../../tmp/servers/virsirnadb/1482971331
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi14161aaatttggagagtggcaggtgg22
K00108.1BLCNCNP La Crosse virus genome molecule S cDNA to genomic RNA 271......................292100
K00610.1BLCSRNA La Crosse virus S RNA, complete, coding for the N and NS-s pro271......................292100
J02390.1SSHS Snowshoe hare bunyavirus small viral RNA 269......................290100
X73468.1 Lumbo virus genomic RNA for N and NSs proteins 268......................289100
Z68497.1 Tahyna virus RNA for N protein and RNA for NS protein, strain 92 268......................289100
Z68497.1 Tahyna virus RNA for N protein and RNA for NS protein, strain 92 763........._____________77140
U47142.1TVU47142 Tahyna virus Prototype Bardos 92 nucleocapsid protein and non267......................288100
DQ196120.1 La Crosse virus strain 77 segment small, complete sequence 271......................292100
EF485030.1 La Crosse virus strain LACV/human/1960 segment small, complete sequen271......................292100
EF485033.1 La Crosse virus strain LACV/human/1978 segment small, complete sequen271......................292100
EF485036.1 La Crosse virus strain LACV/mosquito/1978 segment small, complete seq271......................292100
EF485036.1 La Crosse virus strain LACV/mosquito/1978 segment small, complete seq832........._____________82440
EU294510.1 Snowshoe hare virus segment small, complete sequence 222......................243100
U12797.1CEU12797 California encephalitis virus - BFS-283 segment S RNA N prote268........c.............28995
U12800.1CEU12800 California encephalitis virus E6071 S RNA segment, N and NSs 268........c.............28995
U31989.1MBU31989 Morro Bay virus S RNA segment, nucleocapsid protein (N) and n268........c.............28995
U31989.1MBU31989 Morro Bay virus S RNA segment, nucleocapsid protein (N) and n763........._____________77140
U47139.1SAU47139 San Angelo virus Prototype VR723 nucleocapsid protein and non266........c.............28795
U47140.1SNU47140 Serra do Navio virus BeAr 103645 nucleocapsid protein and non265..g........c..........28690
EU616903.1 Chatanga virus strain LEIV-17756 segment L, complete sequence 1410___.........._________140145
M87664.1BLCG2NSM Bunyavirus La Crosse G2/Nsm/G1 gene, open reading frame 1781_..ca.........________179350
M87664.1BLCG2NSM Bunyavirus La Crosse G2/Nsm/G1 gene, open reading frame 1482_____________.........147440
U18979.1LCU18979 La Crosse virus isolate LAC30928-31 M segment polyprotein gen1804_..ca.........________181650
U18979.1LCU18979 La Crosse virus isolate LAC30928-31 M segment polyprotein gen1505_____________.........149740
U18980.1LCU18980 La Crosse virus isolate LAC22988-89 M segment polyprotein gen1804_..ca.........________181650
U18980.1LCU18980 La Crosse virus isolate LAC22988-89 M segment polyprotein gen1505_____________.........149740
U70205.1LCU70205 La Crosse virus polyprotein gene, complete cds 1804_..ca.........________181650
U70205.1LCU70205 La Crosse virus polyprotein gene, complete cds 1505_____________.........149740
U70206.1LCU70206 La Crosse virus polyprotein gene, complete cds 1804_..ca.........________181650
U70206.1LCU70206 La Crosse virus polyprotein gene, complete cds 1505_____________.........149740
AF123485.1 Tahyna virus polyprotein mRNA, complete cds 1966.........ct.._________195450
AF123485.1 Tahyna virus polyprotein mRNA, complete cds 2788___________.........__279640
AF229129.1 Tahyna virus middle segment RNA ORF (M-RNA) mRNA, complete cds 1966.........ct.._________195450
AF229129.1 Tahyna virus middle segment RNA ORF (M-RNA) mRNA, complete cds 2788___________.........__279640
DQ196119.1 La Crosse virus strain 77 segment middle, complete sequence 1804_..ca.........________181650
DQ196119.1 La Crosse virus strain 77 segment middle, complete sequence 1505_____________.........149740
EF485031.1 La Crosse virus strain LACV/human/1960 segment medium, complete seque1804_..ca.........________181650
EF485031.1 La Crosse virus strain LACV/human/1960 segment medium, complete seque1505_____________.........149740
EF485034.1 La Crosse virus strain LACV/human/1978 segment medium, complete seque1804_..ca.........________181650
EF485034.1 La Crosse virus strain LACV/human/1978 segment medium, complete seque1505_____________.........149740
EF485037.1 La Crosse virus strain LACV/mosquito/1978 segment medium, complete se1804_..ca.........________181650
EF485037.1 La Crosse virus strain LACV/mosquito/1978 segment medium, complete se2790__________.t........._280045
EF485037.1 La Crosse virus strain LACV/mosquito/1978 segment medium, complete se1505_____________.........149740
D10370.1BLCMRP La Crosse virus M RNA for polyprotein, complete cds 1505_____________.........149740
U70207.1LCU70207 La Crosse virus polyprotein gene, complete cds 1505_____________.........149740
U70208.1LCU70208 La Crosse virus polyprotein gene, complete cds 1505_____________.........149740
AF123483.1 California encephalitis virus polyprotein mRNA, complete cds 4086________........._____407840
AF123486.1 San Angelo virus polyprotein mRNA, complete cds 459__________.........___46740
EU789573.1 Inkoo virus segment large strain KN3641, complete sequence 5737__________.........___574540