 Dengue virus 2 isolate DENV-2/US/BID-V1492/2003, complete genome 10591.....................10611100
EU687241.1 Dengue virus 2 isolate DENV-2/US/BID-V1493/2003, complete genome 10591.....................10611100
EU687242.1 Dengue virus 2 isolate DENV-2/US/BID-V1494/2004, complete genome 10591.....................10611100
EU687243.1 Dengue virus 2 isolate DENV-2/US/BID-V1495/2004, complete genome 10591.....................10611100
EU687244.1 Dengue virus 2 isolate DENV-2/US/BID-V1496/2004, complete genome 10591.....................10611100
EU687245.1 Dengue virus 2 isolate DENV-2/US/BID-V1497/2005, complete genome 10591.....................10611100
EU687246.1 Dengue virus 2 isolate DENV-2/TH/BID-V1498/1994, complete genome 10592.....................10612100
EU687248.1 Dengue virus 2 isolate DENV-2/VN/BID-V1509/2007, complete genome 10591.....................10611100
EU687249.1 Dengue virus 2 isolate DENV-2/VN/BID-V1512/2007, complete genome 10591.....................10611100
EU687250.1 Dengue virus 2 isolate DENV-2/VN/BID-V1522/2007, complete genome 10581.....................10601100
EU726767.1 Dengue virus 2 isolate DENV-2/TH/BID-V1458/1994, complete genome 10591.....................10611100
EU726768.1 Dengue virus 3 isolate DENV-3/US/BID-V1465/2000, complete genome 10561.....................10581100
EU726769.1 Dengue virus 3 isolate DENV-3/US/BID-V1490/2003, complete genome 10561.....................10581100
EU726770.1 Dengue virus 2 isolate DENV-2/US/BID-V1440/2005, complete genome 10592.....................10612100
EU726771.1 Dengue virus 3 isolate DENV-3/US/BID-V1448/1998, complete genome 10561.....................10581100
EU726772.1 Dengue virus 3 isolate DENV-3/US/BID-V1449/1998, complete genome 10561.....................10581100
EU726773.1 Dengue virus 3 isolate DENV-3/US/BID-V1453/1999, complete genome 10563.....................10583100
EU726774.1 Dengue virus 3 isolate DENV-3/US/BID-V1454/1999, complete genome 10561.....................10581100
EU726775.1 Dengue virus 2 isolate DENV-2/VE/BID-V1457/1996, complete genome 10592.....................10612100
EU726776.1 Dengue virus 2 isolate DENV-2/VN/BID-V1514/2007, complete genome 10576.....................10596100
EU781135.1 Dengue virus 2 isolate DENV-2/US/BID-V1442/2005, complete genome 10591.....................10611100
EU781137.1 Dengue virus 3 isolate DENV-3/US/BID-V1452/1999, complete genome 10561.....................10581100
EU854291.1 Dengue virus 3 isolate DENV-3/VE/BID-V1591/2004, complete genome 10561.....................10581100
EU854292.1 Dengue virus 3 isolate DENV-3/VE/BID-V1593/2005, complete genome 10561.....................10581100
EU854293.1 Dengue virus 2 isolate DENV-2/CO/BID-V1599/1944, complete genome 10578.....................10598100
EU854294.1 Dengue virus 2 isolate DENV-2/CO/BID-V1601/2005, complete genome 10581.....................10601100
EU854295.1 Dengue virus 4 isolate DENV-4/US/BID-V1083/1986, complete genome 10518.....................10538100
EU854296.1 Dengue virus 4 isolate DENV-4/US/BID-V1093/1998, complete genome 10518.....................10538100
EU854297.1 Dengue virus 4 isolate DENV-4/US/BID-V1094/1998, complete genome 10518.....................10538100
EU854298.1 Dengue virus 3 isolate DENV-3/US/BID-V1477/2002, complete genome 10553.....................10573100
EU854299.1 Dengue virus 4 isolate DENV-4/VE/BID-V1157/2007, complete genome 10518.....................10538100
EU854300.1 Dengue virus 4 isolate DENV-4/VE/BID-V1159/2007, complete genome 10518.....................10538100
EU854301.1 Dengue virus 4 isolate DENV-4/VE/BID-V1161/2007, complete genome 10518.....................10538100
FJ024424.1 Dengue virus 4 isolate DENV-4/US/BID-V1082/1998, complete genome 10518.....................10538100
FJ024465.1 Dengue virus 3 isolate DENV-3/US/BID-V1606/2004, complete genome 10561.....................10581100
FJ024466.1 Dengue virus 3 isolate DENV-3/US/BID-V1607/2004, complete genome 10563.....................10583100
FJ024467.1 Dengue virus 3 isolate DENV-3/US/BID-V1608/2004, complete genome 10558.....................10578100
FJ024468.1 Dengue virus 3 isolate DENV-3/US/BID-V1609/2004, complete genome 10561.....................10581100
FJ024469.1 Dengue virus 3 isolate DENV-3/US/BID-V1610/2004, complete genome 10561.....................10581100
FJ024470.1 Dengue virus 3 isolate DENV-3/US/BID-V1612/2004, complete genome 10562.....................10582100
FJ024471.1 Dengue virus 3 isolate DENV-3/US/BID-V1613/2004, complete genome 10562.....................10582100
FJ024473.1 Dengue virus 2 isolate DENV-2/CO/BID-V1594/2005, complete genome 10592.....................10612100
FJ024474.1 Dengue virus 2 isolate DENV-2/CO/BID-V1595/2005, complete genome 10592.....................10612100
FJ024475.1 Dengue virus 2 isolate DENV-2/CO/BID-V1596/2005, complete genome 10592.....................10612100
FJ024476.1 Dengue virus 4 isolate DENV-4/CO/BID-V1600/1997, complete genome 10518.....................10538100
FJ024452.1 Dengue virus 2 isolate DENV-2/VN/BID-V1669/2007, complete genome 10591.....................10611100
FJ024454.1 Dengue virus 2 isolate DENV-2/VN/BID-V1675/2007, complete genome 10591.....................10611100
FJ024458.1 Dengue virus 2 isolate DENV-2/VN/BID-V1685/2007, complete genome 10591.....................10611100
FJ024461.1 Dengue virus 2 isolate DENV-2/VN/BID-V1697/2007, complete genome 10591.....................10611100
FM210202.1 Dengue virus 2 isolate DF768, complete genome 10602.....................10622100
FM210203.1 Dengue virus 2 isolate DF900, complete genome 10602.....................10622100
FM210205.1 Dengue virus 2 isolate MD1533, complete genome 10601.....................10621100
FM210206.1 Dengue virus 2 isolate MD1600, complete genome 10601.....................10621100
FM210207.1 Dengue virus 2 isolate MD1619, complete genome 10601.....................10621100
FM210209.1 Dengue virus 2 isolate DF726, complete genome 10603.....................10623100
FM210210.1 Dengue virus 2 isolate DF727, complete genome 10603.....................10623100
FM210211.1 Dengue virus 2 isolate DF907, complete genome 10603.....................10623100
FM210213.1 Dengue virus 2 isolate MD1504, complete genome 10603.....................10623100
FM210214.1 Dengue virus 2 isolate CSF63, complete genome 10597.....................10617100
FM210215.1 Dengue virus 2 isolate DF380, complete genome 10597.....................10617100
FM210216.1 Dengue virus 2 isolate DF401, complete genome 10597.....................10617100
FM210217.1 Dengue virus 2 isolate DF404, complete genome 10597.....................10617100
FM210219.1 Dengue virus 2 isolate DF670, complete genome 10597.....................10617100
FM210221.1 Dengue virus 2 isolate DF699, complete genome 10597.....................10617100
FM210222.1 Dengue virus 2 isolate DF755, complete genome 10597.....................10617100
FM210223.1 Dengue virus 2 isolate DF897, complete genome 10597.....................10617100
FM210224.1 Dengue virus 2 isolate MD518, complete genome 10597.....................10617100
FM210225.1 Dengue virus 2 isolate MD594, complete genome 10597.....................10617100
FM210226.1 Dengue virus 2 isolate MD861, complete genome 10597.....................10617100
FM210227.1 Dengue virus 2 isolate MD863, complete genome 10597.....................10617100
FM210228.1 Dengue virus 2 isolate MD917, complete genome 10597.....................10617100
FM210230.1 Dengue virus 2 isolate MD944, complete genome 10597.....................10617100
FM210231.1 Dengue virus 2 isolate MD1240, complete genome 10597.....................10617100
FM210232.2 Dengue virus 2 isolate MD1270, complete genome 10597.....................10617100
FM210233.2 Dengue virus 2 isolate MD1272, complete genome 10597.....................10617100
FM210234.2 Dengue virus 2 isolate MD1366, complete genome 10597.....................10617100
FM210235.2 Dengue virus 2 isolate MD1515, complete genome 10597.....................10617100
FM210237.2 Dengue virus 2 isolate DF657, complete genome 10596.....................10616100
FM210238.2 Dengue virus 2 isolate MD510, complete genome 10569.....................10589100
FM210239.2 Dengue virus 2 isolate MD1244, complete genome 10593.....................10613100
FM210240.2 Dengue virus 2 isolate MD1273, complete genome 10542.....................10562100
FM210241.2 Dengue virus 2 isolate MD1275, complete genome 10570.....................10590100
FM210242.2 Dengue virus 2 isolate MD1279, complete genome 10600.....................10620100
FM210243.2 Dengue virus 2 isolate MD1280, complete genome 10574.....................10594100
FM210244.2 Dengue virus 2 isolate MD1284, complete genome 10595.....................10615100
FM210245.2 Dengue virus 2 isolate MD1520, complete genome 10583.....................10603100
FJ182004.1 Dengue virus 3 isolate DENV-3/US/BID-V1604/2004, complete genome 10561.....................10581100
FJ182005.1 Dengue virus 3 isolate DENV-3/US/BID-V1614/2004, complete genome 10563.....................10583100
FJ182006.1 Dengue virus 3 isolate DENV-3/US/BID-V1616/2004, complete genome 10561.....................10581100
FJ182007.1 Dengue virus 3 isolate DENV-3/US/BID-V1617/2005, complete genome 10561.....................10581100
FJ182008.1 Dengue virus 3 isolate DENV-3/US/BID-V1618/2005, complete genome 10561.....................10581100
FJ182009.1 Dengue virus 3 isolate DENV-3/US/BID-V1619/2005, complete genome 10561.....................10581100
FJ182010.1 Dengue virus 3 isolate DENV-3/US/BID-V1620/2005, complete genome 10561.....................10581100
FJ182011.1 Dengue virus 3 isolate DENV-3/US/BID-V1621/2005, complete genome 10563.....................10583100
FJ182012.1 Dengue virus 2 isolate DENV-2/CO/BID-V1597/2005, complete genome 10583.....................10603100
FJ182013.1 Dengue virus 3 isolate DENV-3/US/BID-V1450/1998, complete genome 10561.....................10581100
FJ182014.1 Dengue virus 2 isolate DENV-2/NI/BID-V1303/2007, complete genome 10593.....................10613100
FJ182015.1 Dengue virus 3 isolate DENV-3/VE/BID-V1114/2001, complete genome 10561.....................10581100
FJ182016.1 Dengue virus 4 isolate DENV-4/VE/BID-V1158/2007, complete genome 10518.....................10538100
FJ182017.1 Dengue virus 4 isolate DENV-4/VE/BID-V1160/2007, complete genome 10518.....................10538100
FJ182037.1 Dengue virus 3 isolate DENV-3/US/BID-V1622/2005, complete genome 10561.....................10581100
FJ182038.1 Dengue virus 3 isolate DENV-3/US/BID-V1623/2005, complete genome 10561.....................10581100
FJ182039.1 Dengue virus 3 isolate DENV-3/US/BID-V1624/2005, complete genome 10561.....................10581100
FJ182040.1 Dengue virus 3 isolate DENV-3/US/BID-V1625/2005, complete genome 10565.....................10585100
FJ182041.1 Dengue virus 3 isolate DENV-3/US/BID-V1626/2005, complete genome 10561.....................10581100
FJ205870.1 Dengue virus 3 isolate DENV-3/US/BID-V1731/2003, complete genome 10561.....................10581100
FJ205871.1 Dengue virus 3 isolate DENV-3/US/BID-V1733/1999, complete genome 10564.....................10584100
FJ205885.1 Dengue virus 2 isolate DENV-2/NI/BID-V1721/2008, complete genome 10593.....................10613100
FJ205878.1 Dengue virus 2 isolate DENV-2/VN/BID-V1680/2007, complete genome 10591.....................10611100
FJ205879.1 Dengue virus 2 isolate DENV-2/VN/BID-V1682/2007, complete genome 10591.....................10611100
FJ205880.1 Dengue virus 2 isolate DENV-2/VN/BID-V1690/2007, complete genome 10591.....................10611100
FJ226066.1 Dengue virus 2 isolate DENV-2/NI/BID-V528/2005, complete genome 10597.....................10617100
FJ226067.1 Dengue virus 4 isolate DENV-4/US/BID-V860/1994, complete genome 10518.....................10538100
FJ373299.1 Dengue virus 2 isolate DENV-2/VN/BID-V1699/2007, complete genome 10591.....................10611100
FJ373300.1 Dengue virus 2 isolate DENV-2/NI/BID-V1194/2007, complete genome 10593.....................10613100
FJ373301.1 Dengue virus 2 isolate DENV-2/NI/BID-V1205/2007, complete genome 10593.....................10613100
FJ373302.1 Dengue virus 3 isolate DENV-3/US/BID-V1615/2004, complete genome 10565.....................10585100
FJ373303.1 Dengue virus 3 isolate DENV-3/VE/BID-V1585/2001, complete genome 10561.....................10581100
FJ373306.1 Dengue virus 3 isolate DENV-3/US/BID-V1478/2002, complete genome 10561.....................10581100
FJ390371.1 Dengue virus 3 isolate DENV-3/US/BID-V1729/2003, complete genome 10561.....................10581100
FJ390372.1 Dengue virus 3 isolate DENV-3/US/BID-V1730/2003, complete genome 10568.....................10588100
FJ390373.1 Dengue virus 3 isolate DENV-3/US/BID-V1732/2002, complete genome 10561.....................10581100
FJ390375.1 Dengue virus 3 isolate DENV-3/US/BID-V1735/1999, complete genome 10563.....................10583100
FJ390376.1 Dengue virus 3 isolate DENV-3/US/BID-V1736/1999, complete genome 10582.....................10602100
FJ390377.1 Dengue virus 3 isolate DENV-3/US/BID-V1737/1999, complete genome 10563.....................10583100
FJ390384.1 Dengue virus 2 isolate DENV-2/VN/BID-V1679/2007, complete genome 10591.....................10611100
FJ390385.1 Dengue virus 2 isolate DENV-2/VN/BID-V1684/2007, complete genome 10591.....................10611100
FJ390387.1 Dengue virus 2 isolate DENV-2/VN/BID-V1696/2007, complete genome 10581.....................10601100
FJ390389.1 Dengue virus 2 isolate DENV-2/CO/BID-V1598/1944, complete genome 10589.....................10609100
FJ390390.1 Dengue virus 2 isolate DENV-2/NI/BID-V1298/2007, complete genome 10592.....................10612100
FJ390391.1 Dengue virus 2 isolate DENV-2/NI/BID-V1300/2007, complete genome 10593.....................10613100
FJ410176.1 Dengue virus 3 isolate DENV-3/US/BID-V2104/2000, complete genome 10558.....................10578100
FJ410177.1 Dengue virus 3 isolate DENV-3/US/BID-V2105/2000, complete genome 10561.....................10581100
FJ410178.1 Dengue virus 3 isolate DENV-3/US/BID-V2120/2002, complete genome 10560.....................10580100
FJ410193.1 Dengue virus 2 isolate DENV-2/VN/BID-V1773/2007, complete genome 10579.....................10599100
FJ410195.1 Dengue virus 2 isolate DENV-2/VN/BID-V1776/2007, complete genome 10591.....................10611100
FJ410200.1 Dengue virus 2 isolate DENV-2/VN/BID-V1801/2007, complete genome 10591.....................10611100
FJ410202.1 Dengue virus 2 isolate DENV-2/VN/BID-V1807/2007, complete genome 10581.....................10601100
FJ410208.1 Dengue virus 2 isolate DENV-2/VN/BID-V1818/2007, complete genome 10588.....................10608100
FJ410215.1 Dengue virus 2 isolate DENV-2/VN/BID-V1844/2008, complete genome 10591.....................10611100
FJ410217.1 Dengue virus 2 isolate DENV-2/VN/BID-V1853/2007, complete genome 10591.....................10611100
FJ410219.1 Dengue virus 2 isolate DENV-2/VN/BID-V1857/2007, complete genome 10581.....................10601100
FJ410221.1 Dengue virus 2 isolate DENV-2/VN/BID-V1864/2007, complete genome 10591.....................10611100
FJ410223.1 Dengue virus 2 isolate DENV-2/VN/BID-V1869/2007, complete genome 10591.....................10611100
FJ410224.1 Dengue virus 2 isolate DENV-2/VN/BID-V1872/2007, complete genome 10591.....................10611100
FJ410228.1 Dengue virus 2 isolate DENV-2/VN/BID-V1881/2007, complete genome 10591.....................10611100
FJ410229.1 Dengue virus 3 isolate DENV-3/VN/BID-V1882/2007, complete genome 10551.....................10571100
FJ410233.1 Dengue virus 2 isolate DENV-2/VN/BID-V1895/2008, complete genome 10576.....................10596100
FJ410237.1 Dengue virus 2 isolate DENV-2/VN/BID-V1900/2008, complete genome 10591.....................10611100
FJ410241.1 Dengue virus 2 isolate DENV-2/VN/BID-V1905/2008, complete genome 10591.....................10611100
FJ410259.1 Dengue virus 2 isolate DENV-2/VN/BID-V1928/2008, complete genome 10591.....................10611100
FJ410288.1 Dengue virus 2 isolate DENV-2/VN/BID-V1654/2007, complete genome 10591.....................10611100
FJ410291.1 Dengue virus 2 isolate DENV-2/NI/BID-V1233/2007, complete genome 10592.....................10612100
FJ478455.1 Dengue virus 2 isolate DENV-2/NI/BID-V532/2005, complete genome 10593.....................10613100
FJ478456.1 Dengue virus 3 isolate DENV-3/US/BID-V2123/2002, complete genome 10561.....................10581100
FJ478459.1 Dengue virus 2 isolate DENV-2/NI/BID-V1214/2007, complete genome 10593.....................10613100
FJ547061.1 Dengue virus 3 isolate DENV-3/VN/BID-V1831/2007, complete genome 10551.....................10571100
FJ547062.1 Dengue virus 3 isolate DENV-3/VN/BID-V1833/2007, complete genome 10551.....................10571100
FJ547064.1 Dengue virus 2 isolate DENV-2/VN/BID-V1868/2007, complete genome 10592.....................10612100
FJ547066.1 Dengue virus 3 isolate DENV-3/VN/BID-V1911/2008, complete genome 10550.....................10570100
FJ547067.1 Dengue virus 2 isolate DENV-2/VN/BID-V1930/2007, complete genome 10591.....................10611100
FJ547069.1 Dengue virus 3 isolate DENV-3/US/BID-V2098/1999, complete genome 10561.....................10581100
FJ547070.1 Dengue virus 3 isolate DENV-3/US/BID-V2099/1998, complete genome 10561.....................10581100
FJ547071.1 Dengue virus 3 isolate DENV-3/US/BID-V2103/2000, complete genome 10561.....................10581100
FJ547072.1 Dengue virus 3 isolate DENV-3/US/BID-V2106/2000, complete genome 10562.....................10582100
FJ547073.1 Dengue virus 3 isolate DENV-3/US/BID-V2107/2000, complete genome 10561.....................10581100
FJ547074.1 Dengue virus 3 isolate DENV-3/US/BID-V2108/2000, complete genome 10561.....................10581100
FJ547075.1 Dengue virus 3 isolate DENV-3/US/BID-V2110/2000, complete genome 10561.....................10581100
FJ547076.1 Dengue virus 3 isolate DENV-3/US/BID-V2111/2000, complete genome 10561.....................10581100
FJ547077.1 Dengue virus 3 isolate DENV-3/US/BID-V2112/2000, complete genome 10561.....................10581100
FJ547078.1 Dengue virus 3 isolate DENV-3/US/BID-V2113/2000, complete genome 10561.....................10581100
FJ547079.1 Dengue virus 3 isolate DENV-3/US/BID-V2114/2001, complete genome 10561.....................10581100
FJ547080.1 Dengue virus 3 isolate DENV-3/US/BID-V2115/2001, complete genome 10561.....................10581100
FJ547081.1 Dengue virus 3 isolate DENV-3/US/BID-V2117/2001, complete genome 10561.....................10581100
FJ547082.1 Dengue virus 3 isolate DENV-3/US/BID-V2118/2001, complete genome 10561.....................10581100
FJ547083.1 Dengue virus 3 isolate DENV-3/US/BID-V2119/2002, complete genome 10562.....................10582100
FJ547084.1 Dengue virus 3 isolate DENV-3/US/BID-V2122/2002, complete genome 10561.....................10581100
FJ547085.1 Dengue virus 3 isolate DENV-3/US/BID-V2126/2006, complete genome 10561.....................10581100
FJ562097.1 Dengue virus 3 isolate DENV-3/VN/BID-V1790/2007, complete genome 10561.....................10581100
FJ562098.1 Dengue virus 2 isolate DENV-2/VN/BID-V1794/2007, complete genome 10579.....................10599100
FJ562099.1 Dengue virus 3 isolate DENV-3/VN/BID-V1815/2007, complete genome 10564.....................10584100
FJ562100.1 Dengue virus 3 isolate DENV-3/VN/BID-V1824/2007, complete genome 10551.....................10571100
FJ562102.1 Dengue virus 3 isolate DENV-3/VN/BID-V1877/2007, complete genome 10551.....................10571100
FJ562103.1 Dengue virus 3 isolate DENV-3/VN/BID-V1957/2008, complete genome 10557.....................10577100
FJ562107.1 Dengue virus 3 isolate DENV-3/US/BID-V2100/2000, complete genome 10561.....................10581100
FJ547090.1 Dengue virus 2 isolate DENV-2/NI/BID-V1311/2007, complete genome 10593.....................10613100
FJ639732.1 Dengue virus 2 isolate DENV-2/VE/BID-V2158/2005, complete genome 10582.....................10602100
FJ639733.1 Dengue virus 2 isolate DENV-2/VE/BID-V2159/2005, complete genome 10591.....................10611100
FJ639734.1 Dengue virus 2 isolate DENV-2/VE/BID-V2160/2003, complete genome 10580.....................10600100
FJ639736.1 Dengue virus 4 isolate DENV-4/VE/BID-V2163/1998, complete genome 10518.....................10538100
FJ639737.1 Dengue virus 4 isolate DENV-4/VE/BID-V2164/1998, complete genome 10519.....................10539100
FJ639738.1 Dengue virus 4 isolate DENV-4/VE/BID-V2165/1998, complete genome 10518.....................10538100
FJ639739.1 Dengue virus 4 isolate DENV-4/VE/BID-V2166/1998, complete genome 10518.....................10538100
FJ639742.1 Dengue virus 4 isolate DENV-4/VE/BID-V2170/1999, complete genome 10518.....................10538100
FJ639744.1 Dengue virus 4 isolate DENV-4/VE/BID-V2172/1999, complete genome 10518.....................10538100
FJ639745.1 Dengue virus 4 isolate DENV-4/VE/BID-V2173/1999, complete genome 10518.....................10538100
FJ639746.1 Dengue virus 3 isolate DENV-3/VE/BID-V2174/2000, complete genome 10561.....................10581100
FJ639747.1 Dengue virus 3 isolate DENV-3/VE/BID-V2175/2000, complete genome 10561.....................10581100
FJ639748.1 Dengue virus 4 isolate DENV-4/VE/BID-V2177/2000, complete genome 10503.....................10523100
FJ639749.1 Dengue virus 3 isolate DENV-3/VE/BID-V2178/2000, complete genome 10560.....................10580100
FJ639750.1 Dengue virus 3 isolate DENV-3/VE/BID-V2179/2000, complete genome 10561.....................10581100
FJ639751.1 Dengue virus 3 isolate DENV-3/VE/BID-V2180/2001, complete genome 10561.....................10581100
FJ639752.1 Dengue virus 3 isolate DENV-3/VE/BID-V2181/2001, complete genome 10561.....................10581100
FJ639753.1 Dengue virus 3 isolate DENV-3/VE/BID-V2182/2001, complete genome 10560.....................10580100
FJ639754.1 Dengue virus 3 isolate DENV-3/VE/BID-V2183/2001, complete genome 10561.....................10581100
FJ639755.1 Dengue virus 3 isolate DENV-3/VE/BID-V2184/2001, complete genome 10561.....................10581100
FJ639756.1 Dengue virus 3 isolate DENV-3/VE/BID-V2185/2001, complete genome 10561.....................10581100
FJ639757.1 Dengue virus 3 isolate DENV-3/VE/BID-V2187/2001, complete genome 10560.....................10580100
FJ639758.1 Dengue virus 3 isolate DENV-3/VE/BID-V2188/2001, complete genome 10561.....................10581100
FJ639759.1 Dengue virus 3 isolate DENV-3/VE/BID-V2189/2001, complete genome 10561.....................10581100
FJ639760.1 Dengue virus 3 isolate DENV-3/VE/BID-V2190/2001, complete genome 10562.....................10582100
FJ639761.1 Dengue virus 3 isolate DENV-3/VE/BID-V2191/2001, complete genome 10561.....................10581100
FJ639762.1 Dengue virus 3 isolate DENV-3/VE/BID-V2192/2001, complete genome 10564.....................10584100
FJ639763.1 Dengue virus 3 isolate DENV-3/VE/BID-V2193/2001, complete genome 10561.....................10581100
FJ639764.1 Dengue virus 4 isolate DENV-4/VE/BID-V2194/2001, complete genome 10518.....................10538100
FJ639765.1 Dengue virus 3 isolate DENV-3/VE/BID-V2195/2001, complete genome 10561.....................10581100
FJ639766.1 Dengue virus 3 isolate DENV-3/VE/BID-V2196/2001, complete genome 10561.....................10581100
FJ639767.1 Dengue virus 3 isolate DENV-3/VE/BID-V2197/2001, complete genome 10560.....................10580100
FJ639768.1 Dengue virus 3 isolate DENV-3/VE/BID-V2198/2001, complete genome 10561.....................10581100
FJ639769.1 Dengue virus 3 isolate DENV-3/VE/BID-V2199/2001, complete genome 10560.....................10580100
FJ639770.1 Dengue virus 3 isolate DENV-3/VE/BID-V2203/2001, complete genome 10561.....................10581100
FJ639771.1 Dengue virus 3 isolate DENV-3/VE/BID-V2204/2001, complete genome 10560.....................10580100
FJ639772.1 Dengue virus 3 isolate DENV-3/VE/BID-V2205/2007, complete genome 10561.....................10581100
FJ639773.1 Dengue virus 4 isolate DENV-4/VE/BID-V2206/2001, complete genome 10518.....................10538100
FJ639774.1 Dengue virus 3 isolate DENV-3/VE/BID-V2207/2001, complete genome 10560.....................10580100
FJ639775.1 Dengue virus 3 isolate DENV-3/VE/BID-V2208/2002, complete genome 10561.....................10581100
FJ639776.1 Dengue virus 3 isolate DENV-3/VE/BID-V2209/2002, complete genome 10561.....................10581100
FJ639777.1 Dengue virus 3 isolate DENV-3/VE/BID-V2210/2002, complete genome 10561.....................10581100
FJ639778.1 Dengue virus 3 isolate DENV-3/VE/BID-V2211/2002, complete genome 10562.....................10582100
FJ639779.1 Dengue virus 3 isolate DENV-3/VE/BID-V2212/2003, complete genome 10561.....................10581100
FJ639780.1 Dengue virus 3 isolate DENV-3/VE/BID-V2213/2003, complete genome 10562.....................10582100
FJ639781.1 Dengue virus 3 isolate DENV-3/VE/BID-V2214/2003, complete genome 10561.....................10581100
FJ639782.1 Dengue virus 3 isolate DENV-3/VE/BID-V2215/2003, complete genome 10567.....................10587100
FJ639784.1 Dengue virus 3 isolate DENV-3/VE/BID-V2217/2003, complete genome 10561.....................10581100
FJ639785.1 Dengue virus 3 isolate DENV-3/VE/BID-V2218/2003, complete genome 10561.....................10581100
FJ639786.1 Dengue virus 3 isolate DENV-3/VE/BID-V2219/2003, complete genome 10567.....................10587100
FJ639787.1 Dengue virus 3 isolate DENV-3/VE/BID-V2220/2004, complete genome 10561.....................10581100
FJ639789.1 Dengue virus 3 isolate DENV-3/VE/BID-V2222/2004, complete genome 10563.....................10583100
FJ639790.1 Dengue virus 3 isolate DENV-3/VE/BID-V2223/2004, complete genome 10567.....................10587100
FJ639791.1 Dengue virus 3 isolate DENV-3/VE/BID-V2224/2004, complete genome 10560.....................10580100
FJ639792.1 Dengue virus 3 isolate DENV-3/VE/BID-V2225/2004, complete genome 10561.....................10581100
FJ639793.1 Dengue virus 3 isolate DENV-3/VE/BID-V2226/2004, complete genome 10561.....................10581100
FJ639795.1 Dengue virus 3 isolate DENV-3/VE/BID-V2228/2004, complete genome 10560.....................10580100
FJ639798.1 Dengue virus 3 isolate DENV-3/VE/BID-V2231/2004, complete genome 10561.....................10581100
FJ639799.1 Dengue virus 3 isolate DENV-3/VE/BID-V2232/2004, complete genome 10566.....................10586100
FJ639800.1 Dengue virus 3 isolate DENV-3/VE/BID-V2233/2004, complete genome 10561.....................10581100
FJ639801.1 Dengue virus 3 isolate DENV-3/VE/BID-V2234/2004, complete genome 10561.....................10581100
FJ639803.1 Dengue virus 3 isolate DENV-3/VE/BID-V2239/2005, complete genome 10561.....................10581100
FJ639804.1 Dengue virus 3 isolate DENV-3/VE/BID-V2240/2005, complete genome 10561.....................10581100
FJ639805.1 Dengue virus 3 isolate DENV-3/VE/BID-V2242/2005, complete genome 10562.....................10582100
FJ639807.1 Dengue virus 3 isolate DENV-3/VE/BID-V2244/2005, complete genome 10561.....................10581100
FJ639809.1 Dengue virus 2 isolate DENV-2/VE/BID-V2246/2005, complete genome 10591.....................10611100
FJ639810.1 Dengue virus 3 isolate DENV-3/VE/BID-V2247/2005, complete genome 10561.....................10581100
FJ639816.1 Dengue virus 3 isolate DENV-3/VE/BID-V2256/2005, complete genome 10561.....................10581100
FJ639817.1 Dengue virus 3 isolate DENV-3/VE/BID-V2257/2006, complete genome 10562.....................10582100
FJ639825.1 Dengue virus 3 isolate DENV-3/VE/BID-V2266/2006, complete genome 10561.....................10581100
FJ639826.1 Dengue virus 3 isolate DENV-3/VE/BID-V2267/2008, complete genome 10567.....................10587100
FJ639827.1 Dengue virus 3 isolate DENV-3/VE/BID-V2268/2008, complete genome 10562.....................10582100
FJ639828.1 Dengue virus 2 isolate DENV-2/TH/BID-V2153/2001, complete genome 10592.....................10612100
FJ639829.1 Dengue virus 2 isolate DENV-2/TH/BID-V2154/2001, complete genome 10592.....................10612100
FJ639830.1 Dengue virus 2 isolate DENV-2/TH/BID-V2155/2001, complete genome 10592.....................10612100
FJ639831.1 Dengue virus 2 isolate DENV-2/TH/BID-V2156/2001, complete genome 10592.....................10612100
FJ639832.1 Dengue virus 2 isolate DENV-2/TH/BID-V2157/2001, complete genome 10591.....................10611100
FJ639833.1 Dengue virus 2 isolate DENV-2/NI/BID-V1237/2007, complete genome 10593.....................10613100
FJ639834.1 Dengue virus 2 isolate DENV-2/NI/BID-V2354/2007, complete genome 10578.....................10598100
FJ639835.1 Dengue virus 2 isolate DENV-2/NI/BID-V2355/2007, complete genome 10593.....................10613100
FJ639836.1 Dengue virus 2 isolate DENV-2/NI/BID-V2357/2007, complete genome 10593.....................10613100
FJ639837.1 Dengue virus 2 isolate DENV-2/NI/BID-V2358/2007, complete genome 10593.....................10613100
FJ432722.1 Dengue virus 3 isolate DENV-3/VN/BID-V1769/2007, complete genome 10561.....................10581100
FJ432726.1 Dengue virus 2 isolate DENV-2/VN/BID-V1780/2007, complete genome 10591.....................10611100
FJ432728.1 Dengue virus 3 isolate DENV-3/VN/BID-V1783/2007, complete genome 10551.....................10571100
FJ432729.1 Dengue virus 1 isolate DENV-1/VN/BID-V1784/2007, complete genome 10602.....................10622100
FJ432731.1 Dengue virus 3 isolate DENV-3/VN/BID-V1786/2007, complete genome 10551.....................10571100
FJ432733.1 Dengue virus 1 isolate DENV-1/VN/BID-V1788/2007, complete genome 10602.....................10622100
FJ432741.1 Dengue virus 3 isolate DENV-3/VN/BID-V1810/2007, complete genome 10551.....................10571100
FJ432743.1 Dengue virus 3 isolate DENV-3/VN/BID-V1817/2007, complete genome 10561.....................10581100
FJ461305.1 Dengue virus 2 isolate DENV-2/VN/BID-V1837/2007, complete genome 10578.....................10598100
FJ461309.1 Dengue virus 2 isolate DENV-2/VN/BID-V1845/2008, complete genome 10591.....................10611100
FJ461311.1 Dengue virus 2 isolate DENV-2/VN/BID-V1848/2008, complete genome 10591.....................10611100
FJ461314.1 Dengue virus 2 isolate DENV-2/VN/BID-V1858/2007, complete genome 10591.....................10611100
FJ461321.1 Dengue virus 2 isolate DENV-2/VN/BID-V1873/2007, complete genome 10591.....................10611100
FJ461322.1 Dengue virus 3 isolate DENV-3/VN/BID-V1874/2008, complete genome 10551.....................10571100
FJ461326.1 Dengue virus 3 isolate DENV-3/VN/BID-V1891/2007, complete genome 10551.....................10571100
FJ461329.1 Dengue virus 3 isolate DENV-3/VN/BID-V1897/2007, complete genome 10551.....................10571100
FJ461337.1 Dengue virus 3 isolate DENV-3/VN/BID-V1946/2008, complete genome 10551.....................10571100
FJ461338.1 Dengue virus 3 isolate DENV-3/VN/BID-V1953/2008, complete genome 10551.....................10571100
FJ639697.1 Dengue virus 2 isolate DENV-2/KH/BID-V2020/2001, complete genome 10581.....................10601100
FJ639698.1 Dengue virus 2 isolate DENV-2/KH/BID-V2021/2002, complete genome 10593.....................10613100
FJ639699.1 Dengue virus 2 isolate DENV-2/KH/BID-V2022/2002, complete genome 10594.....................10614100
FJ639700.1 Dengue virus 2 isolate DENV-2/KH/BID-V2023/2002, complete genome 10594.....................10614100
FJ639701.1 Dengue virus 2 isolate DENV-2/KH/BID-V2024/2002, complete genome 10594.....................10614100
FJ639702.1 Dengue virus 2 isolate DENV-2/KH/BID-V2030/2003, complete genome 10580.....................10600100
FJ639703.1 Dengue virus 2 isolate DENV-2/KH/BID-V2033/2003, complete genome 10576.....................10596100
FJ639704.1 Dengue virus 2 isolate DENV-2/KH/BID-V2036/2003, complete genome 10586.....................10606100
FJ639705.1 Dengue virus 2 isolate DENV-2/KH/BID-V2039/2003, complete genome 10592.....................10612100
FJ639706.1 Dengue virus 2 isolate DENV-2/KH/BID-V2040/2004, complete genome 10592.....................10612100
FJ639707.1 Dengue virus 2 isolate DENV-2/KH/BID-V2041/2004, complete genome 10591.....................10611100
FJ639708.1 Dengue virus 2 isolate DENV-2/KH/BID-V2042/2005, complete genome 10591.....................10611100
FJ639709.1 Dengue virus 2 isolate DENV-2/KH/BID-V2043/2005, complete genome 10593.....................10613100
FJ639710.1 Dengue virus 2 isolate DENV-2/KH/BID-V2044/2005, complete genome 10580.....................10600100
FJ639711.1 Dengue virus 2 isolate DENV-2/KH/BID-V2045/2005, complete genome 10580.....................10600100
FJ639712.1 Dengue virus 3 isolate DENV-3/KH/BID-V2050/2007, complete genome 10556.....................10576100
FJ639714.1 Dengue virus 3 isolate DENV-3/KH/BID-V2052/2007, complete genome 10562.....................10582100
FJ639715.1 Dengue virus 3 isolate DENV-3/KH/BID-V2053/2008, complete genome 10561.....................10581100
FJ639716.1 Dengue virus 3 isolate DENV-3/KH/BID-V2054/2008, complete genome 10561.....................10581100
FJ639717.1 Dengue virus 2 isolate DENV-2/KH/BID-V2066/2007, complete genome 10592.....................10612100
FJ639718.1 Dengue virus 2 isolate DENV-2/KH/BID-V2068/2008, complete genome 10616.....................10636100
FJ639719.1 Dengue virus 3 isolate DENV-3/KH/BID-V2071/2000, complete genome 10561.....................10581100
FJ639720.1 Dengue virus 3 isolate DENV-3/KH/BID-V2073/2001, complete genome 10561.....................10581100
FJ639721.1 Dengue virus 3 isolate DENV-3/KH/BID-V2078/2002, complete genome 10561.....................10581100
FJ639722.1 Dengue virus 3 isolate DENV-3/KH/BID-V2079/2002, complete genome 10561.....................10581100
FJ639723.1 Dengue virus 3 isolate DENV-3/KH/BID-V2080/2003, complete genome 10561.....................10581100
FJ639724.1 Dengue virus 3 isolate DENV-3/KH/BID-V2081/2003, complete genome 10561.....................10581100
FJ639725.1 Dengue virus 3 isolate DENV-3/KH/BID-V2082/2003, complete genome 10561.....................10581100
FJ639726.1 Dengue virus 3 isolate DENV-3/KH/BID-V2083/2004, complete genome 10561.....................10581100
FJ639727.1 Dengue virus 3 isolate DENV-3/KH/BID-V2086/2005, complete genome 10561.....................10581100
FJ639728.1 Dengue virus 3 isolate DENV-3/KH/BID-V2088/2005, complete genome 10561.....................10581100
FJ639729.1 Dengue virus 3 isolate DENV-3/KH/BID-V2089/2006, complete genome 10561.....................10581100
FJ639730.1 Dengue virus 3 isolate DENV-3/KH/BID-V2090/2006, complete genome 10561.....................10581100
FJ639731.1 Dengue virus 3 isolate DENV-3/KH/BID-V2092/2007, complete genome 10561.....................10581100
FJ687434.1 Dengue virus 2 isolate DENV-2/TH/BID-V2278/2001, complete genome 10592.....................10612100
FJ687435.1 Dengue virus 2 isolate DENV-2/TH/BID-V2279/2001, complete genome 10592.....................10612100
FJ687436.1 Dengue virus 2 isolate DENV-2/TH/BID-V2280/2001, complete genome 10592.....................10612100
FJ687437.1 Dengue virus 2 isolate DENV-2/TH/BID-V2281/2001, complete genome 10591.....................10611100
FJ687438.1 Dengue virus 2 isolate DENV-2/TH/BID-V2282/2001, complete genome 10591.....................10611100
FJ687439.1 Dengue virus 2 isolate DENV-2/TH/BID-V2283/2001, complete genome 10591.....................10611100
FJ687440.1 Dengue virus 2 isolate DENV-2/TH/BID-V2284/2001, complete genome 10592.....................10612100
FJ687441.1 Dengue virus 2 isolate DENV-2/TH/BID-V2286/2001, complete genome 10592.....................10612100
FJ687442.1 Dengue virus 2 isolate DENV-2/TH/BID-V2287/2001, complete genome 10592.....................10612100
FJ687443.1 Dengue virus 2 isolate DENV-2/TH/BID-V2288/2001, complete genome 10592.....................10612100
FJ687444.1 Dengue virus 2 isolate DENV-2/TH/BID-V2289/2001, complete genome 10592.....................10612100
FJ687445.1 Dengue virus 2 isolate DENV-2/TH/BID-V2290/2001, complete genome 10592.....................10612100
FJ687446.1 Dengue virus 2 isolate DENV-2/TH/BID-V2292/2001, complete genome 10592.....................10612100
FJ687447.1 Dengue virus 2 isolate DENV-2/TH/BID-V2293/2001, complete genome 10591.....................10611100
FJ687448.1 Dengue virus 3 isolate DENV-3/TH/BID-V2318/2001, complete genome 10563.....................10583100
FJ744700.1 Dengue virus 3 isolate DENV-3/VE/BID-V2186/2001, complete genome 10561.....................10581100
FJ744703.1 Dengue virus 2 isolate DENV-2/NI/BID-V1764/2007, complete genome 10593.....................10613100
FJ744710.1 Dengue virus 2 isolate DENV-2/TH/BID-V2294/2001, complete genome 10591.....................10611100
FJ744711.1 Dengue virus 2 isolate DENV-2/TH/BID-V2295/2001, complete genome 10591.....................10611100
FJ744712.1 Dengue virus 2 isolate DENV-2/TH/BID-V2296/2001, complete genome 10591.....................10611100
FJ744713.1 Dengue virus 2 isolate DENV-2/TH/BID-V2298/2001, complete genome 10591.....................10611100
FJ744714.1 Dengue virus 2 isolate DENV-2/TH/BID-V2300/2001, complete genome 10591.....................10611100
FJ744715.1 Dengue virus 2 isolate DENV-2/TH/BID-V2301/2001, complete genome 10591.....................10611100
FJ744716.1 Dengue virus 2 isolate DENV-2/TH/BID-V2302/2001, complete genome 10591.....................10611100
FJ744717.1 Dengue virus 2 isolate DENV-2/TH/BID-V2303/2001, complete genome 10591.....................10611100
FJ744718.1 Dengue virus 2 isolate DENV-2/TH/BID-V2304/2001, complete genome 10591.....................10611100
FJ744719.1 Dengue virus 2 isolate DENV-2/TH/BID-V2305/2001, complete genome 10633.....................10653100
FJ744720.1 Dengue virus 2 isolate DENV-2/TH/BID-V2306/2001, complete genome 10592.....................10612100
FJ744721.1 Dengue virus 2 isolate DENV-2/TH/BID-V2307/2001, complete genome 10592.....................10612100
FJ744722.1 Dengue virus 2 isolate DENV-2/TH/BID-V2308/2001, complete genome 10592.....................10612100
FJ744723.1 Dengue virus 2 isolate DENV-2/TH/BID-V2309/2001, complete genome 10592.....................10612100
FJ744724.1 Dengue virus 2 isolate DENV-2/TH/BID-V2310/2001, complete genome 10592.....................10612100
FJ744725.1 Dengue virus 2 isolate DENV-2/TH/BID-V2311/2001, complete genome 10591.....................10611100
FJ744726.1 Dengue virus 3 isolate DENV-3/TH/BID-V2312/2001, complete genome 10562.....................10582100
FJ744727.1 Dengue virus 3 isolate DENV-3/TH/BID-V2313/2001, complete genome 10578.....................10598100
FJ744728.1 Dengue virus 3 isolate DENV-3/TH/BID-V2314/2001, complete genome 10577.....................10597100
FJ744729.1 Dengue virus 3 isolate DENV-3/TH/BID-V2315/2001, complete genome 10576.....................10596100
FJ744730.1 Dengue virus 3 isolate DENV-3/TH/BID-V2316/2001, complete genome 10576.....................10596100
FJ744731.1 Dengue virus 3 isolate DENV-3/TH/BID-V2317/2001, complete genome 10576.....................10596100
FJ744732.1 Dengue virus 3 isolate DENV-3/TH/BID-V2320/2001, complete genome 10576.....................10596100
FJ744733.1 Dengue virus 3 isolate DENV-3/TH/BID-V2321/2001, complete genome 10576.....................10596100
FJ744734.1 Dengue virus 3 isolate DENV-3/TH/BID-V2323/2001, complete genome 10576.....................10596100
FJ744735.1 Dengue virus 3 isolate DENV-3/TH/BID-V2324/2001, complete genome 10576.....................10596100
FJ744736.1 Dengue virus 3 isolate DENV-3/TH/BID-V2325/2001, complete genome 10576.....................10596100
FJ744737.1 Dengue virus 3 isolate DENV-3/TH/BID-V2326/2001, complete genome 10576.....................10596100
FJ744738.1 Dengue virus 3 isolate DENV-3/TH/BID-V2327/2001, complete genome 10576.....................10596100
FJ744739.1 Dengue virus 3 isolate DENV-3/TH/BID-V2328/2001, complete genome 10561.....................10581100
FJ744740.1 Dengue virus 3 isolate DENV-3/TH/BID-V2329/2001, complete genome 10561.....................10581100
FJ744741.1 Dengue virus 2 isolate DENV-2/NI/BID-V1762/2006, complete genome 10592.....................10612100
FJ744742.1 Dengue virus 2 isolate DENV-2/NI/BID-V1763/2006, complete genome 10593.....................10613100
FJ744743.1 Dengue virus 2 isolate DENV-2/NI/BID-V1755/2007, complete genome 10609.....................10629100
FJ744744.1 Dengue virus 2 isolate DENV-2/NI/BID-V2364/2000, complete genome 10577.....................10597100
FJ744745.1 Dengue virus 2 isolate DENV-2/NI/BID-V2362/2000, complete genome 10592.....................10612100
FJ744704.1 Dengue virus 2 isolate DENV-2/NI/BID-V2361/2001, complete genome 10577.....................10597100
FJ744705.1 Dengue virus 2 isolate DENV-2/NI/BID-V2363/2000, complete genome 10582.....................10602100
FJ744706.1 Dengue virus 2 isolate DENV-2/NI/BID-V2359/2007, complete genome 10593.....................10613100
FJ744707.1 Dengue virus 2 isolate DENV-2/NI/BID-V2360/2007, complete genome 10593.....................10613100
FJ744708.1 Dengue virus 2 isolate DENV-2/NI/BID-V2352/2007, complete genome 10593.....................10613100
FJ744709.1 Dengue virus 2 isolate DENV-2/NI/BID-V2351/2008, complete genome 10593.....................10613100
FJ810409.1 Dengue virus 2 isolate DENV-2/TH/BID-V2285/2001, complete genome 10592.....................10612100
FJ810410.1 Dengue virus 2 isolate DENV-2/TH/BID-V2291/2001, complete genome 10592.....................10612100
FJ810411.1 Dengue virus 2 isolate DENV-2/TH/BID-V2297/2001, complete genome 10591.....................10611100
FJ810412.1 Dengue virus 2 isolate DENV-2/TH/BID-V2299/2001, complete genome 10591.....................10611100
FJ810413.1 Dengue virus 3 isolate DENV-3/TH/BID-V2319/2001, complete genome 10576.....................10596100
FJ810414.1 Dengue virus 3 isolate DENV-3/TH/BID-V2322/2001, complete genome 10576.....................10596100
FJ810416.1 Dengue virus 3 isolate DENV-3/VE/BID-V2453/2001, complete genome 10576.....................10596100
FJ810417.1 Dengue virus 4 isolate DENV-4/US/BID-V2433/1995, complete genome 10518.....................10538100
FJ810418.1 Dengue virus 2 isolate DENV-2/NI/BID-V2353/2008, complete genome 10593.....................10613100
FJ850055.1 Dengue virus 3 isolate DENV-3/US/BID-V1605/2004, complete genome 10561.....................10581100
FJ850056.1 Dengue virus 3 isolate DENV-3/US/BID-V1611/2004, complete genome 10562.....................10582100
FJ850057.1 Dengue virus 4 isolate DENV-4/US/BID-V2434/1995, complete genome 10518.....................10538100
FJ850058.1 Dengue virus 4 isolate DENV-4/US/BID-V2440/1996, complete genome 10518.....................10538100
FJ850059.1 Dengue virus 4 isolate DENV-4/US/BID-V2443/1998, complete genome 10518.....................10538100
FJ850071.1 Dengue virus 1 isolate DENV-1/BR/BID-V2375/2000, complete genome 10598.....................10618100
FJ850072.1 Dengue virus 2 isolate DENV-2/BR/BID-V2376/2000, complete genome 10591.....................10611100
FJ850073.1 Dengue virus 1 isolate DENV-1/BR/BID-V2378/2001, complete genome 10606.....................10626100
FJ850074.1 Dengue virus 2 isolate DENV-2/BR/BID-V2379/2001, complete genome 10591.....................10611100
FJ850076.1 Dengue virus 2 isolate DENV-2/BR/BID-V2382/2002, complete genome 10577.....................10597100
FJ850078.1 Dengue virus 2 isolate DENV-2/BR/BID-V2386/2003, complete genome 10581.....................10601100
FJ850079.1 Dengue virus 3 isolate DENV-3/BR/BID-V2387/2003, complete genome 10576.....................10596100
FJ850080.1 Dengue virus 3 isolate DENV-3/BR/BID-V2388/2003, complete genome 10576.....................10596100
FJ850082.1 Dengue virus 2 isolate DENV-2/BR/BID-V2390/2004, complete genome 10591.....................10611100
FJ850083.1 Dengue virus 3 isolate DENV-3/BR/BID-V2391/2004, complete genome 10576.....................10596100
FJ850084.1 Dengue virus 1 isolate DENV-1/BR/BID-V2392/2005, complete genome 10605.....................10625100
FJ850085.1 Dengue virus 2 isolate DENV-2/BR/BID-V2393/2005, complete genome 10591.....................10611100
FJ850086.1 Dengue virus 3 isolate DENV-3/BR/BID-V2394/2005, complete genome 10576.....................10596100
FJ850088.1 Dengue virus 2 isolate DENV-2/BR/BID-V2396/2006, complete genome 10581.....................10601100
FJ850089.1 Dengue virus 3 isolate DENV-3/BR/BID-V2397/2006, complete genome 10576.....................10596100
FJ850090.1 Dengue virus 1 isolate DENV-1/BR/BID-V2398/2007, complete genome 10587.....................10607100
FJ850091.1 Dengue virus 2 isolate DENV-2/BR/BID-V2399/2007, complete genome 10591.....................10611100
FJ850092.1 Dengue virus 3 isolate DENV-3/BR/BID-V2400/2007, complete genome 10576.....................10596100
FJ850094.1 Dengue virus 3 isolate DENV-3/BR/BID-V2403/2008, complete genome 10575.....................10595100
FJ850115.1 Dengue virus 2 isolate DENV-2/NI/BID-V634/2005, complete genome 10592.....................10612100
FJ850116.1 Dengue virus 2 isolate DENV-2/NI/BID-V1197/2007, complete genome 10593.....................10613100
FJ850118.1 Dengue virus 2 isolate DENV-2/NI/BID-V2658/2000, complete genome 10592.....................10612100
FJ850119.1 Dengue virus 2 isolate DENV-2/NI/BID-V2662/2000, complete genome 10592.....................10612100
FJ850120.1 Dengue virus 2 isolate DENV-2/NI/BID-V2673/2001, complete genome 10592.....................10612100
FJ850121.1 Dengue virus 2 isolate DENV-2/NI/BID-V2674/2001, complete genome 10592.....................10612100
FJ850048.1 Dengue virus 3 isolate DENV-3/NI/BID-V2653/2008, complete genome 10565.....................10585100
FJ850049.1 Dengue virus 3 isolate DENV-3/NI/BID-V2654/2008, complete genome 10565.....................10585100
FJ850050.1 Dengue virus 2 isolate DENV-2/NI/BID-V2356/2007, complete genome 10582.....................10602100
FJ850051.1 Dengue virus 2 isolate DENV-2/NI/BID-V2635/2007, complete genome 10592.....................10612100
FJ850052.1 Dengue virus 3 isolate DENV-3/NI/BID-V2644/2008, complete genome 10565.....................10585100
FJ850053.1 Dengue virus 2 isolate DENV-2/NI/BID-V2574/2005, complete genome 10592.....................10612100
FJ850054.1 Dengue virus 2 isolate DENV-2/NI/BID-V2576/2005, complete genome 10592.....................10612100
FJ850060.1 Dengue virus 2 isolate DENV-2/NI/BID-V2344/2000, complete genome 10592.....................10612100
FJ850061.1 Dengue virus 2 isolate DENV-2/NI/BID-V2346/2000, complete genome 10575.....................10595100
FJ850062.1 Dengue virus 2 isolate DENV-2/NI/BID-V2659/2000, complete genome 10592.....................10612100
FJ850063.1 Dengue virus 2 isolate DENV-2/NI/BID-V2660/2000, complete genome 10593.....................10613100
FJ850064.1 Dengue virus 2 isolate DENV-2/NI/BID-V2663/2000, complete genome 10592.....................10612100
FJ850066.1 Dengue virus 2 isolate DENV-2/NI/BID-V2665/2000, complete genome 10592.....................10612100
FJ850067.1 Dengue virus 2 isolate DENV-2/NI/BID-V2331/2006, complete genome 10592.....................10612100
FJ850095.1 Dengue virus 4 isolate DENV-4/VE/BID-V2176/2000, complete genome 10518.....................10538100
FJ850096.1 Dengue virus 3 isolate DENV-3/VE/BID-V2201/2001, complete genome 10561.....................10581100
FJ850097.1 Dengue virus 3 isolate DENV-3/VE/BID-V2452/2001, complete genome 10576.....................10596100
FJ850098.1 Dengue virus 3 isolate DENV-3/VE/BID-V2455/2001, complete genome 10576.....................10596100
FJ850105.1 Dengue virus 2 isolate DENV-2/VE/BID-V2470/2007, complete genome 10591.....................10611100
FJ850106.1 Dengue virus 2 isolate DENV-2/VE/BID-V2476/2008, complete genome 10591.....................10611100
FJ850107.1 Dengue virus 2 isolate DENV-2/VE/BID-V2477/2008, complete genome 10580.....................10600100
FJ850108.1 Dengue virus 2 isolate DENV-2/VE/BID-V2478/2008, complete genome 10577.....................10597100
FJ850109.1 Dengue virus 3 isolate DENV-3/VE/BID-V2480/2007, complete genome 10576.....................10596100
FJ850110.1 Dengue virus 3 isolate DENV-3/VE/BID-V2482/2007, complete genome 10576.....................10596100
FJ850111.1 Dengue virus 3 isolate DENV-3/VE/BID-V2484/2007, complete genome 10576.....................10596100
FJ850112.1 Dengue virus 2 isolate DENV-2/VE/BID-V2424/2004, complete genome 10613.....................10633100
FJ859028.1 Dengue virus 2 isolate DENV-2/VN/BID-V1796/2007, complete genome 10576.....................10596100
FJ873808.1 Dengue virus 2 isolate DENV-2/NI/BID-V2666/2000, complete genome 10592.....................10612100
FJ873811.1 Dengue virus 2 isolate DENV-2/VN/BID-V922/2006, complete genome 10591.....................10611100
FJ873812.1 Dengue virus 3 isolate DENV-3/NI/BID-V2647/2008, complete genome 10565.....................10585100
FJ873813.1 Dengue virus 3 isolate DENV-3/NI/BID-V2649/2008, complete genome 10550.....................10570100
FJ882571.1 Dengue virus 3 isolate DENV-3/LK/BID-V2411/1989, complete genome 10576.....................10596100
FJ882572.1 Dengue virus 3 isolate DENV-3/LK/BID-V2412/1989, complete genome 10576.....................10596100
FJ882573.1 Dengue virus 3 isolate DENV-3/LK/BID-V2413/1993, complete genome 10576.....................10596100
FJ882574.1 Dengue virus 3 isolate DENV-3/LK/BID-V2414/1985, complete genome 10564.....................10584100
FJ882575.1 Dengue virus 3 isolate DENV-3/MZ/BID-V2418/1985, complete genome 10576.....................10596100
FJ882576.1 Dengue virus 3 isolate DENV-3/NI/BID-V2420/1994, complete genome 10576.....................10596100
FJ882577.1 Dengue virus 3 isolate DENV-3/VE/BID-V2200/2001, complete genome 10577.....................10597100
FJ882578.1 Dengue virus 3 isolate DENV-3/VE/BID-V2202/2001, complete genome 10576.....................10596100
FJ882580.1 Dengue virus 4 isolate DENV-4/VE/BID-V2489/2007, complete genome 10508.....................10528100
FJ882581.1 Dengue virus 4 isolate DENV-4/VE/BID-V2490/2007, complete genome 10518.....................10538100
FJ882582.1 Dengue virus 4 isolate DENV-4/VE/BID-V2491/2007, complete genome 10515.....................10535100
FJ882583.1 Dengue virus 4 isolate DENV-4/VE/BID-V2492/2007, complete genome 10504.....................10524100
FJ882584.1 Dengue virus 4 isolate DENV-4/VE/BID-V2493/2007, complete genome 10507.....................10527100
FJ882585.1 Dengue virus 4 isolate DENV-4/VE/BID-V2494/2007, complete genome 10506.....................10526100
FJ882586.1 Dengue virus 4 isolate DENV-4/VE/BID-V2495/2007, complete genome 10518.....................10538100
FJ882587.1 Dengue virus 4 isolate DENV-4/VE/BID-V2496/2007, complete genome 10504.....................10524100
FJ882588.1 Dengue virus 4 isolate DENV-4/VE/BID-V2497/2007, complete genome 10506.....................10526100
FJ882589.1 Dengue virus 4 isolate DENV-4/VE/BID-V2498/2007, complete genome 10507.....................10527100
FJ882590.1 Dengue virus 4 isolate DENV-4/VE/BID-V2499/2007, complete genome 10506.....................10526100
FJ882591.1 Dengue virus 4 isolate DENV-4/VE/BID-V2500/2007, complete genome 10505.....................10525100
FJ882592.1 Dengue virus 4 isolate DENV-4/VE/BID-V2501/2008, complete genome 10518.....................10538100
FJ882595.1 Dengue virus 4 isolate DENV-4/US/BID-V2441/1998, complete genome 10518.....................10538100
FJ882596.1 Dengue virus 4 isolate DENV-4/US/BID-V2442/1998, complete genome 10518.....................10538100
FJ882597.1 Dengue virus 4 isolate DENV-4/US/BID-V2444/1998, complete genome 10518.....................10538100
FJ882598.1 Dengue virus 4 isolate DENV-4/US/BID-V2445/1998, complete genome 10518.....................10538100
FJ882599.1 Dengue virus 4 isolate DENV-4/US/BID-V2446/1999, complete genome 10507.....................10527100
FJ882600.1 Dengue virus 4 isolate DENV-4/US/BID-V2447/1999, complete genome 10518.....................10538100
FJ882601.1 Dengue virus 4 isolate DENV-4/US/BID-V2448/1999, complete genome 10518.....................10538100
FJ882602.1 Dengue virus 2 isolate DENV-2/LK/BID-V2416/1996, complete genome 10591.....................10611100
FJ898371.1 Dengue virus 1 isolate DENV-1/VN/BID-V2722/2007, complete genome 10587.....................10607100
FJ898376.1 Dengue virus 1 isolate DENV-1/VN/BID-V2728/2007, complete genome 10602.....................10622100
FJ898434.1 Dengue virus 2 isolate DENV-2/NI/BID-V2920/2007, complete genome 10593.....................10613100
FJ898435.1 Dengue virus 2 isolate DENV-2/NI/BID-V648/2005, complete genome 10592.....................10612100
FJ898436.1 Dengue virus 2 isolate DENV-2/NI/BID-V627/2004, complete genome 10592.....................10612100
FJ898438.1 Dengue virus 2 isolate DENV-2/MX/BID-V2953/2002, complete genome 10578.....................10598100
FJ898439.1 Dengue virus 2 isolate DENV-2/MX/BID-V2964/2008, complete genome 10593.....................10613100
FJ898440.1 Dengue virus 3 isolate DENV-3/MX/BID-V2985/2003, complete genome 10576.....................10596100
FJ898441.1 Dengue virus 3 isolate DENV-3/MX/BID-V2987/2006, complete genome 10576.....................10596100
FJ898442.1 Dengue virus 3 isolate DENV-3/MX/BID-V2989/2007, complete genome 10576.....................10596100
FJ898443.1 Dengue virus 3 isolate DENV-3/CO/BID-V2984/2003, complete genome 10576.....................10596100
FJ898444.1 Dengue virus 3 isolate DENV-3/CO/BID-V2986/2005, complete genome 10576.....................10596100
FJ898445.1 Dengue virus 3 isolate DENV-3/CO/BID-V2988/2007, complete genome 10577.....................10597100
FJ898446.1 Dengue virus 3 isolate DENV-3/BR/BID-V2977/2001, complete genome 10576.....................10596100
FJ898447.1 Dengue virus 3 isolate DENV-3/BR/BID-V2983/2003, complete genome 10576.....................10596100
FJ898449.1 Dengue virus 2 isolate DENV-2/HN/BID-V2945/1984, complete genome 10581.....................10601100
FJ898450.1 Dengue virus 2 isolate DENV-2/VI/BID-V2948/1990, complete genome 10591.....................10611100
FJ898451.1 Dengue virus 2 isolate DENV-2/DO/BID-V2955/2003, complete genome 10591.....................10611100
FJ898452.1 Dengue virus 2 isolate DENV-2/TH/BID-V2957/2003, complete genome 10592.....................10612100
FJ898453.1 Dengue virus 2 isolate DENV-2/VI/BID-V2960/2005, complete genome 10591.....................10611100
FJ898454.1 Dengue virus 2 isolate DENV-2/IN/BID-V2961/2006, complete genome 10583.....................10603100
FJ898455.1 Dengue virus 3 isolate DENV-3/CK/BID-V2972/1991, complete genome 10576.....................10596100
FJ898456.1 Dengue virus 3 isolate DENV-3/WS/BID-V2973/1995, complete genome 10576.....................10596100
FJ898457.1 Dengue virus 3 isolate DENV-3/EC/BID-V2975/2000, complete genome 10576.....................10596100
FJ898458.1 Dengue virus 3 isolate DENV-3/PE/BID-V2981/2002, complete genome 10576.....................10596100
FJ898459.1 Dengue virus 3 isolate DENV-3/TT/BID-V2982/2002, complete genome 10576.....................10596100
FJ898460.1 Dengue virus 2 isolate DENV-2/KN/BID-V2951/2001, complete genome 10591.....................10611100
FJ898461.1 Dengue virus 2 isolate DENV-2/BZ/BID-V2952/2002, complete genome 10592.....................10612100
FJ898462.1 Dengue virus 3 isolate DENV-3/AI/BID-V2976/2001, complete genome 10576.....................10596100
FJ898463.1 Dengue virus 3 isolate DENV-3/LC/BID-V2979/2001, complete genome 10576.....................10596100
FJ898464.1 Dengue virus 3 isolate DENV-3/GY/BID-V2980/2002, complete genome 10576.....................10596100
FJ898465.1 Dengue virus 2 isolate DENV-2/VE/BID-V2941/1998, complete genome 10590.....................10610100
FJ898466.1 Dengue virus 2 isolate DENV-2/VE/BID-V2942/2000, complete genome 10592.....................10612100
FJ898467.1 Dengue virus 2 isolate DENV-2/VE/BID-V2944/2005, complete genome 10591.....................10611100
FJ898468.1 Dengue virus 3 isolate DENV-3/VE/BID-V2965/2000, complete genome 10576.....................10596100
FJ898469.1 Dengue virus 3 isolate DENV-3/VE/BID-V2966/2001, complete genome 10576.....................10596100
FJ898470.1 Dengue virus 3 isolate DENV-3/VE/BID-V2967/2001, complete genome 10576.....................10596100
FJ898471.1 Dengue virus 3 isolate DENV-3/VE/BID-V2968/2002, complete genome 10576.....................10596100
FJ898472.1 Dengue virus 3 isolate DENV-3/VE/BID-V2969/2003, complete genome 10577.....................10597100
FJ898473.1 Dengue virus 3 isolate DENV-3/VE/BID-V2970/2003, complete genome 10576.....................10596100
FJ898474.1 Dengue virus 3 isolate DENV-3/VE/BID-V2971/2007, complete genome 10577.....................10597100
FJ906956.1 Dengue virus 2 isolate DENV-2/NI/BID-V543/2005, complete genome 10592.....................10612100
FJ906957.1 Dengue virus 2 isolate DENV-2/TH/BID-V2616/1996, complete genome 10591.....................10611100
FJ906958.1 Dengue virus 2 isolate DENV-2/TH/BID-V2617/1996, complete genome 10592.....................10612100
FJ906959.1 Dengue virus 2 isolate DENV-2/PG/BID-V2618/2008, complete genome 10591.....................10611100
FJ906960.1 Dengue virus 2 isolate DENV-2/NI/BID-V2569/2007, complete genome 10575.....................10595100
FJ906961.1 Dengue virus 2 isolate DENV-2/NI/BID-V2572/2005, complete genome 10592.....................10612100
FJ906962.1 Dengue virus 2 isolate DENV-2/NI/BID-V2573/2005, complete genome 10592.....................10612100
FJ906966.1 Dengue virus 2 isolate DENV-2/Harvard/BID-V2990/2009, complete genome10591.....................10611100
FJ906967.1 Dengue virus 2 isolate DENV-2/Harvard/BID-V2991/2009, complete genome10591.....................10611100
FJ906968.1 Dengue virus 2 isolate DENV-2/Harvard/BID-V2992/2009, complete genome10591.....................10611100
FJ906969.1 Dengue virus 2 isolate DENV-2/Harvard/BID-V2993/2009, complete genome10592.....................10612100
FJ913015.1 Dengue virus 3 isolate DENV-3/BR/BID-V2380/2001, complete genome 10576.....................10596100
FJ898475.1 Dengue virus 3 isolate DENV-3/NI/BID-V2935/2008, complete genome 10565.....................10585100
FJ898476.1 Dengue virus 3 isolate DENV-3/NI/BID-V2934/2008, complete genome 10565.....................10585100
FJ898477.1 Dengue virus 2 isolate DENV-2/NI/BID-V2923/2000, complete genome 10592.....................10612100
FJ898478.1 Dengue virus 2 isolate DENV-2/NI/BID-V2924/2000, complete genome 10593.....................10613100
FJ898479.1 Dengue virus 2 isolate DENV-2/NI/BID-V2922/2007, complete genome 10593.....................10613100
FJ432724.1 Dengue virus 2 isolate DENV-2/VN/BID-V1777/2007, complete genome 10576.....................10596100
FJ882593.1 Dengue virus 2 isolate DENV-2/NI/BID-V1302/2007, complete genome 10593.....................10613100
FJ882594.1 Dengue virus 2 isolate DENV-2/NI/BID-V1313/2007, complete genome 10593.....................10613100
GQ199784.1 Dengue virus 1 isolate DENV-1/VN/BID-V2760/2007, complete genome 10602.....................10622100
GQ199790.1 Dengue virus 1 isolate DENV-1/VN/BID-V2766/2007, complete genome 10602.....................10622100
GQ199805.1 Dengue virus 1 isolate DENV-1/VN/BID-V2785/2007, complete genome 10602.....................10622100
GQ199860.1 Dengue virus 3 isolate DENV-3/NI/BID-V3055/2008, complete genome 10565.....................10585100
GQ199861.1 Dengue virus 3 isolate DENV-3/NI/BID-V3057/2008, complete genome 10565.....................10585100
GQ199862.1 Dengue virus 3 isolate DENV-3/NI/BID-V3059/2008, complete genome 10565.....................10585100
GQ199863.1 Dengue virus 3 isolate DENV-3/NI/BID-V3066/2008, complete genome 10565.....................10585100
GQ199864.1 Dengue virus 3 isolate DENV-3/NI/BID-V3068/2008, complete genome 10565.....................10585100
GQ199865.1 Dengue virus 3 isolate DENV-3/NI/BID-V3069/2009, complete genome 10565.....................10585100
GQ199866.1 Dengue virus 2 isolate DENV-2/NI/BID-V2427/2007, complete genome 10583.....................10603100
GQ199868.1 Dengue virus 2 isolate DENV-2/NI/BID-V2996/2007, complete genome 10593.....................10613100
GQ199869.1 Dengue virus 2 isolate DENV-2/NI/BID-V3002/2007, complete genome 10593.....................10613100
GQ199870.1 Dengue virus 3 isolate DENV-3/NI/BID-V3072/2008, complete genome 10565.....................10585100
GQ199871.1 Dengue virus 3 isolate DENV-3/NI/BID-V3073/2008, complete genome 10550.....................10570100
GQ199874.1 Dengue virus 2 isolate DENV-2/NI/BID-V668/2004, complete genome 10580.....................10600100
GQ199876.1 Dengue virus 4 isolate DENV-4/VE/BID-V2610/2007, complete genome 10507.....................10527100
GQ199878.1 Dengue virus 4 isolate DENV-4/US/BID-V2429/1994, complete genome 10504.....................10524100
GQ199879.1 Dengue virus 4 isolate DENV-4/US/BID-V2430/1994, complete genome 10505.....................10525100
GQ199880.1 Dengue virus 4 isolate DENV-4/US/BID-V2431/1995, complete genome 10502.....................10522100
GQ199881.1 Dengue virus 4 isolate DENV-4/US/BID-V2435/1996, complete genome 10502.....................10522100
GQ199882.1 Dengue virus 4 isolate DENV-4/US/BID-V2436/1996, complete genome 10504.....................10524100
GQ199883.1 Dengue virus 4 isolate DENV-4/US/BID-V2437/1996, complete genome 10518.....................10538100
GQ199884.1 Dengue virus 4 isolate DENV-4/US/BID-V2438/1996, complete genome 10518.....................10538100
GQ199885.1 Dengue virus 4 isolate DENV-4/US/BID-V2439/1996, complete genome 10502.....................10522100
GQ199899.1 Dengue virus 2 isolate DENV-2/UMASS-Medical/BID-V2619/2008, complete 10483.....................10503100
GQ199900.1 Dengue virus 2 isolate DENV-2/UMASS-Medical/BID-V2620/2008, complete 10483.....................10503100
GQ199901.1 Dengue virus 2 isolate DENV-2/UMASS-Medical/BID-V2621/2008, complete 10483.....................10503100
GQ199895.1 Dengue virus 2 isolate DENV-2/NI/BID-V2683/1999, complete genome 10592.....................10612100
GQ199896.1 Dengue virus 2 isolate DENV-2/NI/BID-V2680/2006, complete genome 10593.....................10613100
GQ199897.1 Dengue virus 2 isolate DENV-2/NI/BID-V2675/2002, complete genome 10581.....................10601100
GQ199898.1 Dengue virus 2 isolate DENV-2/NI/BID-V3076/2001, complete genome 10592.....................10612100
GQ199886.1 Dengue virus 3 isolate DENV-3/NI/BID-V2419/1998, complete genome 10576.....................10596100
GQ199887.1 Dengue virus 3 isolate DENV-3/LK/BID-V2405/1983, complete genome 10576.....................10596100
GQ199888.1 Dengue virus 3 isolate DENV-3/LK/BID-V2407/1983, complete genome 10576.....................10596100
GQ199889.1 Dengue virus 3 isolate DENV-3/LK/BID-V2410/1983, complete genome 10576.....................10596100
GQ199890.1 Dengue virus 2 isolate DENV-2/BR/BID-V2402/2008, complete genome 10592.....................10612100
GQ199891.1 Dengue virus 3 isolate DENV-3/CO/BID-V2978/2001, complete genome 10576.....................10596100
GQ199892.1 Dengue virus 2 isolate DENV-2/JM/BID-V2963/2007, complete genome 10591.....................10611100
GQ199893.1 Dengue virus 2 isolate DENV-2/MX/BID-V2954/2002, complete genome 10592.....................10612100
GQ199894.1 Dengue virus 2 isolate DENV-2/MX/BID-V2959/2005, complete genome 10582.....................10602100
GQ252674.1 Dengue virus 3 isolate DENV-3/LK/BID-V2409/1997, complete genome 10576.....................10596100
GQ252675.1 Dengue virus 4 isolate DENV-4/US/BID-V2432/1995, complete genome 10503.....................10523100
GQ252676.1 Dengue virus 2 isolate DENV-2/LK/BID-V2421/2003, complete genome 10581.....................10601100
GQ252677.1 Dengue virus 2 isolate DENV-2/LK/BID-V2422/2004, complete genome 10580.....................10600100
GQ252678.1 Dengue virus 3 isolate DENV-3/VE/BID-V2454/2001, complete genome 10576.....................10596100
AB479041.1 Dengue virus 2 genomic RNA, nearly complete genome, isolate: VNHCM18-10595.....................10615100
AB479042.1 Dengue virus 2 genomic RNA, nearly complete genome, isolate: VNHCM18-10595.....................10615100
FN429891.1 Dengue virus type 2, isolate D2MY97-10340, genomic RNA, complete geno10613.....................10633100
FN429892.1 Dengue virus type 2, isolate D2MY00-22563, genomic RNA, complete geno10613.....................10633100
FN429893.1 Dengue virus type 2, isolate D2MY04-32618, genomic RNA, complete geno10613.....................10633100
FN429894.1 Dengue virus type 2, isolate D2MY04-32883, genomic RNA, complete geno10613.....................10633100
FN429895.1 Dengue virus type 2, isolate D2MY04-33054, genomic RNA, complete geno10613.....................10633100
FN429896.1 Dengue virus type 3, isolate D3MY95-2471, genomic RNA, complete genom10597.....................10617100
FN429897.1 Dengue virus type 3, isolate D3MY95-3952, genomic RNA, complete genom10597.....................10617100
FN429898.1 Dengue virus type 3, isolate D3MY96-4269, genomic RNA, complete genom10597.....................10617100
FN429899.1 Dengue virus type 3, isolate D3MY97-12440, genomic RNA, complete geno10598.....................10618100
FN429900.1 Dengue virus type 3, isolate D3MY99-21531, genomic RNA, complete geno10597.....................10617100
FN429901.1 Dengue virus type 3, isolate D3MY00-22447, genomic RNA, complete geno10597.....................10617100
FN429902.1 Dengue virus type 3, isolate D3MY00-22460, genomic RNA, complete geno10597.....................10617100
FN429903.1 Dengue virus type 3, isolate D3MY00-22550, genomic RNA, complete geno10597.....................10617100
FN429904.1 Dengue virus type 3, isolate D3MY00-22583, genomic RNA, complete geno10597.....................10617100
FN429905.1 Dengue virus type 3, isolate D3MY00-22366, genomic RNA, complete geno10597.....................10617100
FN429906.1 Dengue virus type 3, isolate D3MY01-22939, genomic RNA, complete geno10597.....................10617100
FN429907.1 Dengue virus type 3, isolate D3MY01-24056, genomic RNA, complete geno10597.....................10617100
FN429908.1 Dengue virus type 3, isolate D3MY02-25811, genomic RNA, complete geno10597.....................10617100
FN429909.1 Dengue virus type 3, isolate D3MY02-25850, genomic RNA, complete geno10597.....................10617100
FN429910.1 Dengue virus type 3, isolate D3MY03-27834, genomic RNA, complete geno10597.....................10617100
FN429911.1 Dengue virus type 3, isolate D3MY03-28526, genomic RNA, complete geno10597.....................10617100
FN429912.1 Dengue virus type 3, isolate D3MY04-32645, genomic RNA, complete geno10597.....................10617100
FN429913.1 Dengue virus type 3, isolate D3MY04-33077, genomic RNA, complete geno10597.....................10617100
FN429914.1 Dengue virus type 3, isolate D3MY05-33464, genomic RNA, complete geno10596.....................10616100
FN429915.1 Dengue virus type 3, isolate D3MY05-33506, genomic RNA, complete geno10597.....................10617100
FN429916.1 Dengue virus type 3, isolate D3MY05-33610, genomic RNA, complete geno10596.....................10616100
FN429917.1 Dengue virus type 3, isolate D3MY05-33927, genomic RNA, complete geno10596.....................10616100
FN429918.1 Dengue virus type 3, isolate D3MY05-34640, genomic RNA, complete geno10596.....................10616100
FN429919.1 Dengue virus type 4, isolate D4MY95-328, genomic RNA, complete genome10539.....................10559100
FN429920.1 Dengue virus type 4, isolate D4MY01-22713, genomic RNA, complete geno10542.....................10562100
FN429921.1 Dengue virus type 4, isolate D4MY01-23476, genomic RNA, complete geno10543.....................10563100
FN429922.1 Dengue virus type 4, isolate D4MY02-26658, genomic RNA, complete geno10543.....................10563100
FN429923.1 Dengue virus type 4, isolate D4MY03-27498, genomic RNA, complete geno10543.....................10563100
FN429924.1 Dengue virus type 4, isolate D4MY03-27949, genomic RNA, complete geno10543.....................10563100
FN429925.1 Dengue virus type 4, isolate D4MY04-31586, genomic RNA, complete geno10543.....................10563100
FN429926.1 Dengue virus type 4, isolate D4MY04-32729, genomic RNA, complete geno10543.....................10563100
FJ644564.1 Dengue virus 3 isolate ND143 from India, complete genome 10597.....................10617100
EU932687.1 Dengue virus 3 isolate DENV-3/VE/BID-V1149/2007, complete genome 10585.....................10605100
EU932688.1 Dengue virus 3 isolate DENV-3/VE/BID-V1150/2007, complete genome 10561.....................10581100
GQ868540.1 Dengue virus 2 isolate DENV-2/VE/BID-V3496/1990, complete genome 10591.....................10611100
GQ868541.1 Dengue virus 2 isolate DENV-2/VE/BID-V3497/1991, complete genome 10591.....................10611100
GQ868543.1 Dengue virus 2 isolate DENV-2/TH/BID-V3501/1995, complete genome 10591.....................10611100
GQ868544.1 Dengue virus 2 isolate DENV-2/TH/BID-V3499/1996, complete genome 10594.....................10614100
GQ868545.1 Dengue virus 2 isolate DENV-2/TH/BID-V3500/1996, complete genome 10592.....................10612100
GQ868546.1 Dengue virus 3 isolate DENV-3/BR/BID-V3431/2006, complete genome 10576.....................10596100
GQ868547.1 Dengue virus 3 isolate DENV-3/BR/BID-V3444/2006, complete genome 10568.....................10588100
GQ868548.1 Dengue virus 3 isolate DENV-3/BR/BID-V3463/2006, complete genome 10576.....................10596100
GQ868549.1 Dengue virus 2 isolate DENV-2/BR/BID-V3481/2008, complete genome 10591.....................10611100
GQ868550.1 Dengue virus 2 isolate DENV-2/BR/BID-V3483/2008, complete genome 10591.....................10611100
GQ868586.1 Dengue virus 3 isolate DENV-3/VE/BID-V2481/2007, complete genome 10576.....................10596100
GQ868587.1 Dengue virus 3 isolate DENV-3/VE/BID-V2483/2007, complete genome 10576.....................10596100
GQ868588.1 Dengue virus 2 isolate DENV-2/MX/BID-V3354/1983, complete genome 10581.....................10601100
GQ868589.1 Dengue virus 2 isolate DENV-2/MX/BID-V3355/1983, complete genome 10581.....................10601100
GQ868590.1 Dengue virus 2 isolate DENV-2/MX/BID-V3356/1992, complete genome 10581.....................10601100
GQ868591.1 Dengue virus 2 isolate DENV-2/TH/BID-V3357/1964, complete genome 10591.....................10611100
GQ868592.1 Dengue virus 2 isolate DENV-2/CO/BID-V3358/1986, complete genome 10582.....................10602100
GQ868593.1 Dengue virus 3 isolate DENV-3/TH/BID-V3360/1973, complete genome 10576.....................10596100
GQ868594.1 Dengue virus 4 isolate DENV-4/PH/BID-V3361/1956, complete genome 10519.....................10539100
GQ868595.1 Dengue virus 2 isolate DENV-2/VE/BID-V3362/1991, complete genome 10591.....................10611100
GQ868596.1 Dengue virus 2 isolate DENV-2/VE/BID-V3363/1991, complete genome 10580.....................10600100
GQ868597.1 Dengue virus 2 isolate DENV-2/VE/BID-V3364/1991, complete genome 10591.....................10611100
GQ868598.1 Dengue virus 2 isolate DENV-2/VE/BID-V3365/1991, complete genome 10591.....................10611100
GQ868599.1 Dengue virus 2 isolate DENV-2/VE/BID-V3366/1987, complete genome 10581.....................10601100
GQ868600.1 Dengue virus 2 isolate DENV-2/PR/BID-V3367/1969, complete genome 10581.....................10601100
GQ868603.1 Dengue virus 2 isolate DENV-2/VI/BID-V2946/1987, complete genome 10590.....................10610100
GQ868604.1 Dengue virus 2 isolate DENV-2/NI/BID-V518/2005, complete genome 10593.....................10613100
GQ868620.1 Dengue virus 2 isolate DENV-2/KH/BID-V2028/2003, complete genome 10577.....................10597100
GQ868621.1 Dengue virus 2 isolate DENV-2/KH/BID-V2034/2003, complete genome 10591.....................10611100
GQ868622.1 Dengue virus 2 isolate DENV-2/KH/BID-V2037/2003, complete genome 10592.....................10612100
GQ868623.1 Dengue virus 2 isolate DENV-2/KH/BID-V2047/2005, complete genome 10592.....................10612100
GQ868624.1 Dengue virus 2 isolate DENV-2/KH/BID-V2062/2007, complete genome 10592.....................10612100
GQ868625.1 Dengue virus 2 isolate DENV-2/KH/BID-V2069/2008, complete genome 10588.....................10608100
GQ868626.1 Dengue virus 3 isolate DENV-3/KH/BID-V2075/2001, complete genome 10576.....................10596100
GQ868627.1 Dengue virus 3 isolate DENV-3/KH/BID-V2077/2002, complete genome 10576.....................10596100
GQ868628.1 Dengue virus 3 isolate DENV-3/KH/BID-V2085/2005, complete genome 10572.....................10592100
GQ868629.1 Dengue virus 3 isolate DENV-3/KH/BID-V2087/2005, complete genome 10573.....................10593100
GQ868631.1 Dengue virus 2 isolate DENV-2/IPC/BID-V3791/2008, complete genome 10591.....................10611100
GQ868634.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3819/2006, complete genome 10576.....................10596100
GQ868638.1 Dengue virus 2 isolate DENV-2/IPC/BID-V3924/2008, complete genome 10582.....................10602100
GQ868640.1 Dengue virus 2 isolate DENV-2/BR/BID-V2385/2003, complete genome 10580.....................10600100
GQ868641.1 Dengue virus 2 isolate DENV-2/VE/BID-V1144/2007, complete genome 10591.....................10611100
GQ868642.1 Dengue virus 4 isolate DENV-4/VE/BID-V1153/2007, complete genome 10507.....................10527100
GQ868643.1 Dengue virus 4 isolate DENV-4/VE/BID-V1154/2007, complete genome 10505.....................10525100
GQ868644.1 Dengue virus 4 isolate DENV-4/VE/BID-V1155/2007, complete genome 10549.....................10569100
GQ868645.1 Dengue virus 4 isolate DENV-4/VE/BID-V1156/2007, complete genome 10518.....................10538100
GQ868646.1 Dengue virus 2 isolate DENV-2/NI/BID-V2428/2007, complete genome 10593.....................10613100
GQ868616.1 Dengue virus 3 isolate DENV-3/LC/BID-V3929/2001, complete genome 10576.....................10596100
GQ868497.1 Dengue virus 2 isolate DENV-2/MX/BID-V3654/2006, complete genome 10577.....................10597100
GQ868515.1 Dengue virus 2 isolate DENV-2/MX/BID-V3713/2007, complete genome 10585.....................10605100
GQ868516.1 Dengue virus 2 isolate DENV-2/MX/BID-V3714/2007, complete genome 10586.....................10606100
GQ868553.1 Dengue virus 2 isolate DENV-2/CO/BID-V3369/1999, complete genome 10577.....................10597100
GQ868554.1 Dengue virus 2 isolate DENV-2/CO/BID-V3370/2004, complete genome 10592.....................10612100
GQ868555.1 Dengue virus 2 isolate DENV-2/CO/BID-V3371/2005, complete genome 10581.....................10601100
GQ868556.1 Dengue virus 2 isolate DENV-2/CO/BID-V3372/2005, complete genome 10592.....................10612100
GQ868557.1 Dengue virus 2 isolate DENV-2/CO/BID-V3373/2005, complete genome 10581.....................10601100
GQ868558.1 Dengue virus 2 isolate DENV-2/CO/BID-V3375/2007, complete genome 10592.....................10612100
GQ868571.1 Dengue virus 3 isolate DENV-3/CO/BID-V3393/2002, complete genome 10576.....................10596100
GQ868572.1 Dengue virus 3 isolate DENV-3/CO/BID-V3395/2003, complete genome 10576.....................10596100
GQ868573.1 Dengue virus 3 isolate DENV-3/CO/BID-V3397/2003, complete genome 10576.....................10596100
GQ868574.1 Dengue virus 3 isolate DENV-3/CO/BID-V3398/2003, complete genome 10576.....................10596100
GQ868575.1 Dengue virus 3 isolate DENV-3/CO/BID-V3400/2004, complete genome 10576.....................10596100
GQ868576.1 Dengue virus 3 isolate DENV-3/CO/BID-V3402/2005, complete genome 10576.....................10596100
GQ868577.1 Dengue virus 3 isolate DENV-3/CO/BID-V3403/2005, complete genome 10576.....................10596100
GQ868578.1 Dengue virus 3 isolate DENV-3/CO/BID-V3405/2007, complete genome 10576.....................10596100
GQ868579.1 Dengue virus 4 isolate DENV-4/CO/BID-V3406/2001, complete genome 10505.....................10525100
GQ868580.1 Dengue virus 4 isolate DENV-4/CO/BID-V3407/2001, complete genome 10510.....................10530100
GQ868581.1 Dengue virus 4 isolate DENV-4/CO/BID-V3408/2001, complete genome 10504.....................10524100
GQ868582.1 Dengue virus 4 isolate DENV-4/CO/BID-V3409/2001, complete genome 10518.....................10538100
GQ868583.1 Dengue virus 4 isolate DENV-4/CO/BID-V3410/2004, complete genome 10503.....................10523100
GQ868584.1 Dengue virus 4 isolate DENV-4/CO/BID-V3411/2004, complete genome 10504.....................10524100
GQ868585.1 Dengue virus 4 isolate DENV-4/CO/BID-V3412/2005, complete genome 10518.....................10538100
GQ868552.1 Dengue virus 2 isolate DENV-2/CO/BID-V3368/1998, complete genome 10576.....................10596100
GU131843.1 Dengue virus 2 isolate DENV-2/BF/BID-V3502/1986, complete genome 10570.....................10590100
GU131846.1 Dengue virus 3 isolate DENV-3/BR/BID-V3424/2006, complete genome 10576.....................10596100
GU131855.1 Dengue virus 3 isolate DENV-3/BR/BID-V3451/2006, complete genome 10576.....................10596100
GU131856.1 Dengue virus 3 isolate DENV-3/BR/BID-V3456/2006, complete genome 10576.....................10596100
GU131857.1 Dengue virus 3 isolate DENV-3/BR/BID-V3457/2006, complete genome 10576.....................10596100
GU131872.1 Dengue virus 3 isolate DENV-3/BR/BID-V3597/2007, complete genome 10568.....................10588100
GU131877.1 Dengue virus 3 isolate DENV-3/BR/BID-V3609/2007, complete genome 10576.....................10596100
GU131878.1 Dengue virus 3 isolate DENV-3/BR/BID-V3615/2007, complete genome 10576.....................10596100
GU131879.1 Dengue virus 2 isolate DENV-2/BR/BID-V3638/2008, complete genome 10591.....................10611100
GU131882.1 Dengue virus 2 isolate DENV-2/BR/BID-V3645/2008, complete genome 10589.....................10609100
GU131883.1 Dengue virus 2 isolate DENV-2/BR/BID-V3648/2008, complete genome 10591.....................10611100
GU131884.1 Dengue virus 2 isolate DENV-2/BR/BID-V3650/2008, complete genome 10578.....................10598100
GU131885.1 Dengue virus 2 isolate DENV-2/BR/BID-V3653/2008, complete genome 10591.....................10611100
GU131886.1 Dengue virus 2 isolate DENV-2/TH/BID-V4325/2001, complete genome 10591.....................10611100
GU131898.1 Dengue virus 2 isolate DENV-2/IPC/BID-V3795/2008, complete genome 10557.....................10577100
GU131899.1 Dengue virus 2 isolate DENV-2/IPC/BID-V3796/2008, complete genome 10559.....................10579100
GU131900.1 Dengue virus 2 isolate DENV-2/IPC/BID-V3797/2008, complete genome 10571.....................10591100
GU131901.1 Dengue virus 2 isolate DENV-2/IPC/BID-V3798/2008, complete genome 10543.....................10563100
GU131902.1 Dengue virus 2 isolate DENV-2/IPC/BID-V3799/2008, complete genome 10592.....................10612100
GU131904.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3807/2005, complete genome 10576.....................10596100
GU131905.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3808/2008, complete genome 10576.....................10596100
GU131906.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3809/2003, complete genome 10576.....................10596100
GU131910.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3824/2006, complete genome 10561.....................10581100
GU131913.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3827/2007, complete genome 10581.....................10601100
GU131916.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3831/2007, complete genome 10576.....................10596100
GU131917.1 Dengue virus 3 isolate DENV-3/IPC/BID-V3832/2007, complete genome 10576.....................10596100
GU131934.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4282/2007, complete genome 10576.....................10596100
GU131935.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4283/2007, complete genome 10576.....................10596100
GU131936.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4284/2007, complete genome 10576.....................10596100
GU131937.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4286/2007, complete genome 10575.....................10595100
GU131938.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4290/2007, complete genome 10576.....................10596100
GU131939.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4294/2007, complete genome 10577.....................10597100
GU131940.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4297/2007, complete genome 10576.....................10596100
GU131942.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4300/2007, complete genome 10571.....................10591100
GU131943.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4302/2007, complete genome 10576.....................10596100
GU131944.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4306/2007, complete genome 10576.....................10596100
GU289913.1 Dengue virus 4 strain 341750, complete genome 10539.....................10559100
GU289914.1 Dengue virus 2 strain S16803, complete genome 10613.....................10633100
GU131950.1 Dengue virus 3 isolate DENV-3/CO/BID-V3392/2001, complete genome 10576.....................10596100
GU131951.1 Dengue virus 3 isolate DENV-3/CO/BID-V3394/2003, complete genome 10576.....................10596100
GU131952.1 Dengue virus 3 isolate DENV-3/CO/BID-V3399/2003, complete genome 10576.....................10596100
GU131974.1 Dengue virus 2 isolate DENV-2/MX/BID-V3715/2007, complete genome 10591.....................10611100
GU131975.1 Dengue virus 2 isolate DENV-2/MX/BID-V3717/2007, complete genome 10581.....................10601100
GU363549.1 Dengue virus 3 isolate GZ1D3, complete genome 10597.....................10617100
AB543624.1 Dengue virus 2 genomic RNA, complete genome, clone: R05-624 10613.....................10633100
HM631865.1 Dengue virus 2 isolate DENV-2/NI/BID-V4156/2007, complete genome 10593.....................10613100
HM631866.1 Dengue virus 2 isolate DENV-2/NI/BID-V4157/2006, complete genome 10593.....................10613100
HM631867.1 Dengue virus 2 isolate DENV-2/NI/BID-V4158/2006, complete genome 10593.....................10613100
HM631868.1 Dengue virus 2 isolate DENV-2/NI/BID-V4159/2005, complete genome 10592.....................10612100
HM488257.1 Dengue virus 2 isolate DENV-2/GU/BID-V2950/2001, complete genome 10591.....................10611100
HM631854.1 Dengue virus 3 isolate DENV-3/KH/BID-V4315/2008, complete genome 10579.....................10599100
GQ466079.1 Dengue virus 3 isolate DEL-72, complete genome 10597.....................10617100
HQ541786.1 Dengue virus 2 isolate DENV-2/NI/BID-V2596/2006, complete genome 10618.....................10638100
HQ541789.1 Dengue virus 3 isolate DENV-3/NI/BID-V3163/2008, complete genome 10570.....................10590100
HQ541790.1 Dengue virus 3 isolate DENV-3/NI/BID-V3169/2008, complete genome 10584.....................10604100
HQ541791.1 Dengue virus 3 isolate DENV-3/NI/BID-V3175/2008, complete genome 10580.....................10600100
HQ671176.1 Dengue virus 3 isolate DENV-3/NI/BID-V4856/2009, complete genome 10571.....................10591100
HQ671177.1 Dengue virus 3 isolate DENV-3/NI/BID-V4830/2009, complete genome 10571.....................10591100
HQ705609.1 Dengue virus 3 isolate DENV-3/NI/BID-V4859/2009, complete genome 10571.....................10591100
HQ705610.1 Dengue virus 3 isolate DENV-3/NI/BID-V4860/2009, complete genome 10571.....................10591100
HQ705611.1 Dengue virus 3 isolate DENV-3/NI/BID-V4861/2009, complete genome 10575.....................10595100
HQ705612.1 Dengue virus 3 isolate DENV-3/NI/BID-V4862/2009, complete genome 10571.....................10591100
HQ705613.1 Dengue virus 3 isolate DENV-3/NI/BID-V4866/2009, complete genome 10571.....................10591100
HQ705614.1 Dengue virus 3 isolate DENV-3/NI/BID-V4867/2009, complete genome 10571.....................10591100
HQ705616.1 Dengue virus 3 isolate DENV-3/NI/BID-V4872/2009, complete genome 10572.....................10592100
HQ705617.1 Dengue virus 3 isolate DENV-3/NI/BID-V4831/2009, complete genome 10572.....................10592100
HQ705618.1 Dengue virus 3 isolate DENV-3/NI/BID-V4836/2009, complete genome 10570.....................10590100
HQ705619.1 Dengue virus 3 isolate DENV-3/NI/BID-V4838/2009, complete genome 10572.....................10592100
HQ705620.1 Dengue virus 3 isolate DENV-3/NI/BID-V4845/2009, complete genome 10571.....................10591100
HQ705621.1 Dengue virus 3 isolate DENV-3/NI/BID-V4848/2009, complete genome 10571.....................10591100
HQ705622.1 Dengue virus 3 isolate DENV-3/NI/BID-V4849/2009, complete genome 10571.....................10591100
HQ705623.1 Dengue virus 3 isolate DENV-3/NI/BID-V4850/2009, complete genome 10571.....................10591100
HQ733861.1 Dengue virus 2 isolate DENV-2/NI/BID-V2599/2006, complete genome 10622.....................10642100
JF357905.1 Dengue virus 2 isolate DENV-2/NI/BID-V2605/2007, complete genome 10601.....................10621100
JF920393.1 Dengue virus 3 isolate DENV-3/NI/BID-V5442/2009, complete genome 10571.....................10591100
JF920394.1 Dengue virus 3 isolate DENV-3/NI/BID-V5452/2009, complete genome 10572.....................10592100
JF920396.1 Dengue virus 3 isolate DENV-3/NI/BID-V5461/2009, complete genome 10565.....................10585100
JF920397.1 Dengue virus 3 isolate DENV-3/NI/BID-V5478/2010, complete genome 10567.....................10587100
JF920399.1 Dengue virus 3 isolate DENV-3/NI/BID-V5097/2009, complete genome 10571.....................10591100
JF920400.1 Dengue virus 3 isolate DENV-3/NI/BID-V5099/2009, complete genome 10571.....................10591100
JF920401.1 Dengue virus 3 isolate DENV-3/NI/BID-V5482/2010, complete genome 10571.....................10591100
JF920404.1 Dengue virus 3 isolate DENV-3/NI/BID-V5449/2009, complete genome 10571.....................10591100
JF920405.1 Dengue virus 3 isolate DENV-3/NI/BID-V5467/2010, complete genome 10571.....................10591100
JF920406.1 Dengue virus 3 isolate DENV-3/NI/BID-V5468/2010, complete genome 10571.....................10591100
JF920407.1 Dengue virus 3 isolate DENV-3/NI/BID-V5101/2009, complete genome 10570.....................10590100
JF920408.1 Dengue virus 3 isolate DENV-3/NI/BID-V5474/2010, complete genome 10571.....................10591100
JF920409.1 Dengue virus 3 isolate DENV-3/NI/BID-V5471/2010, complete genome 10570.....................10590100
JF937620.1 Dengue virus 3 isolate DENV-3/NI/BID-V5477/2010, complete genome 10571.....................10591100
JF937621.1 Dengue virus 3 isolate DENV-3/NI/BID-V5511/2010, complete genome 10570.....................10590100
JF937622.1 Dengue virus 3 isolate DENV-3/NI/BID-V5512/2010, complete genome 10570.....................10590100
JF937623.1 Dengue virus 3 isolate DENV-3/NI/BID-V5514/2010, complete genome 10570.....................10590100
JF937624.1 Dengue virus 3 isolate DENV-3/NI/BID-V5489/2010, complete genome 10570.....................10590100
JF937625.1 Dengue virus 3 isolate DENV-3/NI/BID-V5496/2010, complete genome 10570.....................10590100
JF937628.1 Dengue virus 3 isolate DENV-3/NI/BID-V5686/2010, complete genome 10574.....................10594100
JF937629.1 Dengue virus 3 isolate DENV-3/NI/BID-V5486/2010, complete genome 10571.....................10591100
JF937633.1 Dengue virus 3 isolate DENV-3/NI/BID-V5498/2010, complete genome 10569.....................10589100
JF937634.1 Dengue virus 3 isolate DENV-3/NI/BID-V5499/2010, complete genome 10571.....................10591100
JF937636.1 Dengue virus 3 isolate DENV-3/NI/BID-V5506/2009, complete genome 10573.....................10593100
JF937637.1 Dengue virus 3 isolate DENV-3/NI/BID-V5516/2010, complete genome 10579.....................10599100
JF937638.1 Dengue virus 3 isolate DENV-3/NI/BID-V5517/2010, complete genome 10571.....................10591100
JF937639.1 Dengue virus 3 isolate DENV-3/NI/BID-V5680/2010, complete genome 10534.....................10554100
JF937640.1 Dengue virus 3 isolate DENV-3/NI/BID-V5681/2010, complete genome 10571.....................10591100
JF937641.1 Dengue virus 3 isolate DENV-3/NI/BID-V5455/2009, complete genome 10571.....................10591100
JF937642.1 Dengue virus 3 isolate DENV-3/NI/BID-V5464/2009, complete genome 10571.....................10591100
JF937646.1 Dengue virus 3 isolate DENV-3/NI/BID-V5494/2010, complete genome 10571.....................10591100
JF937647.1 Dengue virus 3 isolate DENV-3/NI/BID-V5495/2009, complete genome 10570.....................10590100
JF937648.1 Dengue virus 3 isolate DENV-3/NI/BID-V5507/2010, complete genome 10570.....................10590100
JN000938.1 Dengue virus 3 isolate DENV-3/NI/BID-V5491/2010, complete genome 10571.....................10591100
HQ235027.1 Dengue virus 3 isolate PAR DENV3 5532-07, complete genome 10597.....................10617100
JF504679.1 Dengue virus 3 isolate ZJYW2009, complete genome 10597.....................10617100
JN093513.1 Dengue virus 3 isolate DENV-3/NI/BID-V5488/2010, complete genome 10570.....................10590100
JN093515.1 Dengue virus 3 isolate DENV-3/NI/BID-V5492/2010, complete genome 10569.....................10589100
JF327392.1 Dengue virus 2 strain DENV-2/SG/D2Y98P-PP1/2009, complete genome 10613.....................10633100
NC_002640.1 Dengue virus type 4, complete genome 10539.....................10559100
NC_001475.2 Dengue virus type 3, complete genome 10597.....................10617100
NC_001474.2 Dengue virus type 2, complete genome 10613.....................10633100
AF022434.1 Dengue virus type 2 strain ThNH-7/93, complete genome 10615_....................1063495
M14931.2DENSTRA Dengue virus type 4 polyprotein precursor, gene, complete cds 10539_....................1055895
AY662691.1 Dengue virus type 3 from Singapore, complete genome 10598_....................1061795
AY858043.2 Dengue virus 3 strain KJ46, complete genome 10597_....................1061695
EU482607.1 Dengue virus 2 isolate DENV-2/VE/BID-V1107/2007, complete genome 10593_....................1061295
FJ024477.1 Dengue virus 2 isolate DENV-2/CO/BID-V1603/2004, complete genome 10593_....................1061295
FM210220.1 Dengue virus 2 isolate DF674, complete genome 10597...................._1061695
FM210246.2 Dengue virus 2 isolate MD1618, complete genome 10595...................._1061495
FJ205877.1 Dengue virus 2 isolate DENV-2/VN/BID-V1674/2007, complete genome 10591_....................1061095
FJ639783.1 Dengue virus 2 isolate DENV-2/VE/BID-V2216/2003, complete genome 10593_....................1061295
FJ639788.1 Dengue virus 2 isolate DENV-2/VE/BID-V2221/2004, complete genome 10593_....................1061295
FJ639822.1 Dengue virus 2 isolate DENV-2/VE/BID-V2262/2006, complete genome 10593_....................1061295
FJ461334.1 Dengue virus 3 isolate DENV-3/VN/BID-V1936/2008, complete genome 10552_....................1057195
FJ639713.1 Dengue virus 3 isolate DENV-3/KH/BID-V2051/2007, complete genome 10562_....................1058195
JF920395.1 Dengue virus 3 isolate DENV-3/NI/BID-V5457/2009, complete genome 10571_....................1059095
JF920402.1 Dengue virus 3 isolate DENV-3/NI/BID-V5441/2009, complete genome 10571_....................1059095
M87512.1DENT1SEQ Dengue virus type 1 complete genome 10607.t...................1062795
U88535.1DVU88535 Dengue virus type 1 clone WestPac, complete genome 10625.c...................1064595
U88537.1DVU88537 Dengue virus type 1 clone 45AZ5-PDK27, complete genome 10625.c...................1064595
AF022440.1 Dengue virus type 2 strain ThNH-p16/93, complete genome 10613..................a..1063395
AF119661.1 Dengue virus type 2 China isolate 04, complete genome 10613...........t.........1063395
A75711.1 Sequence 1 from Patent WO9322440 10608.t...................1062895
AF180817.1 Dengue virus type 1 strain 16007 polyprotein precursor, mRNA, complet10625.t...................1064595
AF180818.1 Dengue virus type 1 strain 16007 (PDK-13) polyprotein precursor, mRNA10625.t...................1064595
AF226686.1 Dengue virus type 1 strain FGA/NA d1d, complete genome 10625.c...................1064595
AF350498.1 Dengue virus type 1 strain GZ/80 polyprotein precursor, gene, complet10625.t...................1064595
AF226687.2 Dengue virus type 1 strain FGA/89, complete genome 10625.c...................1064595
AF298807.1 Dengue virus type 1 Abidjan strain polyprotein gene, complete cds 10611.c...................1063195
AF298808.1 Dengue virus type 1 Djibouti strain D1/H/IMTSSA/98/606 polyprotein ge10611.t...................1063195
AF309641.1 Dengue virus type 1 from Cambodia, complete genome 10611.t...................1063195
AB074760.1 Dengue virus type 1 genomic RNA, complete genome, strain:Mochizuki 10625.t...................1064595
AB074761.1 Dengue virus type 1 genomic RNA, complete genome, strain:A88 10625.t...................1064595
AY145121.1 Dengue virus type 1 recombinant clone rDEN1, complete genome 10625.c...................1064595
AY145122.1 Dengue virus type 1 recombinant clone rDEN1mutF, complete genome 10625.c...................1064595
AY145123.1 Dengue virus type 1 recombinant clone rDEN1delta30, complete genome 10595.c...................1061595
AF311956.1 Dengue virus type 1 strain BR/97-111, complete genome 10625.c...................1064595
AF311957.1 Dengue virus type 1 strain BR/97-409, complete genome 10625.c...................1064595
AF311958.1 Dengue virus type 1 strain BR/97-233, complete genome 10625.c...................1064595
AF514878.2 Dengue virus type 1 strain 280par00 polyprotein gene, complete cds 10625.c...................1064595
AF514889.3 Dengue virus type 1 strain 297arg00 polyprotein gene, complete cds 10625.c...................1064595
AF513110.1 Dengue virus type 1 isolate BR/01-MR, complete genome 10625.c...................1064595
AF514876.3 Dengue virus type 1 strain 301arg00 polyprotein gene, complete cds 10625.c...................1064595
AF514885.3 Dengue virus type 1 strain 295arg00 polyprotein gene, complete cds 10625.c...................1064595
AF514883.2 Dengue virus type 1 strain 259par00 polyprotein gene, complete cds 10625.c...................1064595
AY277664.1 Dengue virus type 1 isolate ARG9920, complete genome 10625.c...................1064595
AY277665.1 Dengue virus type 1 isolate ARG0028, complete genome 10625.c...................1064595
AY277666.1 Dengue virus type 1 isolate ARG0048, complete genome 10625.c...................1064595
AY206457.3 Dengue virus type 1 strain 293arg00 polyprotein gene, complete cds 10625.c...................1064595
AB178040.1 Dengue virus type 1 genomic RNA, complete genome 10625.t...................1064595
AB189120.1 Dengue virus 1 genomic RNA, complete genome, strain: 98901518 DHF DV-10625.t...................1064595
AB189121.1 Dengue virus 1 genomic RNA, complete genome, strain: 98901530 DF DV-110625.t...................1064595
AY762084.1 Dengue virus type 1 strain Singapore 8114/93, complete genome 10623.t...................1064395
AY726554.1 Dengue virus type 1 strain D1.Myanmar.31987/98 polyprotein gene, comp10625.t...................1064595
AY726555.1 Dengue virus type 1 strain D1.Myanmar.31459/98 polyprotein gene, comp10616.t...................1063695
AY732474.1 Dengue virus type 1 strain ThD1_0673_80, complete genome 10625.t...................1064595
AY732475.1 Dengue virus type 1 strain ThD1_0488_94, complete genome 10625.t...................1064595
AY732476.1 Dengue virus type 1 strain ThD1_0442_80, complete genome 10625.t...................1064595
AY732477.1 Dengue virus type 1 strain ThD1_0336_91, complete genome 10625.t...................1064595
AY732478.1 Dengue virus type 1 strain ThD1_0323_91, complete genome 10625.t...................1064595
AY732479.1 Dengue virus type 1 strain ThD1_0102_01, complete genome 10625.t...................1064595
AY732480.1 Dengue virus type 1 strain ThD1_0097_94, complete genome 10625.t...................1064595
AY732481.1 Dengue virus type 1 strain ThD1_0081_82, complete genome 10625.t...................1064595
AY732482.1 Dengue virus type 1 strain ThD1_0049_01, complete genome 10625.t...................1064595
AY732483.1 Dengue virus type 1 strain ThD1_0008_81, complete genome 10625.t...................1064595
AB204803.1 Dengue virus 1 genomic RNA, complete genome, strain: D1/hu/Yap/NIID2710596.t...................1061695
DQ193572.1 Dengue virus type 1 strain Fj231/04, complete genome 10625.t...................1064595
DQ285558.1 Dengue virus type 1 isolate Reunion 185/04 polyprotein gene, complete10593.t...................1061395
DQ285559.1 Dengue virus type 1 isolate Reunion 191/04 polyprotein gene, complete10610.c...................1063095
DQ285560.1 Dengue virus type 1 isolate Reunion 257/04 polyprotein gene, complete10600.t...................1062095
DQ285561.1 Dengue virus type 1 clone Seychelles 1480/04 polyprotein gene, comple10596.t...................1061695
DQ285562.1 Dengue virus type 1 isolate Comoros 04.329/93 polyprotein gene, compl10624.t...................1064495
AY496871.2 Dengue virus type 3 isolate BDH02-1, complete genome 10597.................c...1061795
AY496873.2 Dengue virus type 3 isolate BDH02-3, complete genome 10597.................c...1061795
AY496874.2 Dengue virus type 3 isolate BDH02-4, complete genome 10597.................c...1061795
AY496877.2 Dengue virus type 3 isolate BDH02-7, complete genome 10597.................c...1061795
AY496879.2 Dengue virus type 3 isolate PhMH-J1-97, complete genome 10597.................c...1061795
DQ401689.1 Dengue virus type 3 isolate mutant BDH02-01, complete genome 10597.................c...1061795
DQ401690.1 Dengue virus type 3 isolate InJ-16-82, complete genome 10597.................c...1061795
DQ401691.1 Dengue virus type 3 isolate mutant BDH02-03, complete genome 10597.................c...1061795
DQ401692.1 Dengue virus type 3 isolate mutant BDH02-04, complete genome 10597.................c...1061795
DQ401693.1 Dengue virus type 3 isolate mutant BDH02-07, complete genome 10597.................c...1061795
DQ401694.1 Dengue virus type 3 isolate mutant InJ-I6-82, complete genome 10597.................c...1061795
DQ401695.1 Dengue virus type 3 isolate mutant PhMH-J1-97, complete genome 10597.................c...1061795
DQ672556.1 Dengue virus type 1 strain FP0203, complete genome 10625.t...................1064595
DQ672557.1 Dengue virus type 1 strain FP0705, complete genome 10625.t...................1064595
DQ672558.1 Dengue virus type 1 strain FP0908, complete genome 10625.t...................1064595
DQ672559.1 Dengue virus type 1 strain FP1104, complete genome 10625.t...................1064595
DQ672560.1 Dengue virus type 1 strain HawM2516, complete genome 10625.t...................1064595
DQ672561.1 Dengue virus type 1 strain HawM3430, complete genome 10625.t...................1064595
DQ672562.1 Dengue virus type 1 strain HawM2540, complete genome 10625.t...................1064595
DQ672563.1 Dengue virus type 1 strain HawO3758, complete genome 10625.t...................1064595
DQ672564.1 Dengue virus type 1 strain HawO3663, complete genome 10625.c...................1064595
EF025110.1 Dengue virus type 1 isolate 71/02GZ, complete genome 10625.c...................1064595
EF032590.1 Dengue virus type 1 strain GZ01/95, complete genome 10625.t...................1064595
CS477263.1 Sequence 1 from Patent WO2006134433 10625.t...................1064595
CS477264.1 Sequence 2 from Patent WO2006134433 10625.t...................1064595
CS477265.1 Sequence 3 from Patent WO2006134433 10625.t...................1064595
CS479203.1 Sequence 39 from Patent WO2006134443 10625.t...................1064595
CS479204.1 Sequence 40 from Patent WO2006134443 10625.t...................1064595
EF105378.1 Dengue virus type 2 strain PM33974 polyprotein gene, complete cds 10612...c.................1063295
EF105379.1 Dengue virus type 2 isolate P8-1407 polyprotein gene, complete cds 10609..t..................1062995
EF105380.1 Dengue virus type 2 isolate Dak Ar 578 polyprotein gene, complete cds10612...c.................1063295
EF105381.1 Dengue virus type 2 isolate Dak Ar 510 polyprotein gene, complete cds10612...c.................1063295
EF105382.1 Dengue virus type 2 isolate Dak Ar 2039 polyprotein gene, complete cd10612...c.................1063295
EF105383.1 Dengue virus type 2 isolate Dak Ar A1247 polyprotein gene, complete c10590...c.................1061095
EF105384.1 Dengue virus type 2 isolate Dak HD 10674 polyprotein gene, complete c10614...c.................1063495
EF105385.1 Dengue virus type 2 isolate Dak Ar D20761 polyprotein gene, complete 10614...c.................1063495
EF105386.1 Dengue virus type 2 isolate Dak Ar A2022 polyprotein gene, complete c10611...c.................1063195
EF105387.1 Dengue virus type 2 isolate IBH11208 polyprotein gene, complete cds 10599...c.................1061995
EF105388.1 Dengue virus type 2 isolate IBH11664 polyprotein gene, complete cds 10601...c.................1062195
EF105389.1 Dengue virus type 2 isolate Dak Ar 141069 polyprotein gene, complete 10613...c.................1063395
EF105390.1 Dengue virus type 2 isolate Dak Ar 141070 polyprotein gene, complete 10607...c.................1062795
EF122231.1 Dengue virus 1 strain FGA/NA P6, complete genome 10625.c...................1064595
EF122232.1 Dengue virus 1 strain FGA/NA a5c, complete genome 10625.c...................1064595
EF457904.1 Dengue virus type 2 isolate Dak Ar D75505, complete genome 10614...c.................1063495
EF457905.1 Dengue virus type 1 isolate P72-1244, complete genome 10625.t...................1064595
AF226685.2 Dengue virus type 1 strain Den1BR/90, complete genome 10625.c...................1064595
EU081226.1 Dengue virus type 1 strain D1/SG/05K814DK1/2005, complete genome 10625.t...................1064595
EU081227.1 Dengue virus type 1 strain D1/SG/05K847DK1/2005, complete genome 10625.t...................1064595
EU081228.1 Dengue virus type 1 strain D1/SG/05K872DK1/2005, complete genome 10625.t...................1064595
EU081229.1 Dengue virus type 1 strain D1/SG/05K2398DK1/2005, complete genome 10625.t...................1064595
EU081230.1 Dengue virus type 1 strain D1/SG/05K2402DK1/2005, complete genome 10625.t...................1064595
EU081231.1 Dengue virus type 1 strain D1/SG/05K2887DK1/2005, complete genome 10625.t...................1064595
EU081232.1 Dengue virus type 1 strain D1/SG/05K2895DK1/2005, complete genome 10625.t...................1064595
EU081233.1 Dengue virus type 1 strain D1/SG/05K2901DK1/2005, complete genome 10625.t...................1064595
EU081234.1 Dengue virus type 1 strain D1/SG/05K2916DK1/2005, complete genome 10625.t...................1064595
EU081235.1 Dengue virus type 1 strain D1/SG/05K2928DK1/2005, complete genome 10625.t...................1064595
EU081236.1 Dengue virus type 1 strain D1/SG/05K3297DK1/2005, complete genome 10625.t...................1064595
EU081237.1 Dengue virus type 1 strain D1/SG/05K3300DK1/2005, complete genome 10625.t...................1064595
EU081238.1 Dengue virus type 1 strain D1/SG/05K3301DK1/2005, complete genome 10625.t...................1064595
EU081239.1 Dengue virus type 1 strain D1/SG/05K3318DK1/2005, complete genome 10625.t...................1064595
EU081240.1 Dengue virus type 1 strain D1/SG/05K3886DK1/2005, complete genome 10625.t...................1064595
EU081241.1 Dengue virus type 1 strain D1/SG/05K3894DK1/2005, complete genome 10625.t...................1064595
EU081242.1 Dengue virus type 1 strain D1/SG/05K3903DK1/2005, complete genome 10625.t...................1064595
EU081243.1 Dengue virus type 1 strain D1/SG/05K3904DK1/2005, complete genome 10625.t...................1064595
EU081244.1 Dengue virus type 1 strain D1/SG/05K3905DK1/2005, complete genome 10625.t...................1064595
EU081245.1 Dengue virus type 1 strain D1/SG/05K3908DK1/2005, complete genome 10625.t...................1064595
EU081246.1 Dengue virus type 1 strain D1/SG/05K3910DK1/2005, complete genome 10625.t...................1064595
EU081247.1 Dengue virus type 1 strain D1/SG/05K3911DK1/2005, complete genome 10625.t...................1064595
EU081248.1 Dengue virus type 1 strain D1/SG/05K3915DK1/2005, complete genome 10625.t...................1064595
EU081249.1 Dengue virus type 1 strain D1/SG/05K3916DK1/2005, complete genome 10625.t...................1064595
EU081250.1 Dengue virus type 1 strain D1/SG/05K3930DK1/2005, complete genome 10625.t...................1064595
EU081251.1 Dengue virus type 1 strain D1/SG/05K3933DK1/2005, complete genome 10625.t...................1064595
EU081252.1 Dengue virus type 1 strain D1/SG/05K3934DK1/2005, complete genome 10625.t...................1064595
EU081253.1 Dengue virus type 1 strain D1/SG/05K3935DK1/2005, complete genome 10625.t...................1064595
EU081255.1 Dengue virus type 1 strain D1/SG/05K4139DK1/2005, complete genome 10625.t...................1064595
EU081256.1 Dengue virus type 1 strain D1/SG/05K4140DK1/2005, complete genome 10625.t...................1064595
EU081257.1 Dengue virus type 1 strain D1/SG/05K4142DK1/2005, complete genome 10625.t...................1064595
EU081258.1 Dengue virus type 1 strain D1/SG/05K4147DK1/2005, complete genome 10625.c...................1064595
EU081259.1 Dengue virus type 1 strain D1/SG/05K4152DK1/2005, complete genome 10625.t...................1064595
EU081260.1 Dengue virus type 1 strain D1/SG/05K4154DK1/2005, complete genome 10625.t...................1064595
EU081261.1 Dengue virus type 1 strain D1/SG/05K4172DK1/2005, complete genome 10625.t...................1064595
EU081263.1 Dengue virus type 1 strain D1/SG/05K4174DK1/2005, complete genome 10625.t...................1064595
EU081264.1 Dengue virus type 1 strain D1/SG/05K4175DK1/2005, complete genome 10625.t...................1064595
EU081265.1 Dengue virus type 1 strain D1/SG/05K4183DK1/2005, complete genome 10625.t...................1064595
EU081266.1 Dengue virus type 1 strain D1/SG/05K4441DK1/2005, complete genome 10625.t...................1064595
EU081267.1 Dengue virus type 1 strain D1/SG/05K4443DK1/2005, complete genome 10625.t...................1064595
EU081268.1 Dengue virus type 1 strain D1/SG/05K4468DK1/2005, complete genome 10625.t...................1064595
EU081269.1 Dengue virus type 1 strain D1/SG/05K4479DK1/2005, complete genome 10625.t...................1064595
EU081270.1 Dengue virus type 1 strain D1/SG/05K4480DK1/2005, complete genome 10625.t...................1064595
EU081271.1 Dengue virus type 1 strain D1/SG/05K4604DK1/2005, complete genome 10625.t...................1064595
EU081272.1 Dengue virus type 1 strain D1/SG/05K4605DK1/2005, complete genome 10625.t...................1064595
EU081273.1 Dengue virus type 1 strain D1/SG/05K4606DK1/2005, complete genome 10625.t...................1064595
EU081274.1 Dengue virus type 1 strain D1/SG/05K4609DK1/2005, complete genome 10625.t...................1064595
EU081275.1 Dengue virus type 1 strain D1/SG/05K4620DK1/2005, complete genome 10625.t...................1064595
EU081276.1 Dengue virus type 1 strain D1/SG/05K4621DK1/2005, complete genome 10625.t...................1064595
EU081277.1 Dengue virus type 1 strain D1/SG/05K4622DK1/2005, complete genome 10625.t...................1064595
EU081278.1 Dengue virus type 1 strain D1/SG/05K4632DK1/2005, complete genome 10625.t...................1064595
EU081279.1 Dengue virus type 1 strain D1/SG/05K4820DK1/2005, complete genome 10625.t...................1064595
EU081280.1 Dengue virus type 1 strain D1/SG/06K2236DK1/2006, complete genome 10625.t...................1064595
EU081281.1 Dengue virus type 1 strain D1/SG/06K2290DK1/2006, complete genome 10625.t...................1064595
EU179860.1 Dengue virus type 1 isolate DS06-210505, complete genome 10561.t...................1058195
EU179861.1 Dengue virus type 1 isolate DS212-110306, complete genome 10606.t...................1062695
CS805343.1 Sequence 9 from Patent WO2007093472 10625.t...................1064595
CS805347.1 Sequence 13 from Patent WO2007093472 10625.t...................1064595
EU280167.1 Dengue virus type 1 strain DGVgz01, complete genome 10625.t...................1064595
EU359008.1 Dengue virus 1 isolate ZH1067, complete genome 10625.t...................1064595
EU249490.1 Dengue virus 1 isolate DENV-1/VN/BID-V793/2006, complete genome 10603.t...................1062395
EU249491.1 Dengue virus 1 isolate DENV-1/VN/BID-V794/2006, complete genome 10603.t...................1062395
EU249492.1 Dengue virus 1 isolate DENV-1/VN/BID-V795/2006, complete genome 10603.t...................1062395
EU249493.1 Dengue virus 1 isolate DENV-1/VN/BID-V796/2006, complete genome 10603.t...................1062395
EU249494.1 Dengue virus 1 isolate DENV-1/VN/BID-V797/2006, complete genome 10603.t...................1062395
EU249495.1 Dengue virus 1 isolate DENV-1/VN/BID-V798/2006, complete genome 10603.t...................1062395
EU482476.1 Dengue virus 1 isolate DENV-1/VN/BID-V931/2003, complete genome 10603.t...................1062395
EU482477.1 Dengue virus 1 isolate DENV-1/VN/BID-V932/2007, complete genome 10603.t...................1062395
EU482478.1 Dengue virus 1 isolate DENV-1/VN/BID-V933/2007, complete genome 10603.t...................1062395
EU482479.1 Dengue virus 1 isolate DENV-1/VN/BID-V934/2007, complete genome 10603.t...................1062395
EU482480.1 Dengue virus 1 isolate DENV-1/VN/BID-V935/2006, complete genome 10603.t...................1062395
EU482481.1 Dengue virus 1 isolate DENV-1/VN/BID-V936/2007, complete genome 10603.t...................1062395
EU482482.1 Dengue virus 1 isolate DENV-1/VN/BID-V937/2007, complete genome 10603.t...................1062395
EU482483.1 Dengue virus 1 isolate DENV-1/VN/BID-V938/2007, complete genome 10603.t...................1062395
EU482484.1 Dengue virus 1 isolate DENV-1/VN/BID-V939/2007, complete genome 10603.t...................1062395
EU482485.1 Dengue virus 1 isolate DENV-1/VN/BID-V940/2007, complete genome 10603.t...................1062395
EU482486.1 Dengue virus 1 isolate DENV-1/VN/BID-V941/2007, complete genome 10603.t...................1062395
EU482487.1 Dengue virus 1 isolate DENV-1/VN/BID-V942/2007, complete genome 10603.t...................1062395
EU482488.1 Dengue virus 1 isolate DENV-1/VN/BID-V943/2007, complete genome 10603.t...................1062395
EU482489.1 Dengue virus 1 isolate DENV-1/VN/BID-V944/2007, complete genome 10603.t...................1062395
EU482490.1 Dengue virus 1 isolate DENV-1/VN/BID-V945/2007, complete genome 10603.t...................1062395
EU482491.1 Dengue virus 1 isolate DENV-1/VN/BID-V946/2007, complete genome 10603.t...................1062395
EU482492.1 Dengue virus 1 isolate DENV-1/VN/BID-V947/2007, complete genome 10603.t...................1062395
EU482493.1 Dengue virus 1 isolate DENV-1/VN/BID-V948/2007, complete genome 10603.t...................1062395
EU482494.1 Dengue virus 1 isolate DENV-1/VN/BID-V949/2007, complete genome 10603.t...................1062395
EU482495.1 Dengue virus 1 isolate DENV-1/VN/BID-V950/2007, complete genome 10603.t...................1062395
EU482497.1 Dengue virus 1 isolate DENV-1/VN/BID-V952/2007, complete genome 10603.t...................1062395
EU482498.1 Dengue virus 1 isolate DENV-1/VN/BID-V953/2007, complete genome 10603.t...................1062395
EU482499.1 Dengue virus 1 isolate DENV-1/VN/BID-V954/2007, complete genome 10603.t...................1062395
EU482500.1 Dengue virus 1 isolate DENV-1/VN/BID-V955/2007, complete genome 10603.t...................1062395
EU482501.1 Dengue virus 1 isolate DENV-1/VN/BID-V956/2007, complete genome 10603.t...................1062395
EU482502.1 Dengue virus 1 isolate DENV-1/VN/BID-V957/2007, complete genome 10603.t...................1062395
EU482503.1 Dengue virus 1 isolate DENV-1/VN/BID-V958/2007, complete genome 10603.t...................1062395
EU482504.1 Dengue virus 1 isolate DENV-1/VN/BID-V959/2007, complete genome 10603.t...................1062395
EU482505.1 Dengue virus 1 isolate DENV-1/VN/BID-V960/2007, complete genome 10603.t...................1062395
EU482506.1 Dengue virus 1 isolate DENV-1/VN/BID-V961/2007, complete genome 10603.t...................1062395
EU482508.1 Dengue virus 1 isolate DENV-1/VN/BID-V963/2007, complete genome 10603.t...................1062395
EU482509.1 Dengue virus 1 isolate DENV-1/VN/BID-V964/2007, complete genome 10603.t...................1062395
EU482510.1 Dengue virus 1 isolate DENV-1/VN/BID-V965/2007, complete genome 10603.t...................1062395
EU482511.1 Dengue virus 1 isolate DENV-1/VN/BID-V966/2007, complete genome 10603.t...................1062395
EU482512.1 Dengue virus 1 isolate DENV-1/VN/BID-V967/2007, complete genome 10603.t...................1062395
EU482513.1 Dengue virus 1 isolate DENV-1/VN/BID-V968/2007, complete genome 10603.t...................1062395
EU482514.1 Dengue virus 1 isolate DENV-1/VN/BID-V969/2007, complete genome 10603.t...................1062395
EU482515.1 Dengue virus 1 isolate DENV-1/VN/BID-V970/2007, complete genome 10603.t...................1062395
EU482516.1 Dengue virus 1 isolate DENV-1/VN/BID-V972/2007, complete genome 10603.t...................1062395
EU482517.1 Dengue virus 1 isolate DENV-1/VN/BID-V973/2007, complete genome 10603.t...................1062395
EU482518.1 Dengue virus 1 isolate DENV-1/VN/BID-V974/2006, complete genome 10603.t...................1062395
EU482519.1 Dengue virus 1 isolate DENV-1/VN/BID-V975/2006, complete genome 10603.t...................1062395
EU482520.1 Dengue virus 1 isolate DENV-1/VN/BID-V976/2006, complete genome 10603.t...................1062395
EU482521.1 Dengue virus 1 isolate DENV-1/VN/BID-V977/2006, complete genome 10603.t...................1062395
EU482522.1 Dengue virus 1 isolate DENV-1/VN/BID-V978/2006, complete genome 10603.t...................1062395
EU482523.1 Dengue virus 1 isolate DENV-1/VN/BID-V979/2006, complete genome 10603.t...................1062395
EU482524.1 Dengue virus 1 isolate DENV-1/VN/BID-V980/2006, complete genome 10603.t...................1062395
EU482525.1 Dengue virus 1 isolate DENV-1/VN/BID-V981/2006, complete genome 10603.t...................1062395
EU482526.1 Dengue virus 1 isolate DENV-1/VN/BID-V982/2006, complete genome 10603.t...................1062395
EU482527.1 Dengue virus 1 isolate DENV-1/VN/BID-V983/2006, complete genome 10603.t...................1062395
EU482528.1 Dengue virus 1 isolate DENV-1/VN/BID-V984/2006, complete genome 10602.t...................1062295
EU482529.1 Dengue virus 1 isolate DENV-1/VN/BID-V985/2006, complete genome 10603.t...................1062395
EU482530.1 Dengue virus 1 isolate DENV-1/VN/BID-V986/2006, complete genome 10603.t...................1062395
EU482531.1 Dengue virus 1 isolate DENV-1/VN/BID-V987/2006, complete genome 10603.t...................1062395
EU482532.1 Dengue virus 1 isolate DENV-1/VN/BID-V988/2006, complete genome 10603.t...................1062395
EU482533.1 Dengue virus 1 isolate DENV-1/VN/BID-V989/2006, complete genome 10603.t...................1062395
EU482534.1 Dengue virus 1 isolate DENV-1/VN/BID-V990/2006, complete genome 10603.t...................1062395
EU482535.1 Dengue virus 1 isolate DENV-1/VN/BID-V991/2006, complete genome 10603.t...................1062395
EU482536.1 Dengue virus 1 isolate DENV-1/VN/BID-V992/2006, complete genome 10603.t...................1062395
EU482537.1 Dengue virus 1 isolate DENV-1/VN/BID-V993/2006, complete genome 10603.t...................1062395
EU482538.1 Dengue virus 1 isolate DENV-1/VN/BID-V994/2006, complete genome 10603.t...................1062395
EU482539.1 Dengue virus 1 isolate DENV-1/VN/BID-V995/2006, complete genome 10603.t...................1062395
EU482540.1 Dengue virus 1 isolate DENV-1/VN/BID-V996/2006, complete genome 10603.t...................1062395
EU482552.1 Dengue virus 2 isolate DENV-2/US/BID-V1040/2006, complete genome 10591...g.................1061195
EU482567.1 Dengue virus 1 isolate DENV-1/US/BID-V1162/1998, complete genome 10603.c...................1062395
EU482591.1 Dengue virus 1 isolate DENV-1/US/BID-V852/2006, complete genome 10603.c...................1062395
EU482592.1 Dengue virus 1 isolate DENV-1/US/BID-V853/1998, complete genome 10603.c...................1062395
EU482609.1 Dengue virus 1 isolate DENV-1/VE/BID-V1134/2007, complete genome 10603.c...................1062395
EU482610.1 Dengue virus 1 isolate DENV-1/VE/BID-V1135/2007, complete genome 10603.c...................1062395
EU482611.1 Dengue virus 1 isolate DENV-1/VE/BID-V1136/2007, complete genome 10603.c...................1062395
EU482615.1 Dengue virus 1 isolate DENV-1/NI/BID-V1069/2005, complete genome 10603.c...................1062395
EU482616.1 Dengue virus 1 isolate DENV-1/NI/BID-V1070/2005, complete genome 10603.c...................1062395
EU482617.1 Dengue virus 1 isolate DENV-1/NI/BID-V1071/2005, complete genome 10603.c...................1062395
EU482618.1 Dengue virus 1 isolate DENV-1/NI/BID-V1072/2005, complete genome 10603.c...................1062395
EU482619.1 Dengue virus 1 isolate DENV-1/NI/BID-V1073/2005, complete genome 10603.c...................1062395
EU482706.1 Dengue virus 1 isolate DENV-1/VN/BID-V780/2006, complete genome 10603.t...................1062395
EU482707.1 Dengue virus 1 isolate DENV-1/VN/BID-V781/2006, complete genome 10603.t...................1062395
EU482708.1 Dengue virus 1 isolate DENV-1/VN/BID-V782/2007, complete genome 10603.t...................1062395
EU482709.1 Dengue virus 1 isolate DENV-1/VN/BID-V783/2007, complete genome 10603.t...................1062395
EU482710.1 Dengue virus 1 isolate DENV-1/VN/BID-V784/2007, complete genome 10603.t...................1062395
EU482711.1 Dengue virus 1 isolate DENV-1/VN/BID-V785/2007, complete genome 10603.t...................1062395
EU482712.1 Dengue virus 1 isolate DENV-1/VN/BID-V786/2007, complete genome 10603.t...................1062395
EU482713.1 Dengue virus 1 isolate DENV-1/VN/BID-V787/2007, complete genome 10603.t...................1062395
EU482714.1 Dengue virus 1 isolate DENV-1/VN/BID-V788/2007, complete genome 10603.t...................1062395
EU482715.1 Dengue virus 1 isolate DENV-1/VN/BID-V789/2007, complete genome 10603.t...................1062395
EU482716.1 Dengue virus 1 isolate DENV-1/VN/BID-V790/2007, complete genome 10603.t...................1062395
EU482717.1 Dengue virus 1 isolate DENV-1/VN/BID-V791/2007, complete genome 10603.t...................1062395
EU482718.1 Dengue virus 1 isolate DENV-1/VN/BID-V792/2007, complete genome 10603.t...................1062395
EU482789.1 Dengue virus 1 isolate DENV-1/VN/BID-V767/2003, complete genome 10603.t...................1062395
EU482790.1 Dengue virus 1 isolate DENV-1/VN/BID-V768/2003, complete genome 10603.t...................1062395
EU482791.1 Dengue virus 1 isolate DENV-1/VN/BID-V769/2003, complete genome 10603.t...................1062395
EU482792.1 Dengue virus 1 isolate DENV-1/VN/BID-V770/2003, complete genome 10603.t...................1062395
EU482793.1 Dengue virus 1 isolate DENV-1/VN/BID-V799/2006, complete genome 10603.t...................1062395
EU482794.1 Dengue virus 1 isolate DENV-1/VN/BID-V800/2006, complete genome 10602.t...................1062295
EU482795.1 Dengue virus 1 isolate DENV-1/VN/BID-V801/2006, complete genome 10603.t...................1062395
EU482796.1 Dengue virus 1 isolate DENV-1/VN/BID-V802/2006, complete genome 10603.t...................1062395
EU482797.1 Dengue virus 1 isolate DENV-1/VN/BID-V803/2006, complete genome 10603.t...................1062395
EU482798.1 Dengue virus 1 isolate DENV-1/VN/BID-V804/2006, complete genome 10603.t...................1062395
EU482799.1 Dengue virus 1 isolate DENV-1/VN/BID-V805/2006, complete genome 10603.t...................1062395
EU482800.1 Dengue virus 1 isolate DENV-1/VN/BID-V806/2006, complete genome 10603.c...................1062395
EU482801.1 Dengue virus 1 isolate DENV-1/VN/BID-V807/2006, complete genome 10603.t...................1062395
EU482802.1 Dengue virus 1 isolate DENV-1/VN/BID-V808/2006, complete genome 10603.t...................1062395
EU482803.1 Dengue virus 1 isolate DENV-1/VN/BID-V809/2006, complete genome 10603.t...................1062395
EU482804.1 Dengue virus 1 isolate DENV-1/VN/BID-V810/2006, complete genome 10603.t...................1062395
EU482805.1 Dengue virus 1 isolate DENV-1/VN/BID-V811/2006, complete genome 10603.t...................1062395
EU482806.1 Dengue virus 1 isolate DENV-1/VN/BID-V812/2006, complete genome 10603.t...................1062395
EU482807.1 Dengue virus 1 isolate DENV-1/VN/BID-V813/2006, complete genome 10603.t...................1062395
EU482808.1 Dengue virus 1 isolate DENV-1/VN/BID-V814/2006, complete genome 10603.t...................1062395
EU482809.1 Dengue virus 1 isolate DENV-1/VN/BID-V815/2006, complete genome 10603.t...................1062395
EU482810.1 Dengue virus 1 isolate DENV-1/VN/BID-V816/2006, complete genome 10603.t...................1062395
EU482811.1 Dengue virus 1 isolate DENV-1/VN/BID-V817/2006, complete genome 10603.t...................1062395
EU482812.1 Dengue virus 1 isolate DENV-1/VN/BID-V818/2006, complete genome 10603.t...................1062395
EU482813.1 Dengue virus 1 isolate DENV-1/VN/BID-V819/2006, complete genome 10603.t...................1062395
EU482814.1 Dengue virus 1 isolate DENV-1/VN/BID-V820/2006, complete genome 10603.t...................1062395
EU482815.1 Dengue virus 1 isolate DENV-1/VN/BID-V821/2006, complete genome 10603.t...................1062395
EU482816.1 Dengue virus 1 isolate DENV-1/VN/BID-V822/2006, complete genome 10603.t...................1062395
EU482817.1 Dengue virus 1 isolate DENV-1/VN/BID-V823/2006, complete genome 10603.t...................1062395
EU482818.1 Dengue virus 1 isolate DENV-1/VN/BID-V824/2006, complete genome 10603.t...................1062395
EU482819.1 Dengue virus 1 isolate DENV-1/VN/BID-V825/2006, complete genome 10603.t...................1062395
EU482820.1 Dengue virus 1 isolate DENV-1/VN/BID-V826/2006, complete genome 10603.t...................1062395
EU482821.1 Dengue virus 1 isolate DENV-1/VN/BID-V827/2006, complete genome 10603.t...................1062395
EU482822.1 Dengue virus 1 isolate DENV-1/VN/BID-V828/2006, complete genome 10603.t...................1062395
EU482823.1 Dengue virus 1 isolate DENV-1/VN/BID-V829/2006, complete genome 10603.t...................1062395
EU482824.1 Dengue virus 1 isolate DENV-1/VN/BID-V830/2006, complete genome 10603.t...................1062395
EU482825.1 Dengue virus 1 isolate DENV-1/VN/BID-V831/2006, complete genome 10603.t...................1062395
EU482826.1 Dengue virus 1 isolate DENV-1/VN/BID-V832/2006, complete genome 10603.t...................1062395
EU482827.1 Dengue virus 1 isolate DENV-1/VN/BID-V833/2006, complete genome 10603.t...................1062395
EU482828.1 Dengue virus 1 isolate DENV-1/VN/BID-V834/2006, complete genome 10603.t...................1062395
AY835999.4 Dengue virus 1 isolate ZJ01/2004, complete genome 10625.t...................1064595
EU596501.1 Dengue virus 1 isolate DENV-1/NI/BID-V653/2004, complete genome 10603.c...................1062395
EU596502.1 Dengue virus 1 isolate DENV-1/NI/BID-V614/2005, complete genome 10603.c...................1062395
EU596503.1 Dengue virus 1 isolate DENV-1/NI/BID-V641/2005, complete genome 10603.c...................1062395
EU596504.1 Dengue virus 1 isolate DENV-1/NI/BID-V606/2005, complete genome 10603.c...................1062395
EU660401.1 Dengue virus 1 isolate DENV-1/VN/BID-V1499/2006, complete genome 10603.t...................1062395
EU660402.1 Dengue virus 1 isolate DENV-1/VN/BID-V1501/2006, complete genome 10603.t...................1062395
EU660403.1 Dengue virus 1 isolate DENV-1/VN/BID-V1502/2006, complete genome 10592.t...................1061295
EU660412.1 Dengue virus 1 isolate DENV-1/VN/BID-V1506/2007, complete genome 10603.t...................1062395
EU660418.1 Dengue virus 1 isolate DENV-1/VN/BID-V1516/2007, complete genome 10603.t...................1062395
EU660419.1 Dengue virus 1 isolate DENV-1/VN/BID-V1552/2007, complete genome 10603.t...................1062395
EU660390.1 Dengue virus 1 isolate DENV-1/VN/BID-V1320/2006, complete genome 10603.t...................1062395
EU660391.1 Dengue virus 1 isolate DENV-1/VN/BID-V1321/2006, complete genome 10603.t...................1062395
EU660392.1 Dengue virus 1 isolate DENV-1/VN/BID-V1322/2006, complete genome 10603.t...................1062395
EU660393.1 Dengue virus 1 isolate DENV-1/VN/BID-V1323/2006, complete genome 10603.t...................1062395
EU660394.1 Dengue virus 1 isolate DENV-1/VN/BID-V1324/2006, complete genome 10603.t...................1062395
EU660395.1 Dengue virus 1 isolate DENV-1/VN/BID-V1505/2007, complete genome 10603.t...................1062395
EU660396.1 Dengue virus 1 isolate DENV-1/VN/BID-V1319/2006, complete genome 10603.t...................1062395
EU660397.1 Dengue virus 1 isolate DENV-1/VN/BID-V1503/2006, complete genome 10603.t...................1062395
EU677139.1 Dengue virus 1 isolate DENV-1/VN/BID-V1539/2007, complete genome 10603.t...................1062395
EU677140.1 Dengue virus 1 isolate DENV-1/VN/BID-V1540/2007, complete genome 10603.t...................1062395
EU677150.1 Dengue virus 1 isolate DENV-1/VN/BID-V1521/2007, complete genome 10604.t...................1062495
EU677151.1 Dengue virus 1 isolate DENV-1/VN/BID-V1523/2007, complete genome 10603.t...................1062395
EU677152.1 Dengue virus 1 isolate DENV-1/VN/BID-V1524/2007, complete genome 10603.t...................1062395
EU677153.1 Dengue virus 1 isolate DENV-1/VN/BID-V1525/2007, complete genome 10603.t...................1062395
EU677154.1 Dengue virus 1 isolate DENV-1/VN/BID-V1526/2007, complete genome 10603.t...................1062395
EU677155.1 Dengue virus 1 isolate DENV-1/VN/BID-V1527/2007, complete genome 10603.t...................1062395
EU677156.1 Dengue virus 1 isolate DENV-1/VN/BID-V1528/2007, complete genome 10603.t...................1062395
EU677157.1 Dengue virus 1 isolate DENV-1/VN/BID-V1529/2007, complete genome 10603.t...................1062395
EU677158.1 Dengue virus 1 isolate DENV-1/VN/BID-V1531/2007, complete genome 10603.t...................1062395
EU677159.1 Dengue virus 1 isolate DENV-1/VN/BID-V1532/2007, complete genome 10603.t...................1062395
EU677160.1 Dengue virus 1 isolate DENV-1/VN/BID-V1533/2007, complete genome 10603.t...................1062395
EU677161.1 Dengue virus 1 isolate DENV-1/VN/BID-V1534/2007, complete genome 10603.t...................1062395
EU677162.1 Dengue virus 1 isolate DENV-1/VN/BID-V1535/2007, complete genome 10604.t...................1062495
EU677163.1 Dengue virus 1 isolate DENV-1/VN/BID-V1536/2007, complete genome 10603.t...................1062395
EU677164.1 Dengue virus 1 isolate DENV-1/VN/BID-V1537/2007, complete genome 10603.t...................1062395
EU677165.1 Dengue virus 1 isolate DENV-1/VN/BID-V1538/2007, complete genome 10603.t...................1062395
EU677166.1 Dengue virus 1 isolate DENV-1/VN/BID-V1541/2007, complete genome 10603.t...................1062395
EU677167.1 Dengue virus 1 isolate DENV-1/VN/BID-V1542/2007, complete genome 10603.t...................1062395
EU677168.1 Dengue virus 1 isolate DENV-1/VN/BID-V1543/2007, complete genome 10603.t...................1062395
EU677169.1 Dengue virus 1 isolate DENV-1/VN/BID-V1544/2007, complete genome 10603.t...................1062395
EU677170.1 Dengue virus 1 isolate DENV-1/VN/BID-V1545/2007, complete genome 10603.t...................1062395
EU677171.1 Dengue virus 1 isolate DENV-1/VN/BID-V1547/2007, complete genome 10603.t...................1062395
EU677172.1 Dengue virus 1 isolate DENV-1/VN/BID-V1548/2007, complete genome 10603.t...................1062395
EU677173.1 Dengue virus 1 isolate DENV-1/VN/BID-V1549/2007, complete genome 10603.t...................1062395
EU677174.1 Dengue virus 1 isolate DENV-1/VN/BID-V1550/2007, complete genome 10603.t...................1062395
EU677175.1 Dengue virus 1 isolate DENV-1/VN/BID-V1553/2007, complete genome 10604.t...................1062495
EU677176.1 Dengue virus 1 isolate DENV-1/VN/BID-V1555/2007, complete genome 10603.t...................1062395
EU677177.1 Dengue virus 1 isolate DENV-1/VN/BID-V1558/2007, complete genome 10603.t...................1062395
EU677178.1 Dengue virus 1 isolate DENV-1/VN/BID-V1560/2007, complete genome 10603.t...................1062395
EU687247.1 Dengue virus 1 isolate DENV-1/VN/BID-V1504/2006, complete genome 10603.t...................1062395
EU726777.1 Dengue virus 1 isolate DENV-1/VN/BID-V1530/2007, complete genome 10603.t...................1062395
EU726778.1 Dengue virus 1 isolate DENV-1/VN/BID-V1546/2007, complete genome 10603.t...................1062395
EU726779.1 Dengue virus 1 isolate DENV-1/VN/BID-V1551/2007, complete genome 10603.t...................1062395
EU726780.1 Dengue virus 1 isolate DENV-1/VN/BID-V1556/2007, complete genome 10603.t...................1062395
EU726781.1 Dengue virus 1 isolate DENV-1/VN/BID-V1557/2007, complete genome 10603.t...................1062395
EU726782.1 Dengue virus 1 isolate DENV-1/VN/BID-V1559/2007, complete genome 10603.t...................1062395
EU781136.1 Dengue virus 3 isolate DENV-3/US/BID-V1451/1999, complete genome 10561..g..................1058195
EU081254.2 Dengue virus type 1 strain D1/SG/05K4138DK1/2005, complete genome 10625.t...................1064595
EU081262.2 Dengue virus type 1 strain D1/SG/05K4173DK1/2005, complete genome 10625.t...................1064595
EU848545.1 Dengue virus 1 isolate US/Hawaii/1944, complete genome 10624.t...................1064495
FJ024423.1 Dengue virus 1 isolate DENV-1/NI/BID-V628/2005, complete genome 10603.c...................1062395
FJ024478.1 Dengue virus 1 isolate DENV-1/NI/BID-V604/2005, complete genome 10603.c...................1062395
FJ024479.1 Dengue virus 1 isolate DENV-1/NI/BID-V642/2006, complete genome 10603.c...................1062395
FJ024480.1 Dengue virus 1 isolate DENV-1/NI/BID-V657/2005, complete genome 10603.c...................1062395
FJ024481.1 Dengue virus 1 isolate DENV-1/NI/BID-V610/2005, complete genome 10603.c...................1062395
FJ024482.1 Dengue virus 1 isolate DENV-1/NI/BID-V652/2005, complete genome 10603.c...................1062395
FJ024483.1 Dengue virus 1 isolate DENV-1/NI/BID-V602/2005, complete genome 10603.c...................1062395
FJ024484.1 Dengue virus 1 isolate DENV-1/NI/BID-V635/2005, complete genome 10603.c...................1062395
FJ024485.1 Dengue virus 1 isolate DENV-1/NI/BID-V629/2005, complete genome 10603.c...................1062395
FJ024425.1 Dengue virus 1 isolate DENV-1/VN/BID-V1565/2007, complete genome 10603.t...................1062395
FJ024426.1 Dengue virus 1 isolate DENV-1/VN/BID-V1566/2007, complete genome 10603.t...................1062395
FJ024427.1 Dengue virus 1 isolate DENV-1/VN/BID-V1567/2007, complete genome 10603.t...................1062395
FJ024428.1 Dengue virus 1 isolate DENV-1/VN/BID-V1568/2007, complete genome 10603.t...................1062395
FJ024429.1 Dengue virus 1 isolate DENV-1/VN/BID-V1569/2007, complete genome 10603.t...................1062395
FJ024430.1 Dengue virus 1 isolate DENV-1/VN/BID-V1570/2007, complete genome 10603.t...................1062395
FJ024431.1 Dengue virus 1 isolate DENV-1/VN/BID-V1571/2007, complete genome 10603.t...................1062395
FJ024433.1 Dengue virus 1 isolate DENV-1/VN/BID-V1573/2007, complete genome 10603.t...................1062395
FJ024434.1 Dengue virus 1 isolate DENV-1/VN/BID-V1574/2007, complete genome 10603.t...................1062395
FJ024435.1 Dengue virus 1 isolate DENV-1/VN/BID-V1575/2007, complete genome 10603.t...................1062395
FJ024436.1 Dengue virus 1 isolate DENV-1/VN/BID-V1576/2007, complete genome 10603.t...................1062395
FJ024437.1 Dengue virus 1 isolate DENV-1/VN/BID-V1577/2007, complete genome 10603.t...................1062395
FJ024438.1 Dengue virus 1 isolate DENV-1/VN/BID-V1579/2007, complete genome 10603.t...................1062395
FJ024439.1 Dengue virus 1 isolate DENV-1/VN/BID-V1580/2007, complete genome 10603.t...................1062395
FJ024440.1 Dengue virus 1 isolate DENV-1/VN/BID-V1581/2007, complete genome 10603.t...................1062395
FJ024441.1 Dengue virus 1 isolate DENV-1/VN/BID-V1582/2007, complete genome 10603.t...................1062395
FJ024442.1 Dengue virus 1 isolate DENV-1/VN/BID-V1583/2007, complete genome 10603.t...................1062395
FJ024443.1 Dengue virus 1 isolate DENV-1/VN/BID-V1584/2007, complete genome 10603.t...................1062395
FJ024444.1 Dengue virus 1 isolate DENV-1/VN/BID-V1628/2006, complete genome 10603.t...................1062395
FJ024445.1 Dengue virus 1 isolate DENV-1/VN/BID-V1638/2007, complete genome 10603.t...................1062395
FJ024447.1 Dengue virus 1 isolate DENV-1/VN/BID-V1643/2007, complete genome 10603.t...................1062395
FJ024448.1 Dengue virus 1 isolate DENV-1/VN/BID-V1648/2007, complete genome 10603.t...................1062395
FJ024449.1 Dengue virus 1 isolate DENV-1/VN/BID-V1655/2007, complete genome 10603.t...................1062395
FJ024450.1 Dengue virus 1 isolate DENV-1/VN/BID-V1660/2007, complete genome 10603.t...................1062395
FJ024451.1 Dengue virus 1 isolate DENV-1/VN/BID-V1665/2007, complete genome 10603.t...................1062395
FJ024453.1 Dengue virus 1 isolate DENV-1/VN/BID-V1672/2007, complete genome 10603.t...................1062395
FJ024455.1 Dengue virus 1 isolate DENV-1/VN/BID-V1676/2007, complete genome 10603.t...................1062395
FJ024456.1 Dengue virus 1 isolate DENV-1/VN/BID-V1677/2007, complete genome 10603.t...................1062395
FJ024457.1 Dengue virus 1 isolate DENV-1/VN/BID-V1683/2007, complete genome 10603.t...................1062395
FJ024459.1 Dengue virus 1 isolate DENV-1/VN/BID-V1689/2007, complete genome 10604.t...................1062495
FJ024460.1 Dengue virus 1 isolate DENV-1/VN/BID-V1692/2007, complete genome 10603.t...................1062395
FJ024462.1 Dengue virus 1 isolate DENV-1/VN/BID-V1700/2007, complete genome 10603.t...................1062395
FJ024463.1 Dengue virus 1 isolate DENV-1/VN/BID-V1701/2007, complete genome 10603.t...................1062395
FJ024464.1 Dengue virus 1 isolate DENV-1/VN/BID-V1703/2007, complete genome 10603.t...................1062395
FJ024472.1 Dengue virus 1 isolate DENV-1/VN/BID-V1578/2007, complete genome 10603.t...................1062395
FM210236.2 Dengue virus 2 isolate CSF381, complete genome 10570...................c.1059095
FJ182002.1 Dengue virus 1 isolate DENV-1/NI/BID-V646/2005, complete genome 10603.c...................1062395
FJ205872.1 Dengue virus 1 isolate DENV-1/US/BID-V1739/1998, complete genome 10603.c...................1062395
FJ205873.1 Dengue virus 1 isolate DENV-1/US/BID-V1740/1998, complete genome 10603.c...................1062395
FJ205874.1 Dengue virus 1 isolate DENV-1/US/BID-V1743/1995, complete genome 10603.c...................1062395
FJ205875.1 Dengue virus 1 isolate DENV-1/US/BID-V1744/1995, complete genome 10603.c...................1062395
FJ176779.1 Dengue virus 1 strain DEN1/GZ/OY polyprotein gene, complete cds 10625.t...................1064595
FJ176780.1 Dengue virus 1 strain DEN1/GZ/XNC polyprotein gene, complete cds 10625.t...................1064595
FJ182003.1 Dengue virus 1 isolate DENV-1/VN/BID-V1657/2007, complete genome 10603.t...................1062395
FJ182018.1 Dengue virus 1 isolate DENV-1/VN/BID-V1632/2006, complete genome 10603.t...................1062395
FJ182019.1 Dengue virus 1 isolate DENV-1/VN/BID-V1635/2007, complete genome 10603.t...................1062395
FJ182020.1 Dengue virus 1 isolate DENV-1/VN/BID-V1637/2007, complete genome 10603.c...................1062395
FJ182022.1 Dengue virus 1 isolate DENV-1/VN/BID-V1640/2007, complete genome 10603.t...................1062395
FJ182023.1 Dengue virus 1 isolate DENV-1/VN/BID-V1642/2007, complete genome 10603.t...................1062395
FJ182024.1 Dengue virus 1 isolate DENV-1/VN/BID-V1644/2007, complete genome 10603.c...................1062395
FJ182025.1 Dengue virus 1 isolate DENV-1/VN/BID-V1646/2007, complete genome 10603.t...................1062395
FJ182026.1 Dengue virus 1 isolate DENV-1/VN/BID-V1649/2007, complete genome 10603.t...................1062395
FJ182027.1 Dengue virus 1 isolate DENV-1/VN/BID-V1651/2007, complete genome 10603.t...................1062395
FJ182028.1 Dengue virus 1 isolate DENV-1/VN/BID-V1653/2007, complete genome 10603.t...................1062395
FJ182029.1 Dengue virus 1 isolate DENV-1/VN/BID-V1658/2007, complete genome 10603.t...................1062395
FJ182030.1 Dengue virus 1 isolate DENV-1/VN/BID-V1662/2007, complete genome 10603.t...................1062395
FJ182031.1 Dengue virus 1 isolate DENV-1/VN/BID-V1663/2007, complete genome 10603.t...................1062395
FJ182032.1 Dengue virus 1 isolate DENV-1/VN/BID-V1664/2007, complete genome 10604.t...................1062495
FJ182033.1 Dengue virus 1 isolate DENV-1/VN/BID-V1666/2007, complete genome 10603.t...................1062395
FJ182034.1 Dengue virus 1 isolate DENV-1/VN/BID-V1667/2007, complete genome 10589.t...................1060995
FJ182035.1 Dengue virus 1 isolate DENV-1/VN/BID-V1668/2007, complete genome 10604.t...................1062495
FJ182036.1 Dengue virus 1 isolate DENV-1/VN/BID-V1670/2007, complete genome 10603.t...................1062395
FJ205876.1 Dengue virus 1 isolate DENV-1/VN/BID-V1673/2007, complete genome 10603.t...................1062395
FJ205881.1 Dengue virus 1 isolate DENV-1/VN/BID-V1691/2007, complete genome 10603.t...................1062395
FJ205882.1 Dengue virus 1 isolate DENV-1/VN/BID-V1693/2007, complete genome 10603.t...................1062395
FJ205883.1 Dengue virus 1 isolate DENV-1/VN/BID-V1694/2007, complete genome 10603.t...................1062395
FJ205884.1 Dengue virus 1 isolate DENV-1/VN/BID-V1698/2007, complete genome 10603.t...................1062395
EU863650.1 Dengue virus 1 strain CHI3336-02, complete genome 10625.t...................1064595
FJ373296.1 Dengue virus 1 isolate DENV-1/VN/BID-V1629/2006, complete genome 10603.t...................1062395
FJ373297.1 Dengue virus 1 isolate DENV-1/VN/BID-V1647/2007, complete genome 10603.t...................1062395
FJ373298.1 Dengue virus 1 isolate DENV-1/VN/BID-V1650/2007, complete genome 10603.t...................1062395
FJ373304.1 Dengue virus 3 isolate DENV-3/VE/BID-V1590/2004, complete genome 10566.c...................1058695
FJ373305.1 Dengue virus 1 isolate DENV-1/VN/BID-V1500/2006, complete genome 10603.t...................1062395
FJ390374.1 Dengue virus 1 isolate DENV-1/US/BID-V1734/1995, complete genome 10603.c...................1062395
FJ390378.1 Dengue virus 1 isolate DENV-1/US/BID-V1738/1998, complete genome 10603.c...................1062395
FJ390379.1 Dengue virus 1 isolate DENV-1/US/BID-V1741/1998, complete genome 10603.c...................1062395
FJ390380.1 Dengue virus 1 isolate DENV-1/US/BID-V1742/1998, complete genome 10603.c...................1062395
FJ390381.1 Dengue virus 1 isolate DENV-1/VN/BID-V1652/2007, complete genome 10603.t...................1062395
FJ390383.1 Dengue virus 1 isolate DENV-1/VN/BID-V1659/2007, complete genome 10603.t...................1062395
FJ390386.1 Dengue virus 1 isolate DENV-1/VN/BID-V1686/2007, complete genome 10603.t...................1062395
FJ390388.1 Dengue virus 1 isolate DENV-1/VN/BID-V1702/2007, complete genome 10603.t...................1062395
FJ410173.1 Dengue virus 1 isolate DENV-1/US/BID-V2093/1998, complete genome 10603.c...................1062395
FJ410174.1 Dengue virus 1 isolate DENV-1/US/BID-V2094/1995, complete genome 10603.c...................1062395
FJ410175.1 Dengue virus 1 isolate DENV-1/US/BID-V2095/1994, complete genome 10603.c...................1062395
FJ410179.1 Dengue virus 1 isolate DENV-1/US/BID-V2127/1994, complete genome 10603.c...................1062395
FJ410180.1 Dengue virus 1 isolate DENV-1/US/BID-V2128/1995, complete genome 10603.c...................1062395
FJ410181.1 Dengue virus 1 isolate DENV-1/US/BID-V2129/1995, complete genome 10590.c...................1061095
FJ410182.1 Dengue virus 1 isolate DENV-1/US/BID-V2131/1996, complete genome 10603.c...................1062395
FJ410183.1 Dengue virus 1 isolate DENV-1/US/BID-V2132/1993, complete genome 10603.c...................1062395
FJ410184.1 Dengue virus 1 isolate DENV-1/US/BID-V2133/1993, complete genome 10603.c...................1062395
FJ410185.1 Dengue virus 1 isolate DENV-1/US/BID-V2134/1993, complete genome 10603.c...................1062395
FJ410186.1 Dengue virus 1 isolate DENV-1/US/BID-V2136/1992, complete genome 10603.c...................1062395
FJ410187.1 Dengue virus 1 isolate DENV-1/US/BID-V2137/1992, complete genome 10603.c...................1062395
FJ410188.1 Dengue virus 1 isolate DENV-1/US/BID-V2139/1996, complete genome 10603.c...................1062395
FJ410189.1 Dengue virus 1 isolate DENV-1/US/BID-V2140/1996, complete genome 10603.c...................1062395
FJ410190.1 Dengue virus 1 isolate DENV-1/US/BID-V2143/1987, complete genome 10603.c...................1062395
FJ410191.1 Dengue virus 1 isolate DENV-1/VN/BID-V1768/2008, complete genome 10602.t...................1062295
FJ410192.1 Dengue virus 1 isolate DENV-1/VN/BID-V1772/2008, complete genome 10590.t...................1061095
FJ410194.1 Dengue virus 1 isolate DENV-1/VN/BID-V1774/2007, complete genome 10596.t...................1061695
FJ410196.1 Dengue virus 1 isolate DENV-1/VN/BID-V1789/2007, complete genome 10604.t...................1062495
FJ410197.1 Dengue virus 1 isolate DENV-1/VN/BID-V1791/2007, complete genome 10599.t...................1061995
FJ410198.1 Dengue virus 1 isolate DENV-1/VN/BID-V1797/2007, complete genome 10589.t...................1060995
FJ410199.1 Dengue virus 1 isolate DENV-1/VN/BID-V1799/2007, complete genome 10589.t...................1060995
FJ410201.1 Dengue virus 1 isolate DENV-1/VN/BID-V1806/2007, complete genome 10589.t...................1060995
FJ410203.1 Dengue virus 1 isolate DENV-1/VN/BID-V1808/2007, complete genome 10599.t...................1061995
FJ410204.1 Dengue virus 1 isolate DENV-1/VN/BID-V1809/2007, complete genome 10603.t...................1062395
FJ410205.1 Dengue virus 1 isolate DENV-1/VN/BID-V1812/2007, complete genome 10591.t...................1061195
FJ410206.1 Dengue virus 1 isolate DENV-1/VN/BID-V1813/2007, complete genome 10609.t...................1062995
FJ410207.1 Dengue virus 1 isolate DENV-1/VN/BID-V1814/2007, complete genome 10596.t...................1061695
FJ410209.1 Dengue virus 1 isolate DENV-1/VN/BID-V1825/2007, complete genome 10591.t...................1061195
FJ410210.1 Dengue virus 1 isolate DENV-1/VN/BID-V1826/2007, complete genome 10587.t...................1060795
FJ410211.1 Dengue virus 1 isolate DENV-1/VN/BID-V1830/2007, complete genome 10587.t...................1060795
FJ410212.1 Dengue virus 1 isolate DENV-1/VN/BID-V1839/2007, complete genome 10587.t...................1060795
FJ410213.1 Dengue virus 1 isolate DENV-1/VN/BID-V1841/2008, complete genome 10585.t...................1060595
FJ410214.1 Dengue virus 1 isolate DENV-1/VN/BID-V1843/2008, complete genome 10587.t...................1060795
FJ410216.1 Dengue virus 1 isolate DENV-1/VN/BID-V1849/2007, complete genome 10603.t...................1062395
FJ410218.1 Dengue virus 1 isolate DENV-1/VN/BID-V1856/2007, complete genome 10589.t...................1060995
FJ410220.1 Dengue virus 1 isolate DENV-1/VN/BID-V1862/2008, complete genome 10585.t...................1060595
FJ410222.1 Dengue virus 1 isolate DENV-1/VN/BID-V1866/2007, complete genome 10584.t...................1060495
FJ410225.1 Dengue virus 1 isolate DENV-1/VN/BID-V1875/2007, complete genome 10587.t...................1060795
FJ410226.1 Dengue virus 1 isolate DENV-1/VN/BID-V1878/2008, complete genome 10603.t...................1062395
FJ410227.1 Dengue virus 1 isolate DENV-1/VN/BID-V1879/2007, complete genome 10593.t...................1061395
FJ410230.1 Dengue virus 1 isolate DENV-1/VN/BID-V1884/2008, complete genome 10589.t...................1060995
FJ410231.1 Dengue virus 1 isolate DENV-1/VN/BID-V1885/2007, complete genome 10584.t...................1060495
FJ410232.1 Dengue virus 1 isolate DENV-1/VN/BID-V1890/2007, complete genome 10592.t...................1061295
FJ410234.1 Dengue virus 1 isolate DENV-1/VN/BID-V1896/2007, complete genome 10603.t...................1062395
FJ410235.1 Dengue virus 1 isolate DENV-1/VN/BID-V1898/2008, complete genome 10592.t...................1061295
FJ410236.1 Dengue virus 1 isolate DENV-1/VN/BID-V1899/2008, complete genome 10603.t...................1062395
FJ410238.1 Dengue virus 1 isolate DENV-1/VN/BID-V1901/2008, complete genome 10603.t...................1062395
FJ410239.1 Dengue virus 1 isolate DENV-1/VN/BID-V1902/2008, complete genome 10603.t...................1062395
FJ410240.1 Dengue virus 1 isolate DENV-1/VN/BID-V1904/2008, complete genome 10603.t...................1062395
FJ410242.1 Dengue virus 1 isolate DENV-1/VN/BID-V1906/2008, complete genome 10603.t...................1062395
FJ410243.1 Dengue virus 1 isolate DENV-1/VN/BID-V1907/2008, complete genome 10603.c...................1062395
FJ410244.1 Dengue virus 1 isolate DENV-1/VN/BID-V1908/2008, complete genome 10603.t...................1062395
FJ410245.1 Dengue virus 1 isolate DENV-1/VN/BID-V1909/2008, complete genome 10603.t...................1062395
FJ410246.1 Dengue virus 1 isolate DENV-1/VN/BID-V1912/2008, complete genome 10603.t...................1062395
FJ410247.1 Dengue virus 1 isolate DENV-1/VN/BID-V1913/2008, complete genome 10603.t...................1062395
FJ410248.1 Dengue virus 1 isolate DENV-1/VN/BID-V1914/2008, complete genome 10603.t...................1062395
FJ410249.1 Dengue virus 1 isolate DENV-1/VN/BID-V1915/2008, complete genome 10603.t...................1062395
FJ410250.1 Dengue virus 1 isolate DENV-1/VN/BID-V1917/2007, complete genome 10603.t...................1062395
FJ410251.1 Dengue virus 1 isolate DENV-1/VN/BID-V1918/2008, complete genome 10603.t...................1062395
FJ410252.1 Dengue virus 1 isolate DENV-1/VN/BID-V1919/2007, complete genome 10603.t...................1062395
FJ410253.1 Dengue virus 1 isolate DENV-1/VN/BID-V1920/2007, complete genome 10603.t...................1062395
FJ410254.1 Dengue virus 1 isolate DENV-1/VN/BID-V1921/2008, complete genome 10603.t...................1062395
FJ410255.1 Dengue virus 1 isolate DENV-1/VN/BID-V1923/2008, complete genome 10603.t...................1062395
FJ410256.1 Dengue virus 1 isolate DENV-1/VN/BID-V1924/2008, complete genome 10603.t...................1062395
FJ410257.1 Dengue virus 1 isolate DENV-1/VN/BID-V1925/2008, complete genome 10603.t...................1062395
FJ410258.1 Dengue virus 1 isolate DENV-1/VN/BID-V1927/2008, complete genome 10603.t...................1062395
FJ410260.1 Dengue virus 1 isolate DENV-1/VN/BID-V1932/2008, complete genome 10603.t...................1062395
FJ410261.1 Dengue virus 1 isolate DENV-1/VN/BID-V1935/2008, complete genome 10603.t...................1062395
FJ410262.1 Dengue virus 1 isolate DENV-1/VN/BID-V1939/2008, complete genome 10603.t...................1062395
FJ410263.1 Dengue virus 1 isolate DENV-1/VN/BID-V1940/2008, complete genome 10599.t...................1061995
FJ410264.1 Dengue virus 1 isolate DENV-1/VN/BID-V1941/2008, complete genome 10598.t...................1061895
FJ410265.1 Dengue virus 1 isolate DENV-1/VN/BID-V1942/2008, complete genome 10603.t...................1062395
FJ410266.1 Dengue virus 1 isolate DENV-1/VN/BID-V1947/2008, complete genome 10603.t...................1062395
FJ410267.1 Dengue virus 1 isolate DENV-1/VN/BID-V1948/2008, complete genome 10603.t...................1062395
FJ410268.1 Dengue virus 1 isolate DENV-1/VN/BID-V1949/2008, complete genome 10603.t...................1062395
FJ410269.1 Dengue virus 1 isolate DENV-1/VN/BID-V1950/2008, complete genome 10603.t...................1062395
FJ410270.1 Dengue virus 1 isolate DENV-1/VN/BID-V1951/2008, complete genome 10601.t...................1062195
FJ410271.1 Dengue virus 1 isolate BID V1952, complete genome 10603.t...................1062395
FJ410272.1 Dengue virus 1 isolate DENV-1/VN/BID-V1954/2008, complete genome 10603.t...................1062395
FJ410273.1 Dengue virus 1 isolate DENV-1/VN/BID-V1955/2008, complete genome 10603.t...................1062395
FJ410274.1 Dengue virus 1 isolate DENV-1/VN/BID-V1956/2008, complete genome 10598.t...................1061895
FJ410275.1 Dengue virus 1 isolate DENV-1/VN/BID-V1958/2008, complete genome 10603.t...................1062395
FJ410276.1 Dengue virus 1 isolate DENV-1/VN/BID-V1960/2008, complete genome 10603.t...................1062395
FJ410277.1 Dengue virus 1 isolate DENV-1/VN/BID-V1961/2008, complete genome 10603.t...................1062395
FJ410278.1 Dengue virus 1 isolate DENV-1/VN/BID-V1962/2008, complete genome 10603.t...................1062395
FJ410279.1 Dengue virus 1 isolate DENV-1/VN/BID-V1965/2008, complete genome 10603.t...................1062395
FJ410280.1 Dengue virus 1 isolate DENV-1/VN/BID-V1966/2008, complete genome 10603.t...................1062395
FJ410281.1 Dengue virus 1 isolate DENV-1/VN/BID-V1967/2008, complete genome 10603.t...................1062395
FJ410282.1 Dengue virus 1 isolate DENV-1/VN/BID-V1968/2008, complete genome 10603.t...................1062395
FJ410283.1 Dengue virus 1 isolate DENV-1/VN/BID-V1970/2008, complete genome 10603.t...................1062395
FJ410284.1 Dengue virus 1 isolate DENV-1/VN/BID-V1971/2008, complete genome 10603.t...................1062395
FJ410285.1 Dengue virus 1 isolate DENV-1/VN/BID-V1972/2008, complete genome 10603.t...................1062395
FJ410286.1 Dengue virus 1 isolate DENV-1/VN/BID-V1974/2008, complete genome 10603.t...................1062395
FJ410287.1 Dengue virus 1 isolate DENV-1/VN/BID-V1634/2006, complete genome 10603.t...................1062395
FJ410289.1 Dengue virus 1 isolate DENV-1/VN/BID-V1671/2007, complete genome 10603.t...................1062395
FJ410290.1 Dengue virus 1 isolate DENV-1/NI/BID-V621/2005, complete genome 10603.c...................1062395
FJ384655.1 Dengue virus 1 isolate DF01-HUB01021093, complete genome 10625.c...................1064595
FJ432719.1 Dengue virus 1 isolate DENV-1/VN/BID-V1636/2007, complete genome 10603.t...................1062395
FJ432720.1 Dengue virus 1 isolate DENV-1/NI/BID-V624/2005, complete genome 10603.c...................1062395
FJ432721.1 Dengue virus 1 isolate DENV-1/NI/BID-V540/2005, complete genome 10603.c...................1062395
FJ461303.1 Dengue virus 1 isolate DENV-1/VN/BID-V971/2007, complete genome 10606.t...................1062695
FJ478457.1 Dengue virus 1 isolate DENV-1/US/BID-V2138/1996, complete genome 10589.c...................1060995
FJ478458.1 Dengue virus 1 isolate DENV-1/US/BID-V2142/1987, complete genome 10593.c...................1061395
FJ547060.1 Dengue virus 1 isolate DENV-1/VN/BID-V1822/2007, complete genome 10603.t...................1062395
FJ547063.1 Dengue virus 1 isolate DENV-1/VN/BID-V1855/2007, complete genome 10587.t...................1060795
FJ547065.1 Dengue virus 1 isolate DENV-1/VN/BID-V1883/2007, complete genome 10587.t...................1060795
FJ547086.1 Dengue virus 1 isolate DENV-1/US/BID-V2130/1995, complete genome 10603.c...................1062395
FJ547087.1 Dengue virus 1 isolate DENV-1/US/BID-V2135/1992, complete genome 10603.c...................1062395
FJ562101.1 Dengue virus 1 isolate DENV-1/VN/BID-V1850/2007, complete genome 10603.t...................1062395
FJ562104.1 Dengue virus 1 isolate DENV-1/NI/BID-V2343/2006, complete genome 10603.c...................1062395
FJ562105.1 Dengue virus 1 isolate DENV-1/US/BID-V2096/1993, complete genome 10603.c...................1062395
FJ562106.1 Dengue virus 1 isolate DENV-1/US/BID-V2097/1986, complete genome 10603.c...................1062395
FJ547068.1 Dengue virus 1 isolate DENV-1/NI/BID-V2342/2006, complete genome 10603.c...................1062395
FJ547088.1 Dengue virus 1 isolate DENV-1/NI/BID-V2330/2008, complete genome 10603.c...................1062395
FJ547089.1 Dengue virus 1 isolate DENV-1/NI/BID-V630/2005, complete genome 10603.c...................1062395
FJ639740.1 Dengue virus 1 isolate DENV-1/VE/BID-V2168/1998, complete genome 10603.c...................1062395
FJ639741.1 Dengue virus 1 isolate DENV-1/VE/BID-V2169/1998, complete genome 10603.c...................1062395
FJ639743.1 Dengue virus 1 isolate DENV-1/VE/BID-V2171/1999, complete genome 10587.c...................1060795
FJ639794.1 Dengue virus 1 isolate DENV-1/VE/BID-V2227/2004, complete genome 10604.c...................1062495
FJ639796.1 Dengue virus 1 isolate DENV-1/VE/BID-V2229/2004, complete genome 10604.c...................1062495
FJ639797.1 Dengue virus 1 isolate DENV-1/VE/BID-V2230/2004, complete genome 10604.c...................1062495
FJ639802.1 Dengue virus 1 isolate DENV-1/VE/BID-V2235/2004, complete genome 10604.c...................1062495
FJ639806.1 Dengue virus 1 isolate DENV-1/VE/BID-V2243/2007, complete genome 10604.c...................1062495
FJ639808.1 Dengue virus 1 isolate DENV-1/VE/BID-V2245/2005, complete genome 10604.c...................1062495
FJ639811.1 Dengue virus 1 isolate DENV-1/VE/BID-V2248/2005, complete genome 10603.c...................1062395
FJ639813.1 Dengue virus 1 isolate DENV-1/VE/BID-V2251/2005, complete genome 10604.c...................1062495
FJ639814.1 Dengue virus 1 isolate DENV-1/VE/BID-V2254/2005, complete genome 10603.c...................1062395
FJ639815.1 Dengue virus 1 isolate DENV-1/VE/BID-V2255/2006, complete genome 10603.c...................1062395
FJ639818.1 Dengue virus 1 isolate DENV-1/VE/BID-V2258/2006, complete genome 10603.c...................1062395
FJ639821.1 Dengue virus 1 isolate DENV-1/VE/BID-V2261/2006, complete genome 10603.c...................1062395
FJ639823.1 Dengue virus 1 isolate DENV-1/VE/BID-V2263/2006, complete genome 10603.c...................1062395
FJ639824.1 Dengue virus 1 isolate DENV-1/VE/BID-V2264/2006, complete genome 10604.c...................1062495
FJ432723.1 Dengue virus 1 isolate DENV-1/VN/BID-V1771/2007, complete genome 10603.t...................1062395
FJ432727.1 Dengue virus 1 isolate DENV-1/VN/BID-V1782/2007, complete genome 10603.t...................1062395
FJ432730.1 Dengue virus 1 isolate DENV-1/VN/BID-V1785/2007, complete genome 10603.t...................1062395
FJ432732.1 Dengue virus 1 isolate DENV-1/VN/BID-V1787/2007, complete genome 10603.t...................1062395
FJ432734.1 Dengue virus 1 isolate DENV-1/VN/BID-V1792/2007, complete genome 10602.t...................1062295
FJ432735.1 Dengue virus 1 isolate DENV-1/VN/BID-V1793/2007, complete genome 10603.t...................1062395
FJ432736.1 Dengue virus 1 isolate DENV-1/VN/BID-V1795/2007, complete genome 10603.t...................1062395
FJ432737.1 Dengue virus 1 isolate DENV-1/VN/BID-V1798/2007, complete genome 10603.t...................1062395
FJ432738.1 Dengue virus 1 isolate DENV-1/VN/BID-V1800/2007, complete genome 10602.t...................1062295
FJ432739.1 Dengue virus 1 isolate DENV-1/VN/BID-V1802/2007, complete genome 10603.t...................1062395
FJ432740.1 Dengue virus 1 isolate DENV-1/VN/BID-V1805/2007, complete genome 10595.t...................1061595
FJ432742.1 Dengue virus 1 isolate DENV-1/VN/BID-V1811/2007, complete genome 10586.t...................1060695
FJ432744.1 Dengue virus 1 isolate DENV-1/VN/BID-V1820/2007, complete genome 10603.t...................1062395
FJ432745.1 Dengue virus 1 isolate DENV-1/VN/BID-V1823/2007, complete genome 10593.t...................1061395
FJ432746.1 Dengue virus 1 isolate DENV-1/VN/BID-V1827/2007, complete genome 10597.t...................1061795
FJ432747.1 Dengue virus 1 isolate DENV-1/VN/BID-V1832/2007, complete genome 10603.t...................1062395
FJ432748.1 Dengue virus 1 isolate DENV-1/VN/BID-V1834/2007, complete genome 10594.t...................1061495
FJ432749.1 Dengue virus 1 isolate DENV-1/VN/BID-V1836/2007, complete genome 10603.t...................1062395
FJ461306.1 Dengue virus 1 isolate DENV-1/VN/BID-V1838/2007, complete genome 10603.t...................1062395
FJ461307.1 Dengue virus 1 isolate DENV-1/VN/BID-V1840/2008, complete genome 10602.t...................1062295
FJ461308.1 Dengue virus 1 isolate DENV-1/VN/BID-V1842/2008, complete genome 10587.t...................1060795
FJ461310.1 Dengue virus 1 isolate DENV-1/VN/BID-V1846/2008, complete genome 10589.t...................1060995
FJ461312.1 Dengue virus 1 isolate DENV-1/VN/BID-V1851/2007, complete genome 10603.t...................1062395
FJ461313.1 Dengue virus 1 isolate DENV-1/VN/BID-V1854/2007, complete genome 10603.t...................1062395
FJ461315.1 Dengue virus 1 isolate DENV-1/VN/BID-V1859/2007, complete genome 10603.t...................1062395
FJ461316.1 Dengue virus 1 isolate DENV-1/VN/BID-V1860/2007, complete genome 10603.t...................1062395
FJ461317.1 Dengue virus 1 isolate DENV-1/VN/BID-V1861/2007, complete genome 10603.t...................1062395
FJ461318.1 Dengue virus 1 isolate DENV-1/VN/BID-V1867/2007, complete genome 10603.t...................1062395
FJ461319.1 Dengue virus 1 isolate DENV-1/VN/BID-V1870/2007, complete genome 10603.t...................1062395
FJ461323.1 Dengue virus 1 isolate DENV-1/VN/BID-V1887/2007, complete genome 10589.t...................1060995
FJ461324.1 Dengue virus 1 isolate DENV-1/VN/BID-V1888/2007, complete genome 10603.t...................1062395
FJ461325.1 Dengue virus 1 isolate DENV-1/VN/BID-V1889/2007, complete genome 10590.t...................1061095
FJ461327.1 Dengue virus 1 isolate DENV-1/VN/BID-V1892/2007, complete genome 10589.t...................1060995
FJ461330.1 Dengue virus 1 isolate DENV-1/VN/BID-V1910/2008, complete genome 10603.t...................1062395
FJ461331.1 Dengue virus 1 isolate DENV-1/VN/BID-V1922/2008, complete genome 10603.t...................1062395
FJ461332.1 Dengue virus 1 isolate DENV-1/VN/BID-V1926/2008, complete genome 10603.t...................1062395
FJ461333.1 Dengue virus 1 isolate DENV-1/VN/BID-V1931/2007, complete genome 10603.t...................1062395
FJ461335.1 Dengue virus 1 isolate DENV-1/VN/BID-V1937/2008, complete genome 10603.t...................1062395
FJ461336.1 Dengue virus 1 isolate DENV-1/VN/BID-V1945/2008, complete genome 10603.t...................1062395
FJ461339.1 Dengue virus 1 isolate DENV-1/VN/BID-V1975/2008, complete genome 10603.t...................1062395
FJ461340.1 Dengue virus 1 isolate DENV-1/VN/BID-V1976/2008, complete genome 10603.t...................1062395
FJ461341.1 Dengue virus 1 isolate DENV-1/VN/BID-V1977/2008, complete genome 10603.t...................1062395
FJ639669.1 Dengue virus 1 isolate DENV-1/KH/BID-V1978/2000, complete genome 10603.t...................1062395
FJ639670.1 Dengue virus 1 isolate DENV-1/KH/BID-V1979/2001, complete genome 10606.t...................1062695
FJ639672.1 Dengue virus 1 isolate DENV-1/KH/BID-V1983/2001, complete genome 10595.t...................1061595
FJ639673.1 Dengue virus 1 isolate DENV-1/KH/BID-V1984/2001, complete genome 10603.t...................1062395
FJ639674.1 Dengue virus 1 isolate DENV-1/KH/BID-V1985/2002, complete genome 10586.t...................1060695
FJ639675.1 Dengue virus 1 isolate DENV-1/KH/BID-V1987/2003, complete genome 10603.t...................1062395
FJ639676.1 Dengue virus 1 isolate DENV-1/KH/BID-V1988/2003, complete genome 10603.t...................1062395
FJ639677.1 Dengue virus 1 isolate DENV-1/KH/BID-V1989/2003, complete genome 10603.t...................1062395
FJ639678.1 Dengue virus 1 isolate DENV-1/KH/BID-V1992/2003, complete genome 10603.t...................1062395
FJ639679.1 Dengue virus 1 isolate DENV-1/KH/BID-V1993/2003, complete genome 10603.t...................1062395
FJ639680.1 Dengue virus 1 isolate DENV-1/KH/BID-V1995/2003, complete genome 10603.t...................1062395
FJ639681.1 Dengue virus 1 isolate DENV-1/KH/BID-V1996/2003, complete genome 10591.t...................1061195
FJ639682.1 Dengue virus 1 isolate DENV-1/KH/BID-V1997/2004, complete genome 10603.t...................1062395
FJ639683.1 Dengue virus 1 isolate DENV-1/KH/BID-V1999/2005, complete genome 10587.t...................1060795
FJ639684.1 Dengue virus 1 isolate DENV-1/KH/BID-V2000/2005, complete genome 10589.t...................1060995
FJ639685.1 Dengue virus 1 isolate DENV-1/KH/BID-V2001/2005, complete genome 10603.t...................1062395
FJ639686.1 Dengue virus 1 isolate DENV-1/KH/BID-V2002/2006, complete genome 10603.t...................1062395
FJ639687.1 Dengue virus 1 isolate DENV-1/KH/BID-V2004/2006, complete genome 10603.t...................1062395
FJ639688.1 Dengue virus 1 isolate DENV-1/KH/BID-V2005/2007, complete genome 10603.t...................1062395
FJ639689.1 Dengue virus 1 isolate DENV-1/KH/BID-V2006/2007, complete genome 10603.t...................1062395
FJ639690.1 Dengue virus 1 isolate DENV-1/KH/BID-V2007/2007, complete genome 10603.t...................1062395
FJ639691.1 Dengue virus 1 isolate DENV-1/KH/BID-V2008/2007, complete genome 10603.t...................1062395
FJ639692.1 Dengue virus 1 isolate DENV-1/KH/BID-V2010/2007, complete genome 10603.t...................1062395
FJ639693.1 Dengue virus 1 isolate DENV-1/KH/BID-V2011/2007, complete genome 10603.t...................1062395
FJ639694.1 Dengue virus 1 isolate DENV-1/KH/BID-V2012/2007, complete genome 10603.t...................1062395
FJ639695.1 Dengue virus 1 isolate DENV-1/KH/BID-V2013/2007, complete genome 10603.t...................1062395
FJ639696.1 Dengue virus 1 isolate DENV-1/KH/BID-V2014/2007, complete genome 10603.t...................1062395
FJ687426.1 Dengue virus 1 isolate DENV-1/TH/BID-V2269/2001, complete genome 10589.t...................1060995
FJ687427.1 Dengue virus 1 isolate DENV-1/TH/BID-V2270/2001, complete genome 10585.t...................1060595
FJ687428.1 Dengue virus 1 isolate DENV-1/TH/BID-V2271/2001, complete genome 10590.t...................1061095
FJ687429.1 Dengue virus 1 isolate DENV-1/TH/BID-V2272/2001, complete genome 10589.t...................1060995
FJ687430.1 Dengue virus 1 isolate DENV-1/TH/BID-V2274/2001, complete genome 10589.t...................1060995
FJ687431.1 Dengue virus 1 isolate DENV-1/TH/BID-V2275/2001, complete genome 10589.t...................1060995
FJ687432.1 Dengue virus 1 isolate DENV-1/TH/BID-V2276/2001, complete genome 10603.t...................1062395
FJ687433.1 Dengue virus 1 isolate DENV-1/TH/BID-V2277/2001, complete genome 10586.t...................1060695
FJ744701.1 Dengue virus 1 isolate DENV-1/VE/BID-V2237/2004, complete genome 10604.c...................1062495
FJ744702.1 Dengue virus 1 isolate DENV-1/KH/BID-V2003/2006, complete genome 10603.t...................1062395
FJ467493.1 Dengue virus 2 isolate DKD811, complete genome 10609..t..................1062995
FJ810415.1 Dengue virus 1 isolate DENV-1/VE/BID-V2253/2005, complete genome 10604.c...................1062495
FJ810419.1 Dengue virus 1 isolate DENV-1/NI/BID-V2341/2006, complete genome 10603.c...................1062395
FJ850068.1 Dengue virus 1 isolate DENV-1/TH/BID-V2273/2001, complete genome 10589.t...................1060995
FJ850070.1 Dengue virus 1 isolate DENV-1/BR/BID-V2374/2000, complete genome 10590.c...................1061095
FJ850075.1 Dengue virus 1 isolate DENV-1/BR/BID-V2381/2002, complete genome 10603.c...................1062395
FJ850077.1 Dengue virus 1 isolate DENV-1/BR/BID-V2384/2003, complete genome 10603.c...................1062395
FJ850081.1 Dengue virus 1 isolate DENV-1/BR/BID-V2389/2004, complete genome 10603.c...................1062395
FJ850087.1 Dengue virus 1 isolate DENV-1/BR/BID-V2395/2006, complete genome 10603.c...................1062395
FJ850093.1 Dengue virus 1 isolate DENV-1/BR/BID-V2401/2008, complete genome 10603.c...................1062395
FJ850113.1 Dengue virus 1 isolate DENV-1/NI/BID-V536/2005, complete genome 10603.c...................1062395
FJ850114.1 Dengue virus 1 isolate DENV-1/NI/BID-V519/2005, complete genome 10603.c...................1062395
FJ850117.1 Dengue virus 2 isolate DENV-2/NI/BID-V2657/2000, complete genome 10592...g.................1061295
FJ850065.1 Dengue virus 2 isolate DENV-2/NI/BID-V2664/2000, complete genome 10592...g.................1061295
FJ850099.1 Dengue virus 1 isolate DENV-1/VE/BID-V2459/2007, complete genome 10604.c...................1062495
FJ850100.1 Dengue virus 1 isolate DENV-1/VE/BID-V2461/2007, complete genome 10603.c...................1062395
FJ850101.1 Dengue virus 1 isolate DENV-1/VE/BID-V2463/2007, complete genome 10603.c...................1062395
FJ850102.1 Dengue virus 1 isolate DENV-1/VE/BID-V2464/2007, complete genome 10603.c...................1062395
FJ850103.1 Dengue virus 1 isolate DENV-1/VE/BID-V2468/2008, complete genome 10591.c...................1061195
FJ850104.1 Dengue virus 1 isolate DENV-1/VE/BID-V2469/2008, complete genome 10603.c...................1062395
FJ461320.1 Dengue virus 1 isolate DENV-1/VN/BID-V1871/2007, complete genome 10603.t...................1062395
FJ461328.1 Dengue virus 1 isolate DENV-1/VN/BID-V1893/2007, complete genome 10603.t...................1062395
FJ859029.1 Dengue virus 1 isolate DENV-1/VN/BID-V1880/2007, complete genome 10589.t...................1060995
FJ873809.1 Dengue virus 1 isolate DENV-1/VE/BID-V2462/2007, complete genome 10603.c...................1062395
FJ873810.1 Dengue virus 1 isolate DENV-1/VE/BID-V2467/2007, complete genome 10603.c...................1062395
FJ873814.1 Dengue virus 1 isolate DENV-1/NI/BID-V667/2005, complete genome 10587.c...................1060795
FJ882515.1 Dengue virus 1 isolate DENV-1/VN/BID-V2684/2006, complete genome 10603.t...................1062395
FJ882516.1 Dengue virus 1 isolate DENV-1/VN/BID-V2685/2006, complete genome 10603.t...................1062395
FJ882517.1 Dengue virus 1 isolate DENV-1/VN/BID-V2686/2006, complete genome 10603.t...................1062395
FJ882518.1 Dengue virus 1 isolate DENV-1/VN/BID-V2691/2006, complete genome 10597.t...................1061795
FJ882519.1 Dengue virus 1 isolate DENV-1/VN/BID-V2693/2006, complete genome 10603.t...................1062395
FJ882520.1 Dengue virus 1 isolate DENV-1/VN/BID-V2694/2006, complete genome 10603.t...................1062395
FJ882521.1 Dengue virus 1 isolate DENV-1/VN/BID-V2695/2006, complete genome 10603.t...................1062395
FJ882522.1 Dengue virus 1 isolate DENV-1/VN/BID-V2696/2006, complete genome 10603.t...................1062395
FJ882523.1 Dengue virus 1 isolate DENV-1/VN/BID-V2697/2006, complete genome 10603.t...................1062395
FJ882524.1 Dengue virus 1 isolate DENV-1/VN/BID-V2698/2006, complete genome 10603.t...................1062395
FJ882525.1 Dengue virus 1 isolate DENV-1/VN/BID-V2699/2006, complete genome 10603.t...................1062395
FJ882526.1 Dengue virus 1 isolate DENV-1/VN/BID-V2700/2006, complete genome 10603.t...................1062395
FJ882527.1 Dengue virus 1 isolate DENV-1/VN/BID-V2701/2006, complete genome 10603.t...................1062395
FJ882528.1 Dengue virus 1 isolate DENV-1/VN/BID-V2702/2006, complete genome 10603.t...................1062395
FJ882529.1 Dengue virus 1 isolate DENV-1/VN/BID-V2703/2006, complete genome 10603.t...................1062395
FJ882530.1 Dengue virus 1 isolate DENV-1/VN/BID-V2704/2006, complete genome 10603.t...................1062395
FJ882531.1 Dengue virus 1 isolate DENV-1/VN/BID-V2705/2006, complete genome 10603.t...................1062395
FJ882532.1 Dengue virus 1 isolate DENV-1/VN/BID-V2706/2006, complete genome 10603.t...................1062395
FJ882533.1 Dengue virus 1 isolate DENV-1/VN/BID-V2708/2006, complete genome 10603.t...................1062395
FJ882534.1 Dengue virus 1 isolate DENV-1/VN/BID-V2709/2006, complete genome 10603.t...................1062395
FJ882535.1 Dengue virus 1 isolate DENV-1/VN/BID-V2710/2006, complete genome 10603.t...................1062395
FJ882536.1 Dengue virus 1 isolate DENV-1/VN/BID-V2711/2006, complete genome 10603.t...................1062395
FJ882537.1 Dengue virus 1 isolate DENV-1/VN/BID-V2712/2006, complete genome 10603.t...................1062395
FJ882538.1 Dengue virus 1 isolate DENV-1/VN/BID-V2714/2006, complete genome 10603.t...................1062395
FJ882539.1 Dengue virus 1 isolate DENV-1/VN/BID-V2715/2006, complete genome 10603.t...................1062395
FJ882540.1 Dengue virus 1 isolate DENV-1/VN/BID-V2716/2006, complete genome 10603.t...................1062395
FJ882541.1 Dengue virus 1 isolate DENV-1/VN/BID-V2717/2006, complete genome 10603.t...................1062395
FJ882542.1 Dengue virus 1 isolate DENV-1/VN/BID-V2719/2006, complete genome 10597.t...................1061795
FJ882543.1 Dengue virus 1 isolate DENV-1/VN/BID-V2720/2006, complete genome 10603.t...................1062395
FJ882544.1 Dengue virus 1 isolate DENV-1/VN/BID-V2721/2006, complete genome 10586.t...................1060695
FJ882545.1 Dengue virus 1 isolate DENV-1/VN/BID-V2723/2007, complete genome 10603.t...................1062395
FJ882546.1 Dengue virus 1 isolate DENV-1/VN/BID-V2749/2007, complete genome 10600.t...................1062095
FJ882547.1 Dengue virus 1 isolate DENV-1/VN/BID-V2772/2007, complete genome 10583.t...................1060395
FJ882548.1 Dengue virus 1 isolate DENV-1/VN/BID-V2778/2007, complete genome 10603.t...................1062395
FJ882549.1 Dengue virus 1 isolate DENV-1/VN/BID-V2794/2007, complete genome 10593.t...................1061395
FJ882550.1 Dengue virus 1 isolate DENV-1/VN/BID-V2800/2007, complete genome 10603.t...................1062395
FJ882551.1 Dengue virus 1 isolate DENV-1/VN/BID-V2801/2007, complete genome 10603.t...................1062395
FJ882552.1 Dengue virus 1 isolate DENV-1/VN/BID-V2803/2007, complete genome 10603.t...................1062395
FJ882553.1 Dengue virus 1 isolate DENV-1/VN/BID-V2804/2007, complete genome 10593.t...................1061395
FJ882554.1 Dengue virus 1 isolate DENV-1/VN/BID-V2805/2007, complete genome 10589.t...................1060995
FJ882555.1 Dengue virus 1 isolate DENV-1/VN/BID-V2809/2007, complete genome 10591.t...................1061195
FJ882556.1 Dengue virus 1 isolate DENV-1/VN/BID-V2811/2007, complete genome 10603.t...................1062395
FJ882557.1 Dengue virus 1 isolate DENV-1/VN/BID-V2813/2007, complete genome 10601.t...................1062195
FJ882558.1 Dengue virus 1 isolate DENV-1/VN/BID-V2814/2007, complete genome 10603.t...................1062395
FJ882559.1 Dengue virus 1 isolate DENV-1/VN/BID-V2818/2007, complete genome 10603.t...................1062395
FJ882560.1 Dengue virus 1 isolate DENV-1/VN/BID-V2819/2007, complete genome 10603.t...................1062395
FJ882561.1 Dengue virus 1 isolate DENV-1/VN/BID-V2823/2007, complete genome 10589.t...................1060995
FJ882562.1 Dengue virus 1 isolate DENV-1/VN/BID-V2825/2003, complete genome 10589.t...................1060995
FJ882563.1 Dengue virus 1 isolate DENV-1/VN/BID-V2826/2003, complete genome 10587.t...................1060795
FJ882564.1 Dengue virus 1 isolate DENV-1/VN/BID-V2827/2003, complete genome 10597.t...................1061795
FJ882565.1 Dengue virus 1 isolate DENV-1/VN/BID-V2829/2003, complete genome 10589.t...................1060995
FJ882566.1 Dengue virus 1 isolate DENV-1/VN/BID-V2831/2003, complete genome 10603.t...................1062395
FJ882567.1 Dengue virus 1 isolate DENV-1/VN/BID-V2832/2003, complete genome 10603.t...................1062395
FJ882568.1 Dengue virus 1 isolate DENV-1/VN/BID-V2835/2003, complete genome 10603.t...................1062395
FJ882569.1 Dengue virus 1 isolate DENV-1/VN/BID-V2836/2004, complete genome 10603.t...................1062395
FJ882570.1 Dengue virus 1 isolate DENV-1/VN/BID-V2838/2005, complete genome 10603.t...................1062395
FJ882579.1 Dengue virus 1 isolate DENV-1/VE/BID-V2465/2007, complete genome 10587.c...................1060795
FJ898372.1 Dengue virus 1 isolate DENV-1/VN/BID-V2724/2007, complete genome 10603.t...................1062395
FJ898373.1 Dengue virus 1 isolate DENV-1/VN/BID-V2725/2007, complete genome 10593.t...................1061395
FJ898374.1 Dengue virus 1 isolate DENV-1/VN/BID-V2726/2007, complete genome 10587.t...................1060795
FJ898375.1 Dengue virus 1 isolate DENV-1/VN/BID-V2727/2007, complete genome 10603.c...................1062395
FJ898377.1 Dengue virus 1 isolate DENV-1/VN/BID-V2729/2007, complete genome 10603.t...................1062395
FJ898378.1 Dengue virus 1 isolate DENV-1/VN/BID-V2730/2007, complete genome 10590.t...................1061095
FJ898379.1 Dengue virus 1 isolate DENV-1/VN/BID-V2731/2007, complete genome 10587.t...................1060795
FJ898380.1 Dengue virus 1 isolate DENV-1/VN/BID-V2738/2007, complete genome 10589.t...................1060995
FJ898381.1 Dengue virus 1 isolate DENV-1/VN/BID-V2739/2007, complete genome 10593.t...................1061395
FJ898382.1 Dengue virus 1 isolate DENV-1/VN/BID-V2740/2007, complete genome 10603.t...................1062395
FJ898383.1 Dengue virus 1 isolate DENV-1/VN/BID-V2741/2007, complete genome 10603.t...................1062395
FJ898384.1 Dengue virus 1 isolate DENV-1/VN/BID-V2742/2007, complete genome 10603.t...................1062395
FJ898385.1 Dengue virus 1 isolate DENV-1/VN/BID-V2743/2007, complete genome 10603.t...................1062395
FJ898386.1 Dengue virus 1 isolate DENV-1/VN/BID-V2842/2005, complete genome 10603.t...................1062395
FJ898387.1 Dengue virus 1 isolate DENV-1/VN/BID-V2847/2005, complete genome 10589.t...................1060995
FJ898388.1 Dengue virus 1 isolate DENV-1/VN/BID-V2848/2005, complete genome 10603.t...................1062395
FJ898389.1 Dengue virus 1 isolate DENV-1/VN/BID-V2850/2005, complete genome 10603.t...................1062395
FJ898390.1 Dengue virus 1 isolate DENV-1/VN/BID-V2851/2005, complete genome 10589.t...................1060995
FJ898391.1 Dengue virus 1 isolate DENV-1/VN/BID-V2852/2005, complete genome 10603.t...................1062395
FJ898392.1 Dengue virus 1 isolate DENV-1/VN/BID-V2853/2005, complete genome 10603.t...................1062395
FJ898393.1 Dengue virus 1 isolate DENV-1/VN/BID-V2854/2005, complete genome 10600.t...................1062095
FJ898394.1 Dengue virus 1 isolate DENV-1/VN/BID-V2855/2005, complete genome 10590.t...................1061095
FJ898395.1 Dengue virus 1 isolate DENV-1/VN/BID-V2856/2005, complete genome 10594.t...................1061495
FJ898396.1 Dengue virus 1 isolate DENV-1/VN/BID-V2858/2006, complete genome 10602.t...................1062295
FJ898397.1 Dengue virus 1 isolate DENV-1/VN/BID-V2860/2006, complete genome 10593.t...................1061395
FJ898398.1 Dengue virus 1 isolate DENV-1/VN/BID-V2861/2006, complete genome 10603.t...................1062395
FJ898399.1 Dengue virus 1 isolate DENV-1/VN/BID-V2862/2006, complete genome 10603.t...................1062395
FJ898400.1 Dengue virus 1 isolate DENV-1/VN/BID-V2863/2006, complete genome 10603.t...................1062395
FJ898401.1 Dengue virus 1 isolate DENV-1/VN/BID-V2864/2006, complete genome 10603.t...................1062395
FJ898402.1 Dengue virus 1 isolate DENV-1/VN/BID-V2865/2006, complete genome 10603.t...................1062395
FJ898403.1 Dengue virus 1 isolate DENV-1/VN/BID-V2867/2006, complete genome 10603.t...................1062395
FJ898404.1 Dengue virus 1 isolate DENV-1/VN/BID-V2868/2006, complete genome 10602.t...................1062295
FJ898405.1 Dengue virus 1 isolate DENV-1/VN/BID-V2871/2006, complete genome 10592.t...................1061295
FJ898406.1 Dengue virus 1 isolate DENV-1/VN/BID-V2873/2006, complete genome 10603.t...................1062395
FJ898407.1 Dengue virus 1 isolate DENV-1/VN/BID-V2876/2006, complete genome 10585.t...................1060595
FJ898408.1 Dengue virus 1 isolate DENV-1/VN/BID-V2877/2006, complete genome 10603.t...................1062395
FJ898409.1 Dengue virus 1 isolate DENV-1/VN/BID-V2879/2006, complete genome 10602.t...................1062295
FJ898410.1 Dengue virus 1 isolate DENV-1/VN/BID-V2888/2006, complete genome 10603.t...................1062395
FJ898411.1 Dengue virus 1 isolate DENV-1/VN/BID-V2891/2006, complete genome 10603.t...................1062395
FJ898412.1 Dengue virus 1 isolate DENV-1/VN/BID-V2892/2006, complete genome 10585.t...................1060595
FJ898413.1 Dengue virus 1 isolate DENV-1/VN/BID-V2894/2006, complete genome 10603.t...................1062395
FJ898414.1 Dengue virus 1 isolate DENV-1/VN/BID-V2895/2006, complete genome 10592.t...................1061295
FJ898415.1 Dengue virus 1 isolate DENV-1/VN/BID-V2896/2006, complete genome 10587.t...................1060795
FJ898416.1 Dengue virus 1 isolate DENV-1/VN/BID-V2899/2006, complete genome 10602.t...................1062295
FJ898417.1 Dengue virus 1 isolate DENV-1/VN/BID-V2900/2006, complete genome 10603.t...................1062395
FJ898418.1 Dengue virus 1 isolate DENV-1/VN/BID-V2903/2006, complete genome 10596.t...................1061695
FJ898419.1 Dengue virus 1 isolate DENV-1/VN/BID-V2904/2006, complete genome 10589.t...................1060995
FJ898420.1 Dengue virus 1 isolate DENV-1/VN/BID-V2905/2006, complete genome 10589.t...................1060995
FJ898421.1 Dengue virus 1 isolate DENV-1/VN/BID-V2906/2006, complete genome 10603.t...................1062395
FJ898422.1 Dengue virus 1 isolate DENV-1/VN/BID-V2907/2006, complete genome 10603.t...................1062395
FJ898423.1 Dengue virus 1 isolate DENV-1/VN/BID-V2908/2006, complete genome 10592.t...................1061295
FJ898424.1 Dengue virus 1 isolate DENV-1/VN/BID-V2910/2006, complete genome 10603.t...................1062395
FJ898425.1 Dengue virus 1 isolate DENV-1/VN/BID-V2911/2006, complete genome 10604.t...................1062495
FJ898426.1 Dengue virus 1 isolate DENV-1/VN/BID-V2912/2006, complete genome 10603.t...................1062395
FJ898427.1 Dengue virus 1 isolate DENV-1/VN/BID-V2914/2006, complete genome 10602.t...................1062295
FJ898428.1 Dengue virus 1 isolate DENV-1/VN/BID-V2915/2006, complete genome 10604.t...................1062495
FJ898429.1 Dengue virus 1 isolate DENV-1/VN/BID-V2916/2006, complete genome 10603.t...................1062395
FJ898430.1 Dengue virus 1 isolate DENV-1/VN/BID-V2917/2006, complete genome 10586.t...................1060695
FJ898431.1 Dengue virus 1 isolate DENV-1/VN/BID-V2919/2006, complete genome 10603.t...................1062395
FJ898433.1 Dengue virus 1 isolate DENV-1/NI/BID-V1223/2007, complete genome 10603.c...................1062395
FJ898437.1 Dengue virus 1 isolate DENV-1/NI/BID-V656/2004, complete genome 10591.c...................1061195
FJ898448.1 Dengue virus 1 isolate DENV-1/PF/BID-V2939/2001, complete genome 10589.t...................1060995
FJ906963.1 Dengue virus 1 isolate DENV-1/VN/BID-V2735/2007, complete genome 10588.t...................1060895
FJ906964.1 Dengue virus 1 isolate DENV-1/VN/BID-V2736/2007, complete genome 10585.t...................1060595
FJ906965.1 Dengue virus 1 isolate DENV-1/VN/BID-V2737/2007, complete genome 10589.t...................1060995
FJ906728.1 Dengue virus 1 isolate DENV-1/VN/BID-V1852/2007, complete genome 10589.t...................1060995
GQ199771.1 Dengue virus 1 isolate DENV-1/VN/BID-V2687/2006, complete genome 10603.t...................1062395
GQ199772.1 Dengue virus 1 isolate DENV-1/VN/BID-V2718/2006, complete genome 10603.t...................1062395
GQ199773.1 Dengue virus 1 isolate DENV-1/VN/BID-V2732/2007, complete genome 10589.t...................1060995
GQ199774.1 Dengue virus 1 isolate DENV-1/VN/BID-V2746/2007, complete genome 10603.t...................1062395
GQ199775.1 Dengue virus 1 isolate DENV-1/VN/BID-V2747/2007, complete genome 10603.t...................1062395
GQ199776.1 Dengue virus 1 isolate DENV-1/VN/BID-V2751/2007, complete genome 10589.t...................1060995
GQ199777.1 Dengue virus 1 isolate DENV-1/VN/BID-V2752/2007, complete genome 10603.t...................1062395
GQ199778.1 Dengue virus 1 isolate DENV-1/VN/BID-V2754/2007, complete genome 10603.t...................1062395
GQ199779.1 Dengue virus 1 isolate DENV-1/VN/BID-V2755/2007, complete genome 10603.t...................1062395
GQ199780.1 Dengue virus 1 isolate DENV-1/VN/BID-V2756/2007, complete genome 10603.t...................1062395
GQ199781.1 Dengue virus 1 isolate DENV-1/VN/BID-V2757/2007, complete genome 10603.t...................1062395
GQ199782.1 Dengue virus 1 isolate DENV-1/VN/BID-V2758/2007, complete genome 10603.t...................1062395
GQ199783.1 Dengue virus 1 isolate DENV-1/VN/BID-V2759/2007, complete genome 10603.t...................1062395
GQ199785.1 Dengue virus 1 isolate DENV-1/VN/BID-V2761/2007, complete genome 10603.t...................1062395
GQ199786.1 Dengue virus 1 isolate DENV-1/VN/BID-V2762/2007, complete genome 10603.t...................1062395
GQ199787.1 Dengue virus 1 isolate DENV-1/VN/BID-V2763/2007, complete genome 10603.t...................1062395
GQ199788.1 Dengue virus 1 isolate DENV-1/VN/BID-V2764/2007, complete genome 10603.t...................1062395
GQ199789.1 Dengue virus 1 isolate DENV-1/VN/BID-V2765/2007, complete genome 10603.t...................1062395
GQ199791.1 Dengue virus 1 isolate DENV-1/VN/BID-V2767/2007, complete genome 10603.t...................1062395
GQ199792.1 Dengue virus 1 isolate DENV-1/VN/BID-V2768/2007, complete genome 10603.t...................1062395
GQ199793.1 Dengue virus 1 isolate DENV-1/VN/BID-V2769/2007, complete genome 10603.t...................1062395
GQ199794.1 Dengue virus 1 isolate DENV-1/VN/BID-V2770/2007, complete genome 10603.t...................1062395
GQ199795.1 Dengue virus 1 isolate DENV-1/VN/BID-V2771/2007, complete genome 10603.t...................1062395
GQ199796.1 Dengue virus 1 isolate DENV-1/VN/BID-V2773/2007, complete genome 10603.t...................1062395
GQ199797.1 Dengue virus 1 isolate DENV-1/VN/BID-V2774/2007, complete genome 10603.t...................1062395
GQ199798.1 Dengue virus 1 isolate DENV-1/VN/BID-V2775/2007, complete genome 10603.t...................1062395
GQ199799.1 Dengue virus 1 isolate DENV-1/VN/BID-V2776/2007, complete genome 10603.t...................1062395
GQ199800.1 Dengue virus 1 isolate DENV-1/VN/BID-V2777/2007, complete genome 10603.t...................1062395
GQ199801.1 Dengue virus 1 isolate DENV-1/VN/BID-V2779/2007, complete genome 10603.t...................1062395
GQ199802.1 Dengue virus 1 isolate DENV-1/VN/BID-V2780/2007, complete genome 10603.t...................1062395
GQ199803.1 Dengue virus 1 isolate DENV-1/VN/BID-V2783/2007, complete genome 10603.t...................1062395
GQ199804.1 Dengue virus 1 isolate DENV-1/VN/BID-V2784/2007, complete genome 10592.t...................1061295
GQ199806.1 Dengue virus 1 isolate DENV-1/VN/BID-V2786/2007, complete genome 10602.t...................1062295
GQ199807.1 Dengue virus 1 isolate DENV-1/VN/BID-V2787/2007, complete genome 10603.t...................1062395
GQ199808.1 Dengue virus 1 isolate DENV-1/VN/BID-V2788/2007, complete genome 10603.t...................1062395
GQ199809.1 Dengue virus 1 isolate DENV-1/VN/BID-V2789/2007, complete genome 10603.t...................1062395
GQ199810.1 Dengue virus 1 isolate DENV-1/VN/BID-V2790/2007, complete genome 10603.t...................1062395
GQ199811.1 Dengue virus 1 isolate DENV-1/VN/BID-V2791/2007, complete genome 10603.t...................1062395
GQ199812.1 Dengue virus 1 isolate DENV-1/VN/BID-V2792/2007, complete genome 10603.t...................1062395
GQ199813.1 Dengue virus 1 isolate DENV-1/VN/BID-V2793/2007, complete genome 10603.t...................1062395
GQ199814.1 Dengue virus 1 isolate DENV-1/VN/BID-V2795/2007, complete genome 10603.t...................1062395
GQ199815.1 Dengue virus 1 isolate DENV-1/VN/BID-V2796/2007, complete genome 10603.t...................1062395
GQ199816.1 Dengue virus 1 isolate DENV-1/VN/BID-V2797/2007, complete genome 10603.t...................1062395
GQ199817.1 Dengue virus 1 isolate DENV-1/VN/BID-V2798/2007, complete genome 10603.t...................1062395
GQ199818.1 Dengue virus 1 isolate DENV-1/VN/BID-V2799/2007, complete genome 10603.t...................1062395
GQ199819.1 Dengue virus 1 isolate DENV-1/VN/BID-V2802/2007, complete genome 10603.t...................1062395
GQ199820.1 Dengue virus 1 isolate DENV-1/VN/BID-V2808/2007, complete genome 10603.t...................1062395
GQ199821.1 Dengue virus 1 isolate DENV-1/VN/BID-V2810/2007, complete genome 10603.t...................1062395
GQ199822.1 Dengue virus 1 isolate DENV-1/VN/BID-V2812/2007, complete genome 10603.t...................1062395
GQ199823.1 Dengue virus 1 isolate DENV-1/VN/BID-V2815/2007, complete genome 10588.t...................1060895
GQ199824.1 Dengue virus 1 isolate DENV-1/VN/BID-V2816/2007, complete genome 10603.t...................1062395
GQ199825.1 Dengue virus 1 isolate DENV-1/VN/BID-V2817/2007, complete genome 10603.t...................1062395
GQ199826.1 Dengue virus 1 isolate DENV-1/VN/BID-V2820/2007, complete genome 10603.t...................1062395
GQ199827.1 Dengue virus 1 isolate DENV-1/VN/BID-V2821/2007, complete genome 10589.t...................1060995
GQ199828.1 Dengue virus 1 isolate DENV-1/VN/BID-V2822/2007, complete genome 10603.t...................1062395
GQ199829.1 Dengue virus 1 isolate DENV-1/VN/BID-V2824/2007, complete genome 10603.t...................1062395
GQ199830.1 Dengue virus 1 isolate DENV-1/VN/BID-V2830/2003, complete genome 10603.t...................1062395
GQ199831.1 Dengue virus 1 isolate DENV-1/VN/BID-V2833/2003, complete genome 10603.t...................1062395
GQ199832.1 Dengue virus 1 isolate DENV-1/VN/BID-V2834/2003, complete genome 10603.t...................1062395
GQ199833.1 Dengue virus 1 isolate DENV-1/VN/BID-V2837/2004, complete genome 10603.t...................1062395
GQ199834.1 Dengue virus 1 isolate DENV-1/VN/BID-V2839/2005, complete genome 10590.t...................1061095
GQ199835.1 Dengue virus 1 isolate DENV-1/VN/BID-V2840/2005, complete genome 10603.t...................1062395
GQ199836.1 Dengue virus 1 isolate DENV-1/VN/BID-V2845/2005, complete genome 10603.t...................1062395
GQ199837.1 Dengue virus 1 isolate DENV-1/VN/BID-V2846/2005, complete genome 10603.t...................1062395
GQ199838.1 Dengue virus 1 isolate DENV-1/VN/BID-V2857/2005, complete genome 10603.t...................1062395
GQ199839.1 Dengue virus 1 isolate DENV-1/VN/BID-V2859/2006, complete genome 10603.t...................1062395
GQ199840.1 Dengue virus 1 isolate DENV-1/VN/BID-V2870/2006, complete genome 10603.t...................1062395
GQ199841.1 Dengue virus 1 isolate DENV-1/VN/BID-V2874/2006, complete genome 10603.t...................1062395
GQ199842.1 Dengue virus 1 isolate DENV-1/VN/BID-V2875/2006, complete genome 10603.t...................1062395
GQ199843.1 Dengue virus 1 isolate DENV-1/VN/BID-V2878/2006, complete genome 10603.t...................1062395
GQ199844.1 Dengue virus 1 isolate DENV-1/VN/BID-V2880/2006, complete genome 10603.t...................1062395
GQ199845.1 Dengue virus 1 isolate DENV-1/VN/BID-V2881/2006, complete genome 10603.t...................1062395
GQ199846.1 Dengue virus 1 isolate DENV-1/VN/BID-V2883/2006, complete genome 10603.t...................1062395
GQ199847.1 Dengue virus 1 isolate DENV-1/VN/BID-V2884/2006, complete genome 10603.t...................1062395
GQ199848.1 Dengue virus 1 isolate DENV-1/VN/BID-V2885/2006, complete genome 10603.t...................1062395
GQ199849.1 Dengue virus 1 isolate DENV-1/VN/BID-V2886/2006, complete genome 10586.t...................1060695
GQ199850.1 Dengue virus 1 isolate DENV-1/VN/BID-V2887/2006, complete genome 10602.t...................1062295
GQ199851.1 Dengue virus 1 isolate DENV-1/VN/BID-V2890/2006, complete genome 10603.t...................1062395
GQ199852.1 Dengue virus 1 isolate DENV-1/VN/BID-V2893/2006, complete genome 10602.t...................1062295
GQ199853.1 Dengue virus 1 isolate DENV-1/VN/BID-V2897/2006, complete genome 10603.t...................1062395
GQ199854.1 Dengue virus 1 isolate DENV-1/VN/BID-V2898/2006, complete genome 10603.t...................1062395
GQ199855.1 Dengue virus 1 isolate DENV-1/VN/BID-V2902/2006, complete genome 10603.t...................1062395
GQ199856.1 Dengue virus 1 isolate DENV-1/VN/BID-V2913/2006, complete genome 10603.t...................1062395
GQ199857.1 Dengue virus 1 isolate DENV-1/NI/BID-V2645/2008, complete genome 10603.c...................1062395
GQ199858.1 Dengue virus 1 isolate DENV-1/NI/BID-V2646/2008, complete genome 10603.c...................1062395
GQ199859.1 Dengue virus 1 isolate DENV-1/NI/BID-V2652/2008, complete genome 10603.c...................1062395
GQ199867.1 Dengue virus 1 isolate DENV-1/NI/BID-V2642/2004, complete genome 10603.c...................1062395
GQ199872.1 Dengue virus 1 isolate DENV-1/NI/BID-V617/2004, complete genome 10603.c...................1062395
GQ199873.1 Dengue virus 1 isolate DENV-1/NI/BID-V664/2004, complete genome 10603.c...................1062395
GQ199875.1 Dengue virus 1 isolate DENV-1/NI/BID-V669/2004, complete genome 10603.c...................1062395
GQ199877.1 Dengue virus 1 isolate DENV-1/VE/BID-V2615/2007, complete genome 10603.c...................1062395
FN429881.1 Dengue virus type 1, isolate D1MY95-3891, genomic RNA, complete genom10625.t...................1064595
FN429882.1 Dengue virus type 1, isolate D1MY95-3928, genomic RNA, complete genom10625.t...................1064595
FN429883.1 Dengue virus type 1, isolate D1MY96-7814, genomic RNA, complete genom10625.t...................1064595
FN429884.1 Dengue virus type 1, isolate D1MY96-7891, genomic RNA, complete genom10625.t...................1064595
FN429886.1 Dengue virus type 1, isolate D1MY96-8064, genomic RNA, complete genom10625.t...................1064595
FN429887.1 Dengue virus type 1, isolate D1MY96-8080, genomic RNA, complete genom10625.t...................1064595
FN429888.1 Dengue virus type 1, isolate D1MY96-8081, genomic RNA, complete genom10625.t...................1064595
FN429889.1 Dengue virus type 1, isolate D1MY97-10245, genomic RNA, complete geno10625.t...................1064595
FN429890.1 Dengue virus type 1, isolate D1MY05-33915, genomic RNA, complete geno10625.t...................1064595
AB519681.1 Dengue virus 1 genomic RNA, complete genome, isolate: SB 01057805 (DF10625.c...................1064595
GQ868542.1 Dengue virus 2 isolate DENV-2/TH/BID-V3498/1994, complete genome 10591..g..................1061195
GQ868551.1 Dengue virus 2 isolate DENV-2/BR/BID-V3486/2008, complete genome 10591....t................1061195
GQ868601.1 Dengue virus 1 isolate DENV-1/VG/BID-V2937/1985, complete genome 10603.c...................1062395
GQ868602.1 Dengue virus 1 isolate DENV-1/PH/BID-V2940/2004, complete genome 10590.c...................1061095
GQ868605.1 Dengue virus 1 isolate DENV-1/VN/BID-V2707/2006, complete genome 10603.t...................1062395
GQ868606.1 Dengue virus 1 isolate DENV-1/VN/BID-V2713/2006, complete genome 10603.t...................1062395
GQ868607.1 Dengue virus 1 isolate DENV-1/VN/BID-V2733/2007, complete genome 10603.t...................1062395
GQ868608.1 Dengue virus 1 isolate DENV-1/VN/BID-V2745/2007, complete genome 10603.c...................1062395
GQ868609.1 Dengue virus 1 isolate DENV-1/VN/BID-V2782/2007, complete genome 10603.t...................1062395
GQ868610.1 Dengue virus 1 isolate DENV-1/VN/BID-V2806/2007, complete genome 10603.t...................1062395
GQ868611.1 Dengue virus 1 isolate DENV-1/VN/BID-V2807/2007, complete genome 10603.t...................1062395
GQ868612.1 Dengue virus 1 isolate DENV-1/VN/BID-V2901/2006, complete genome 10603.t...................1062395
GQ868613.1 Dengue virus 1 isolate DENV-1/VN/BID-V2909/2006, complete genome 10592.t...................1061295
GQ868614.1 Dengue virus 1 isolate DENV-1/VN/BID-V3849/2008, complete genome 10603.t...................1062395
GQ868615.1 Dengue virus 1 isolate DENV-1/VN/BID-V3975/2008, complete genome 10603.t...................1062395
GQ868618.1 Dengue virus 1 isolate DENV-1/KH/BID-V1990/2003, complete genome 10603.t...................1062395
GQ868619.1 Dengue virus 1 isolate DENV-1/KH/BID-V1991/2003, complete genome 10603.t...................1062395
GQ868630.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3781/2006, complete genome 10601.t...................1062195
GQ868632.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3792/2008, complete genome 10603.t...................1062395
GQ868633.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3793/2008, complete genome 10603.t...................1062395
GQ868635.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3915/2008, complete genome 10603.t...................1062395
GQ868636.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3916/2008, complete genome 10603.t...................1062395
GQ868637.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3919/2000, complete genome 10603.t...................1062395
GQ868639.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3925/2006, complete genome 10603.t...................1062395
GQ868617.1 Dengue virus 3 isolate DENV-3/TT/BID-V3928/2002, complete genome 10576..............c......1059695
GQ868498.1 Dengue virus 1 isolate DENV-1/MX/BID-V3659/2006, complete genome 10603.c...................1062395
GQ868499.1 Dengue virus 1 isolate DENV-1/MX/BID-V3664/2006, complete genome 10603.c...................1062395
GQ868500.1 Dengue virus 1 isolate DENV-1/MX/BID-V3665/2007, complete genome 10603.c...................1062395
GQ868501.1 Dengue virus 1 isolate DENV-1/MX/BID-V3682/2007, complete genome 10603.c...................1062395
GQ868502.1 Dengue virus 1 isolate DENV-1/MX/BID-V3685/2007, complete genome 10602.c...................1062295
GQ868503.1 Dengue virus 1 isolate DENV-1/MX/BID-V3686/2007, complete genome 10589.c...................1060995
GQ868504.1 Dengue virus 1 isolate DENV-1/MX/BID-V3687/2007, complete genome 10603.c...................1062395
GQ868505.1 Dengue virus 1 isolate DENV-1/MX/BID-V3689/2007, complete genome 10603.c...................1062395
GQ868506.1 Dengue virus 1 isolate DENV-1/MX/BID-V3694/2007, complete genome 10603.t...................1062395
GQ868507.1 Dengue virus 1 isolate DENV-1/MX/BID-V3696/2007, complete genome 10603.c...................1062395
GQ868508.1 Dengue virus 1 isolate DENV-1/MX/BID-V3697/2007, complete genome 10603.c...................1062395
GQ868509.1 Dengue virus 1 isolate DENV-1/MX/BID-V3698/2007, complete genome 10603.c...................1062395
GQ868510.1 Dengue virus 1 isolate DENV-1/MX/BID-V3699/2007, complete genome 10603.c...................1062395
GQ868511.1 Dengue virus 1 isolate DENV-1/MX/BID-V3700/2007, complete genome 10599.c...................1061995
GQ868512.1 Dengue virus 1 isolate DENV-1/MX/BID-V3701/2007, complete genome 10593.c...................1061395
GQ868513.1 Dengue virus 1 isolate DENV-1/MX/BID-V3709/2007, complete genome 10603.c...................1062395
GQ868514.1 Dengue virus 1 isolate DENV-1/MX/BID-V3710/2007, complete genome 10603.c...................1062395
GQ868517.1 Dengue virus 1 isolate DENV-1/MX/BID-V3721/2007, complete genome 10603.c...................1062395
GQ868518.1 Dengue virus 1 isolate DENV-1/MX/BID-V3723/2007, complete genome 10603.c...................1062395
GQ868519.1 Dengue virus 1 isolate DENV-1/MX/BID-V3724/2007, complete genome 10603.c...................1062395
GQ868520.1 Dengue virus 1 isolate DENV-1/MX/BID-V3726/2007, complete genome 10603.c...................1062395
GQ868521.1 Dengue virus 1 isolate DENV-1/MX/BID-V3727/2007, complete genome 10603.c...................1062395
GQ868522.1 Dengue virus 1 isolate DENV-1/MX/BID-V3728/2007, complete genome 10603.c...................1062395
GQ868523.1 Dengue virus 1 isolate DENV-1/MX/BID-V3730/2007, complete genome 10603.c...................1062395
GQ868524.1 Dengue virus 1 isolate DENV-1/MX/BID-V3731/2007, complete genome 10603.c...................1062395
GQ868525.1 Dengue virus 1 isolate DENV-1/MX/BID-V3734/2007, complete genome 10603.c...................1062395
GQ868526.1 Dengue virus 1 isolate DENV-1/MX/BID-V3735/2007, complete genome 10603.c...................1062395
GQ868527.1 Dengue virus 1 isolate DENV-1/MX/BID-V3739/2007, complete genome 10603.c...................1062395
GQ868529.1 Dengue virus 1 isolate DENV-1/MX/BID-V3744/2008, complete genome 10603.c...................1062395
GQ868530.1 Dengue virus 1 isolate DENV-1/MX/BID-V3746/2008, complete genome 10603.c...................1062395
GQ868531.1 Dengue virus 1 isolate DENV-1/MX/BID-V3747/2008, complete genome 10603.c...................1062395
GQ868533.1 Dengue virus 1 isolate DENV-1/MX/BID-V3752/2008, complete genome 10603.c...................1062395
GQ868534.1 Dengue virus 1 isolate DENV-1/MX/BID-V3753/2008, complete genome 10603.c...................1062395
GQ868535.1 Dengue virus 1 isolate DENV-1/MX/BID-V3754/2008, complete genome 10603.c...................1062395
GQ868536.1 Dengue virus 1 isolate DENV-1/MX/BID-V3756/2008, complete genome 10603.t...................1062395
GQ868537.1 Dengue virus 1 isolate DENV-1/MX/BID-V3758/2008, complete genome 10603.c...................1062395
GQ868538.1 Dengue virus 1 isolate DENV-1/MX/BID-V3759/2008, complete genome 10603.c...................1062395
GQ868559.1 Dengue virus 1 isolate DENV-1/CO/BID-V3376/1998, complete genome 10603.c...................1062395
GQ868560.1 Dengue virus 1 isolate DENV-1/CO/BID-V3377/1998, complete genome 10603.c...................1062395
GQ868561.1 Dengue virus 1 isolate DENV-1/CO/BID-V3378/1999, complete genome 10592.c...................1061295
GQ868562.1 Dengue virus 1 isolate DENV-1/CO/BID-V3380/2005, complete genome 10593.c...................1061395
GQ868563.1 Dengue virus 1 isolate DENV-1/CO/BID-V3381/2006, complete genome 10589.c...................1060995
GQ868564.1 Dengue virus 1 isolate DENV-1/CO/BID-V3382/2006, complete genome 10603.c...................1062395
GQ868565.1 Dengue virus 1 isolate DENV-1/CO/BID-V3385/2006, complete genome 10603.c...................1062395
GQ868566.1 Dengue virus 1 isolate DENV-1/CO/BID-V3386/2007, complete genome 10603.c...................1062395
GQ868567.1 Dengue virus 1 isolate DENV-1/CO/BID-V3387/2007, complete genome 10603.c...................1062395
GQ868568.1 Dengue virus 1 isolate DENV-1/CO/BID-V3388/2007, complete genome 10603.c...................1062395
GQ868569.1 Dengue virus 1 isolate DENV-1/CO/BID-V3390/2007, complete genome 10603.c...................1062395
GQ868570.1 Dengue virus 1 isolate DENV-1/CO/BID-V3391/2008, complete genome 10603.c...................1062395
GQ868539.1 Dengue virus 1 isolate DENV-1/MX/BID-V3760/2008, complete genome 10591.c...................1061195
GU131721.1 Dengue virus 1 isolate DENV-1/VN/BID-V3898/2008, complete genome 10604.t...................1062495
GU131731.1 Dengue virus 1 isolate DENV-1/VN/BID-V3935/2008, complete genome 10579.t...................1059995
GU131732.1 Dengue virus 1 isolate DENV-1/VN/BID-V3937/2008, complete genome 10593.t...................1061395
GU131739.1 Dengue virus 1 isolate DENV-1/VN/BID-V3959/2008, complete genome 10603.t...................1062395
GU131750.1 Dengue virus 1 isolate DENV-1/VN/BID-V3977/2008, complete genome 10603.t...................1062395
GU131759.1 Dengue virus 1 isolate DENV-1/VN/BID-V3986/2008, complete genome 10603.t...................1062395
GU131782.1 Dengue virus 1 isolate DENV-1/VN/BID-V4020/2008, complete genome 10589.t...................1060995
GU131828.1 Dengue virus 1 isolate DENV-1/VN/BID-V4084/2008, complete genome 10595.t...................1061595
GU131894.1 Dengue virus 1 isolate DENV-1/IPC/BID-V3786/2008, complete genome 10582.t...................1060295
GU131956.1 Dengue virus 1 isolate DENV-1/MX/BID-V3656/2006, complete genome 10603.c...................1062395
GU131957.1 Dengue virus 1 isolate DENV-1/MX/BID-V3657/2006, complete genome 10590.c...................1061095
GU131958.1 Dengue virus 1 isolate DENV-1/MX/BID-V3658/2006, complete genome 10603.c...................1062395
GU131959.1 Dengue virus 2 isolate DENV-2/MX/BID-V3661/2006, complete genome 10571...g.................1059195
GU131960.1 Dengue virus 1 isolate DENV-1/MX/BID-V3667/2007, complete genome 10603.c...................1062395
GU131961.1 Dengue virus 1 isolate DENV-1/MX/BID-V3668/2007, complete genome 10603.c...................1062395
GU131962.1 Dengue virus 1 isolate DENV-1/MX/BID-V3669/2007, complete genome 10594.c...................1061495
GU131964.1 Dengue virus 1 isolate DENV-1/MX/BID-V3673/2007, complete genome 10603.c...................1062395
GU131965.1 Dengue virus 1 isolate DENV-1/MX/BID-V3677/2007, complete genome 10578.c...................1059895
GU131966.1 Dengue virus 1 isolate DENV-1/MX/BID-V3679/2007, complete genome 10568.c...................1058895
GU131969.1 Dengue virus 1 isolate DENV-1/MX/BID-V3693/2007, complete genome 10589.c...................1060995
GU131970.1 Dengue virus 1 isolate DENV-1/MX/BID-V3703/2007, complete genome 10588.c...................1060895
GU131971.1 Dengue virus 1 isolate DENV-1/MX/BID-V3707/2007, complete genome 10578.c...................1059895
GU131972.1 Dengue virus 1 isolate DENV-1/MX/BID-V3711/2007, complete genome 10603.c...................1062395
GU131978.1 Dengue virus 1 isolate DENV-1/MX/BID-V3732/2007, complete genome 10602.c...................1062295
GU131979.1 Dengue virus 1 isolate DENV-1/MX/BID-V3737/2007, complete genome 10589.c...................1060995
GU131981.1 Dengue virus 1 isolate DENV-1/MX/BID-V3742/2007, complete genome 10568.c...................1058895
GU131982.1 Dengue virus 1 isolate DENV-1/MX/BID-V3745/2008, complete genome 10603.c...................1062395
GU131983.1 Dengue virus 1 isolate DENV-1/MX/BID-V3748/2008, complete genome 10603.c...................1062395
GU131984.1 Dengue virus 1 isolate DENV-1/MX/BID-V3761/2008, complete genome 10596.c...................1061695
HM181939.1 Dengue virus 1 isolate DENV-1/KH/BID-V4237/2006, complete genome 10603.t...................1062395
HM181941.1 Dengue virus 1 isolate DENV-1/KH/BID-V4239/2006, complete genome 10576.t...................1059695
HM181943.1 Dengue virus 1 isolate DENV-1/KH/BID-V4241/2007, complete genome 10591.t...................1061195
HM181948.1 Dengue virus 1 isolate DENV-1/KH/BID-V4249/2007, complete genome 10589.t...................1060995
HM181949.1 Dengue virus 1 isolate DENV-1/KH/BID-V4250/2007, complete genome 10602.t...................1062295
HM181952.1 Dengue virus 1 isolate DENV-1/KH/BID-V4253/2007, complete genome 10603.t...................1062395
HM181954.1 Dengue virus 1 isolate DENV-1/KH/BID-V4257/2007, complete genome 10592.t...................1061295
HM181956.1 Dengue virus 1 isolate DENV-1/KH/BID-V4259/2007, complete genome 10589.t...................1060995
HM181957.1 Dengue virus 1 isolate DENV-1/KH/BID-V4260/2007, complete genome 10603.t...................1062395
HM181958.1 Dengue virus 1 isolate DENV-1/KH/BID-V4261/2007, complete genome 10597.t...................1061795
HM181959.1 Dengue virus 1 isolate DENV-1/KH/BID-V4262/2007, complete genome 10589.t...................1060995
HM631855.1 Dengue virus 1 isolate DENV-1/MX/BID-V3680/2007, complete genome 10564.c...................1058495
HM488255.1 Dengue virus 1 isolate DENV-1/KH/BID-V4242/2007, complete genome 10559.t...................1057995
HM631852.1 Dengue virus 1 isolate DENV-1/KH/BID-V3773/2006, complete genome 10588.t...................1060895
HM631853.1 Dengue virus 1 isolate DENV-1/KH/BID-V4243/2007, complete genome 10585.t...................1060595
HQ166035.1 Dengue virus 1 isolate DENV-1/MX/BID-V3683/2007, complete genome 10569.c...................1058995
HQ166037.1 Dengue virus 1 isolate DENV-1/MX/BID-V3757/2008, complete genome 10603.c...................1062395
HQ891313.1 Dengue virus 1 isolate DV1_SL_2009a, complete genome 10624.t...................1064495
HQ891314.1 Dengue virus 1 isolate DV1_SL_2009b, complete genome 10625.t...................1064595
HQ891315.1 Dengue virus 1 isolate DV1_SL_2009c, complete genome 10625.t...................1064595
HQ891316.1 Dengue virus 1 isolate DV1_SL_2009d, complete genome 10625.t...................1064595
NC_001477.1 Dengue virus type 1, complete genome 10625.c...................1064595
FJ639819.1 Dengue virus 1 isolate DENV-1/VE/BID-V2259/2006, complete genome 10605__...................1062390
GU131844.1 Dengue virus 3 isolate DENV-3/BR/BID-V3417/2006, complete genome 10576...................__1059490
FJ850069.1 Dengue virus 1 isolate DENV-1/KH/BID-V1994/2003, complete genome 10589.t.................._1060890
HM181945.1 Dengue virus 1 isolate DENV-1/KH/BID-V4245/2007, complete genome 10603.t.................._1062290
EU482496.1 Dengue virus 1 isolate DENV-1/VN/BID-V951/2007, complete genome 10606___..................1062385
EU482507.1 Dengue virus 1 isolate DENV-1/VN/BID-V962/2007, complete genome 10606___..................1062385
EU687251.1 Dengue virus 1 isolate DENV-1/VN/BID-V1561/2007, complete genome 10606___..................1062385
FJ024432.1 Dengue virus 1 isolate DENV-1/VN/BID-V1572/2007, complete genome 10606___..................1062385
FJ024446.1 Dengue virus 1 isolate DENV-1/VN/BID-V1641/2007, complete genome 10606___..................1062385
FJ182021.1 Dengue virus 1 isolate DENV-1/VN/BID-V1639/2007, complete genome 10606___..................1062385
FJ390382.1 Dengue virus 1 isolate DENV-1/VN/BID-V1656/2007, complete genome 10606___..................1062385
FJ639735.1 Dengue virus 1 isolate DENV-1/VE/BID-V2162/1997, complete genome 10606___..................1062385
FJ639671.1 Dengue virus 1 isolate DENV-1/KH/BID-V1981/2001, complete genome 10606___..................1062385
FN429885.1 Dengue virus type 1, isolate D1MY96-7905, genomic RNA, complete genom10628___..................1064585
GQ868528.1 Dengue virus 1 isolate DENV-1/MX/BID-V3743/2007, complete genome 10606___..................1062385
FJ639812.1 Dengue virus 1 isolate DENV-1/VE/BID-V2250/2005, complete genome 10603.c...........g.......1062390
FJ639820.1 Dengue virus 1 isolate DENV-1/VE/BID-V2260/2006, complete genome 10604.c.........c.........1062490
GU131977.1 Dengue virus 1 isolate DENV-1/MX/BID-V3729/2007, complete genome 10603.c..............t....1062390
JF937626.1 Dengue virus 3 isolate DENV-3/NI/BID-V5508/2010, complete genome 10581....ca...............1060190
FJ432725.1 Dengue virus 1 isolate DENV-1/VN/BID-V1779/2007, complete genome 10603.t................___1062080
GU131941.1 Dengue virus 3 isolate DENV-3/IPC/BID-V4298/2007, complete genome 10576.g....t....c.........1059685