../../tmp/servers/virsirnadb/1744581354
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi22411aaccttacagagttgtagtac21
AY278491.2 SARS coronavirus HKU-39849, complete genome 22966.....................22986100
AY278491.2 SARS coronavirus HKU-39849, complete genome 10072.t..a.ta...........t.1005276
AY278554.2 SARS coronavirus CUHK-W1, complete genome 22951.....................22971100
AY278554.2 SARS coronavirus CUHK-W1, complete genome 10057.t..a.ta...........t.1003776
AY278741.1 SARS coronavirus Urbani, complete genome 22966.....................22986100
AY278741.1 SARS coronavirus Urbani, complete genome 10072.t..a.ta...........t.1005276
AY278488.2 SARS coronavirus BJ01, complete genome 22947.....................22967100
AY278488.2 SARS coronavirus BJ01, complete genome 10053.t..a.ta...........t.1003376
AY283794.1 SARS coronavirus Sin2500, complete genome 22950.....................22970100
AY283794.1 SARS coronavirus Sin2500, complete genome 10056.t..a.ta...........t.1003676
AY283795.1 SARS coronavirus Sin2677, complete genome 22950.....................22970100
AY283795.1 SARS coronavirus Sin2677, complete genome 10056.t..a.ta...........t.1003676
AY283796.1 SARS coronavirus Sin2679, complete genome 22950.....................22970100
AY283796.1 SARS coronavirus Sin2679, complete genome 10056.t..a.ta...........t.1003676
AY283797.1 SARS coronavirus Sin2748, complete genome 22950.....................22970100
AY283797.1 SARS coronavirus Sin2748, complete genome 10056.t..a.ta...........t.1003676
AY291451.1 SARS coronavirus TW1, complete genome 22966.....................22986100
AY291451.1 SARS coronavirus TW1, complete genome 10072.t..a.ta...........t.1005276
AY297028.1 SARS coronavirus ZJ01, complete genome 22957.....................22977100
AY297028.1 SARS coronavirus ZJ01, complete genome 10059.t..a.ta...........t.1003976
AY278489.2 SARS coronavirus GD01, complete genome 22950.....................22970100
AY278489.2 SARS coronavirus GD01, complete genome 10056.t..a.ta...........t.1003676
AY278487.3 SARS coronavirus BJ02, complete genome 22966.....................22986100
AY278487.3 SARS coronavirus BJ02, complete genome 10072.t..a.ta...........t.1005276
AY278490.3 SARS coronavirus BJ03, complete genome 22962.....................22982100
AY278490.3 SARS coronavirus BJ03, complete genome 10068.t..a.ta...........t.1004876
AY279354.2 SARS coronavirus BJ04, complete genome 22950.....................22970100
AY279354.2 SARS coronavirus BJ04, complete genome 10056.t..a.ta...........t.1003676
AY291315.1 SARS coronavirus Frankfurt 1, complete genome 22966.....................22986100
AY291315.1 SARS coronavirus Frankfurt 1, complete genome 10072.t..a.ta...........t.1005276
AY321118.1 SARS coronavirus TWC, complete genome 22966.....................22986100
AY321118.1 SARS coronavirus TWC, complete genome 10072.t..a.ta...........t.1005276
AY338174.1 SARS coronavirus Taiwan TC1, complete genome 22897.....................22917100
AY338174.1 SARS coronavirus Taiwan TC1, complete genome 10003.t..a.ta...........t.998376
AY338175.1 SARS coronavirus Taiwan TC2, complete genome 22897.....................22917100
AY338175.1 SARS coronavirus Taiwan TC2, complete genome 10003.t..a.ta...........t.998376
AY345986.1 SARS coronavirus CUHK-AG01, complete genome 22951.....................22971100
AY345986.1 SARS coronavirus CUHK-AG01, complete genome 10057.t..a.ta...........t.1003776
AY345987.1 SARS coronavirus CUHK-AG02, complete genome 22951.....................22971100
AY345987.1 SARS coronavirus CUHK-AG02, complete genome 10057.t..a.ta...........t.1003776
AY345988.1 SARS coronavirus CUHK-AG03, complete genome 22951.....................22971100
AY345988.1 SARS coronavirus CUHK-AG03, complete genome 10057.t..a.ta...........t.1003776
AY323977.2 SARS coronavirus HSR 1, complete genome 22966.....................22986100
AY323977.2 SARS coronavirus HSR 1, complete genome 10072.t..a.ta...........t.1005276
AY348314.1 SARS coronavirus Taiwan TC3, complete genome 22897.....................22917100
AY348314.1 SARS coronavirus Taiwan TC3, complete genome 10003.t..a.ta...........t.998376
AY351680.1 SARS coronavirus ZMY 1, complete genome 22987.....................23007100
AY351680.1 SARS coronavirus ZMY 1, complete genome 10084.t..a.ta...........t.1006476
AP006557.1 SARS coronavirus TWH genomic RNA, complete genome 22966.....................22986100
AP006557.1 SARS coronavirus TWH genomic RNA, complete genome 10072.t..a.ta...........t.1005276
AP006558.1 SARS coronavirus TWJ genomic RNA, complete genome 22966.....................22986100
AP006558.1 SARS coronavirus TWJ genomic RNA, complete genome 10072.t..a.ta...........t.1005276
AP006559.1 SARS coronavirus TWK genomic RNA, complete genome 22966.....................22986100
AP006559.1 SARS coronavirus TWK genomic RNA, complete genome 10072.t..a.ta...........t.1005276
AP006560.1 SARS coronavirus TWS genomic RNA, complete genome 22966.....................22986100
AP006560.1 SARS coronavirus TWS genomic RNA, complete genome 10072.t..a.ta...........t.1005276
AP006561.1 SARS coronavirus TWY genomic RNA, complete genome 22966.....................22986100
AP006561.1 SARS coronavirus TWY genomic RNA, complete genome 10072.t..a.ta...........t.1005276
AY362698.1 SARS coronavirus TWC2, complete genome 22966.....................22986100
AY362698.1 SARS coronavirus TWC2, complete genome 10072.t..a.ta...........t.1005276
AY362699.1 SARS coronavirus TWC3, complete genome 22966.....................22986100
AY362699.1 SARS coronavirus TWC3, complete genome 10072.t..a.ta...........t.1005276
AY310120.1 SARS coronavirus FRA, complete genome 22966.....................22986100
AY310120.1 SARS coronavirus FRA, complete genome 10072.t..a.ta...........t.1005276
AY304486.1 SARS coronavirus SZ3, complete genome 22951.....................22971100
AY304486.1 SARS coronavirus SZ3, complete genome 10057.t..a.ta...........t.1003776
AY304488.1 SARS coronavirus SZ16, complete genome 22951.....................22971100
AY304488.1 SARS coronavirus SZ16, complete genome 10057.t..a.ta...........t.1003776
AY304495.1 SARS coronavirus GZ50, complete genome 22951.....................22971100
AY304495.1 SARS coronavirus GZ50, complete genome 10057.t..a.ta...........t.1003776
AY283798.2 SARS coronavirus Sin2774, complete genome 22950.....................22970100
AY283798.2 SARS coronavirus Sin2774, complete genome 10056.t..a.ta...........t.1003676
AY427439.1 SARS coronavirus AS, complete genome 22950.....................22970100
AY427439.1 SARS coronavirus AS, complete genome 10056.t..a.ta...........t.1003676
AY394977.1 SARS coronavirus GZ-A, partial genome 22915.....................22935100
AY394977.1 SARS coronavirus GZ-A, partial genome 10021.t..a.ta...........t.1000176
AY394978.1 SARS coronavirus GZ-B, complete genome 22894.....................22914100
AY394978.1 SARS coronavirus GZ-B, complete genome 10000.t..a.ta...........t.998076
AY394979.1 SARS coronavirus GZ-C, complete genome 22914.....................22934100
AY394979.1 SARS coronavirus GZ-C, complete genome 10020.t..a.ta...........t.1000076
AY394980.1 SARS coronavirus GZ-D, partial genome 22920.....................22940100
AY394980.1 SARS coronavirus GZ-D, partial genome 10026.t..a.ta...........t.1000676
AY394981.1 SARS coronavirus HGZ8L1-A, partial genome 22912.....................22932100
AY394981.1 SARS coronavirus HGZ8L1-A, partial genome 10021.t..a.ta...........t.1000176
AY394982.1 SARS coronavirus HGZ8L1-B, partial genome 22914.....................22934100
AY394982.1 SARS coronavirus HGZ8L1-B, partial genome 10020.t..a.ta...........t.1000076
AY394983.1 SARS coronavirus HSZ2-A, complete genome 22914.....................22934100
AY394983.1 SARS coronavirus HSZ2-A, complete genome 10020.t..a.ta...........t.1000076
AY394984.1 SARS coronavirus HSZ-A, partial genome 22919.....................22939100
AY394984.1 SARS coronavirus HSZ-A, partial genome 10025.t..a.ta...........t.1000576
AY394985.1 SARS coronavirus HSZ-Bb, complete genome 22716.....................22736100
AY394985.1 SARS coronavirus HSZ-Bb, complete genome 9822.t..a.ta...........t.980276
AY394986.1 SARS coronavirus HSZ-Cb, complete genome 22915.....................22935100
AY394986.1 SARS coronavirus HSZ-Cb, complete genome 10021.t..a.ta...........t.1000176
AY394987.1 SARS coronavirus HZS2-Fb, complete genome 22924.....................22944100
AY394987.1 SARS coronavirus HZS2-Fb, complete genome 10030.t..a.ta...........t.1001076
AY394988.1 SARS coronavirus JMD, partial genome 22880.....................22900100
AY394989.1 SARS coronavirus HZS2-D, complete genome 22951.....................22971100
AY394989.1 SARS coronavirus HZS2-D, complete genome 10057.t..a.ta...........t.1003776
AY394990.1 SARS coronavirus HZS2-E, complete genome 22951.....................22971100
AY394990.1 SARS coronavirus HZS2-E, complete genome 10057.t..a.ta...........t.1003776
AY394991.1 SARS coronavirus HZS2-Fc, complete genome 22951.....................22971100
AY394991.1 SARS coronavirus HZS2-Fc, complete genome 10057.t..a.ta...........t.1003776
AY394992.1 SARS coronavirus HZS2-C, complete genome 22951.....................22971100
AY394992.1 SARS coronavirus HZS2-C, complete genome 10057.t..a.ta...........t.1003776
AY394993.1 SARS coronavirus HGZ8L2, complete genome 22951.....................22971100
AY394993.1 SARS coronavirus HGZ8L2, complete genome 10057.t..a.ta...........t.1003776
AY394994.1 SARS coronavirus HSZ-Bc, complete genome 22951.....................22971100
AY394994.1 SARS coronavirus HSZ-Bc, complete genome 10057.t..a.ta...........t.1003776
AY394995.1 SARS coronavirus HSZ-Cc, complete genome 22951.....................22971100
AY394995.1 SARS coronavirus HSZ-Cc, complete genome 10057.t..a.ta...........t.1003776
AY394996.1 SARS coronavirus ZS-B, complete genome 22951.....................22971100
AY394996.1 SARS coronavirus ZS-B, complete genome 10057.t..a.ta...........t.1003776
AY394997.1 SARS coronavirus ZS-A, complete genome 22951.....................22971100
AY394997.1 SARS coronavirus ZS-A, complete genome 10057.t..a.ta...........t.1003776
AY394998.1 SARS coronavirus LC1, complete genome 22951.....................22971100
AY394998.1 SARS coronavirus LC1, complete genome 10057.t..a.ta...........t.1003776
AY394999.1 SARS coronavirus LC2, complete genome 22951.....................22971100
AY394999.1 SARS coronavirus LC2, complete genome 10057.t..a.ta...........t.1003776
AY395000.1 SARS coronavirus LC3, complete genome 22951.....................22971100
AY395000.1 SARS coronavirus LC3, complete genome 10057.t..a.ta...........t.1003776
AY395001.1 SARS coronavirus LC4, complete genome 22951.....................22971100
AY395001.1 SARS coronavirus LC4, complete genome 10057.t..a.ta...........t.1003776
AY395002.1 SARS coronavirus LC5, complete genome 22951.....................22971100
AY395002.1 SARS coronavirus LC5, complete genome 10057.t..a.ta...........t.1003776
AY395003.1 SARS coronavirus ZS-C, complete genome 22915.....................22935100
AY395003.1 SARS coronavirus ZS-C, complete genome 10021.t..a.ta...........t.1000176
AY395004.1 SARS coronavirus HZS2-Bb, partial genome 22919.....................22939100
AY395004.1 SARS coronavirus HZS2-Bb, partial genome 10025.t..a.ta...........t.1000576
AY313906.1 SARS coronavirus GD69, complete genome 22977.....................22997100
AY313906.1 SARS coronavirus GD69, complete genome 10072.t..a.ta...........t.1005276
AY350750.1 SARS coronavirus PUMC01, complete genome 22953.....................22973100
AY350750.1 SARS coronavirus PUMC01, complete genome 10059.t..a.ta...........t.1003976
AY357075.1 SARS coronavirus PUMC02, complete genome 22952.....................22972100
AY357075.1 SARS coronavirus PUMC02, complete genome 10058.t..a.ta...........t.1003876
AY357076.1 SARS coronavirus PUMC03, complete genome 22952.....................22972100
AY357076.1 SARS coronavirus PUMC03, complete genome 10058.t..a.ta...........t.1003876
AY282752.2 SARS coronavirus CUHK-Su10, complete genome 22951.....................22971100
AY282752.2 SARS coronavirus CUHK-Su10, complete genome 10057.t..a.ta...........t.1003776
AY461660.1 SARS coronavirus SoD, complete genome 22951.....................22971100
AY461660.1 SARS coronavirus SoD, complete genome 10057.t..a.ta...........t.1003776
AY485277.1 SARS coronavirus Sino1-11, complete genome 22966.....................22986100
AY485277.1 SARS coronavirus Sino1-11, complete genome 10072.t..a.ta...........t.1005276
AY485278.1 SARS coronavirus Sino3-11, complete genome 22966.....................22986100
AY485278.1 SARS coronavirus Sino3-11, complete genome 10072.t..a.ta...........t.1005276
AY463059.1 SARS coronavirus ShanghaiQXC1, complete genome 22887.....................22907100
AY463059.1 SARS coronavirus ShanghaiQXC1, complete genome 9993.t..a.ta...........t.997376
AY463060.1 SARS coronavirus ShanghaiQXC2, complete genome 22308.....................22328100
AY463060.1 SARS coronavirus ShanghaiQXC2, complete genome 9414.t..a.ta...........t.939476
AY502923.1 SARS coronavirus TW10, complete genome 22966.....................22986100
AY502923.1 SARS coronavirus TW10, complete genome 10072.t..a.ta...........t.1005276
AY502924.1 SARS coronavirus TW11, complete genome 22966.....................22986100
AY502924.1 SARS coronavirus TW11, complete genome 10072.t..a.ta...........t.1005276
AY502925.1 SARS coronavirus TW2, complete genome 22966.....................22986100
AY502925.1 SARS coronavirus TW2, complete genome 10072.t..a.ta...........t.1005276
AY502926.1 SARS coronavirus TW3, complete genome 22966.....................22986100
AY502926.1 SARS coronavirus TW3, complete genome 10072.t..a.ta...........t.1005276
AY502927.1 SARS coronavirus TW4, complete genome 22966.....................22986100
AY502927.1 SARS coronavirus TW4, complete genome 10072.t..a.ta...........t.1005276
AY502928.1 SARS coronavirus TW5, complete genome 22966.....................22986100
AY502928.1 SARS coronavirus TW5, complete genome 10072.t..a.ta...........t.1005276
AY502929.1 SARS coronavirus TW6, complete genome 22966.....................22986100
AY502929.1 SARS coronavirus TW6, complete genome 10072.t..a.ta...........t.1005276
AY502930.1 SARS coronavirus TW7, complete genome 22966.....................22986100
AY502930.1 SARS coronavirus TW7, complete genome 10072.t..a.ta...........t.1005276
AY502931.1 SARS coronavirus TW8, complete genome 22966.....................22986100
AY502931.1 SARS coronavirus TW8, complete genome 10072.t..a.ta...........t.1005276
AY502932.1 SARS coronavirus TW9, complete genome 22966.....................22986100
AY502932.1 SARS coronavirus TW9, complete genome 10072.t..a.ta...........t.1005276
AY394850.2 SARS coronavirus WHU, complete genome 22966.....................22986100
AY394850.2 SARS coronavirus WHU, complete genome 10072.t..a.ta...........t.1005276
AY508724.1 SARS coronavirus NS-1, complete genome 22950.....................22970100
AY508724.1 SARS coronavirus NS-1, complete genome 10056.t..a.ta...........t.1003676
AY390556.1 SARS coronavirus GZ02, complete genome 22966.....................22986100
AY390556.1 SARS coronavirus GZ02, complete genome 10072.t..a.ta...........t.1005276
AY515512.1 SARS coronavirus HC/SZ/61/03, complete genome 22943.....................22963100
AY515512.1 SARS coronavirus HC/SZ/61/03, complete genome 10049.t..a.ta...........t.1002976
AY545914.1 SARS coronavirus isolate HC/SZ/79/03, complete genome 22943.....................22963100
AY545914.1 SARS coronavirus isolate HC/SZ/79/03, complete genome 10049.t..a.ta...........t.1002976
AY545915.1 SARS coronavirus isolate HC/SZ/DM1/03, complete genome 22934.....................22954100
AY545916.1 SARS coronavirus isolate HC/SZ/266/03, complete genome 22932.....................22952100
AY545916.1 SARS coronavirus isolate HC/SZ/266/03, complete genome 10038.t..a.ta...........t.1001876
AY545917.1 SARS coronavirus isolate HC/GZ/81/03, complete genome 22930.....................22950100
AY545917.1 SARS coronavirus isolate HC/GZ/81/03, complete genome 10036.t..a.ta...........t.1001676
AY545918.1 SARS coronavirus isolate HC/GZ/32/03, complete genome 22932.....................22952100
AY545918.1 SARS coronavirus isolate HC/GZ/32/03, complete genome 10038.t..a.ta...........t.1001876
AY545919.1 SARS coronavirus isolate CFB/SZ/94/03, complete genome 22945.....................22965100
AY545919.1 SARS coronavirus isolate CFB/SZ/94/03, complete genome 10051.t..a.ta...........t.1003176
AY559081.1 SARS coronavirus Sin842, complete genome 22954.....................22974100
AY559081.1 SARS coronavirus Sin842, complete genome 10059.t..a.ta...........t.1003976
AY559082.1 SARS coronavirus Sin852, complete genome 22965.....................22985100
AY559082.1 SARS coronavirus Sin852, complete genome 10071.t..a.ta...........t.1005176
AY559083.1 SARS coronavirus Sin3408, complete genome 23000.....................23020100
AY559083.1 SARS coronavirus Sin3408, complete genome 10106.t..a.ta...........t.1008676
AY559084.1 SARS coronavirus Sin3765V, complete genome 22950.....................22970100
AY559084.1 SARS coronavirus Sin3765V, complete genome 10056.t..a.ta...........t.1003676
AY559085.1 SARS coronavirus Sin848, complete genome 22950.....................22970100
AY559085.1 SARS coronavirus Sin848, complete genome 10056.t..a.ta...........t.1003676
AY559086.1 SARS coronavirus Sin849, complete genome 22950.....................22970100
AY559086.1 SARS coronavirus Sin849, complete genome 10056.t..a.ta...........t.1003676
AY559087.1 SARS coronavirus Sin3725V, complete genome 22950.....................22970100
AY559087.1 SARS coronavirus Sin3725V, complete genome 10056.t..a.ta...........t.1003676
AY559088.1 SARS coronavirus SinP1, complete genome 22951.....................22971100
AY559088.1 SARS coronavirus SinP1, complete genome 10057.t..a.ta...........t.1003776
AY559089.1 SARS coronavirus SinP2, complete genome 22957.....................22977100
AY559089.1 SARS coronavirus SinP2, complete genome 10056.t..a.ta...........t.1003676
AY559090.1 SARS coronavirus SinP3, complete genome 22960.....................22980100
AY559090.1 SARS coronavirus SinP3, complete genome 10058.t..a.ta...........t.1003876
AY559091.1 SARS coronavirus SinP4, complete genome 22950.....................22970100
AY559091.1 SARS coronavirus SinP4, complete genome 10056.t..a.ta...........t.1003676
AY559092.1 SARS coronavirus SinP5, complete genome 22950.....................22970100
AY559092.1 SARS coronavirus SinP5, complete genome 10056.t..a.ta...........t.1003676
AY559093.1 SARS coronavirus Sin845, complete genome 22950.....................22970100
AY559093.1 SARS coronavirus Sin845, complete genome 10056.t..a.ta...........t.1003676
AY559094.1 SARS coronavirus Sin846, complete genome 22952.....................22972100
AY559094.1 SARS coronavirus Sin846, complete genome 10058.t..a.ta...........t.1003876
AY559095.1 SARS coronavirus Sin847, complete genome 22956.....................22976100
AY559095.1 SARS coronavirus Sin847, complete genome 10062.t..a.ta...........t.1004276
AY559096.1 SARS coronavirus Sin850, complete genome 22958.....................22978100
AY559096.1 SARS coronavirus Sin850, complete genome 10064.t..a.ta...........t.1004476
AY559097.1 SARS coronavirus Sin3408L, complete genome 22951.....................22971100
AY559097.1 SARS coronavirus Sin3408L, complete genome 10057.t..a.ta...........t.1003776
AY568539.1 SARS coronavirus GZ0401, complete genome 22916.....................22936100
AY568539.1 SARS coronavirus GZ0401, complete genome 10022.t..a.ta...........t.1000276
AY595412.1 SARS coronavirus LLJ-2004, complete genome 22944.....................22964100
AY595412.1 SARS coronavirus LLJ-2004, complete genome 10050.t..a.ta...........t.1003076
AY654624.1 SARS coronavirus TJF, complete genome 22965.....................22985100
AY654624.1 SARS coronavirus TJF, complete genome 10071.t..a.ta...........t.1005176
AY572034.1 SARS coronavirus civet007, complete genome 22940.....................22960100
AY572034.1 SARS coronavirus civet007, complete genome 10046.t..a.ta...........t.1002676
AY572035.1 SARS coronavirus civet010, complete genome 22918.....................22938100
AY572035.1 SARS coronavirus civet010, complete genome 10024.t..a.ta...........t.1000476
AY572038.1 SARS coronavirus civet020, complete genome 22895.....................22915100
AY572038.1 SARS coronavirus civet020, complete genome 10001.t..a.ta...........t.998176
AY714217.1 SARS Coronavirus CDC#200301157, complete genome 22966.....................22986100
AY714217.1 SARS Coronavirus CDC#200301157, complete genome 10072.t..a.ta...........t.1005276
AY613947.1 SARS coronavirus GZ0402, complete genome 22916.....................22936100
AY613947.1 SARS coronavirus GZ0402, complete genome 10022.t..a.ta...........t.1000276
AY613948.1 SARS coronavirus PC4-13, complete genome 22916.....................22936100
AY613948.1 SARS coronavirus PC4-13, complete genome 10022.t..a.ta...........t.1000276
AY613949.1 SARS coronavirus PC4-136, complete genome 22916.....................22936100
AY613949.1 SARS coronavirus PC4-136, complete genome 10022.t..a.ta...........t.1000276
AY613950.1 SARS coronavirus PC4-227, complete genome 22916.....................22936100
AY613950.1 SARS coronavirus PC4-227, complete genome 10022.t..a.ta...........t.1000276
AY686864.1 SARS coronavirus B039, complete genome 22925.....................22945100
AY686864.1 SARS coronavirus B039, complete genome 10031.t..a.ta...........t.1001176
CQ918584.1 Sequence 1 from Patent WO2004096842 22951.....................22971100
CQ918584.1 Sequence 1 from Patent WO2004096842 10057.t..a.ta...........t.1003776
CQ918585.1 Sequence 2 from Patent WO2004096842 22951.....................22971100
CQ918585.1 Sequence 2 from Patent WO2004096842 10057.t..a.ta...........t.1003776
CQ918598.1 Sequence 15 from Patent WO2004096842 22966.....................22986100
CQ918598.1 Sequence 15 from Patent WO2004096842 10072.t..a.ta...........t.1005276
AY686863.1 SARS coronavirus A022, complete genome 22915.....................22935100
AY686863.1 SARS coronavirus A022, complete genome 10021.t..a.ta...........t.1000176
AY772062.1 SARS coronavirus WH20, complete genome 22976.....................22996100
AY772062.1 SARS coronavirus WH20, complete genome 10082.t..a.ta...........t.1006276
CS079026.1 Sequence 14 from Patent WO2005035556 22966.....................22986100
CS079026.1 Sequence 14 from Patent WO2005035556 10072.t..a.ta...........t.1005276
CS079027.1 Sequence 15 from Patent WO2005035556 22966.....................22986100
CS079027.1 Sequence 15 from Patent WO2005035556 10072.t..a.ta...........t.1005276
CS079028.1 Sequence 16 from Patent WO2005035556 22966.....................22986100
CS079028.1 Sequence 16 from Patent WO2005035556 10072.t..a.ta...........t.1005276
CS079029.1 Sequence 17 from Patent WO2005035556 22951.....................22971100
CS079029.1 Sequence 17 from Patent WO2005035556 10057.t..a.ta...........t.1003776
AY864805.1 SARS coronavirus BJ162, complete genome 22966.....................22986100
AY864805.1 SARS coronavirus BJ162, complete genome 10072.t..a.ta...........t.1005276
AY864806.1 SARS coronavirus BJ202, complete genome 22966.....................22986100
AY864806.1 SARS coronavirus BJ202, complete genome 10072.t..a.ta...........t.1005276
DQ182595.1 SARS coronavirus ZJ0301 from China, complete genome 22950.....................22970100
DQ182595.1 SARS coronavirus ZJ0301 from China, complete genome 10056.t..a.ta...........t.1003676
CS254197.1 Sequence 67 from Patent WO2004011647 22966.....................22986100
CS254197.1 Sequence 67 from Patent WO2004011647 10072.t..a.ta...........t.1005276
AB257344.1 SARS coronavirus Frankfurt 1 genomic RNA, nearly complete genome, clo22925.....................22945100
AB257344.1 SARS coronavirus Frankfurt 1 genomic RNA, nearly complete genome, clo10031.t..a.ta...........t.1001176
DQ497008.1 SARS coronavirus strain MA-15, complete genome 22966.....................22986100
DQ497008.1 SARS coronavirus strain MA-15, complete genome 10072.t..a.ta...........t.1005276
DQ640652.1 SARS coronavirus GDH-BJH01, complete genome 22972.....................22992100
DQ640652.1 SARS coronavirus GDH-BJH01, complete genome 10078.t..a.ta...........t.1005876
DQ898174.1 SARS coronavirus strain CV7, complete genome 22966.....................22986100
DQ898174.1 SARS coronavirus strain CV7, complete genome 10072.t..a.ta...........t.1005276
CS569493.1 Sequence 1 from Patent WO2006039656 22966.....................22986100
CS569493.1 Sequence 1 from Patent WO2006039656 10072.t..a.ta...........t.1005276
EU371559.1 SARS coronavirus ZJ02, complete genome 22966.....................22986100
EU371559.1 SARS coronavirus ZJ02, complete genome 10072.t..a.ta...........t.1005276
EU371560.1 SARS coronavirus BJ182a, complete genome 22966.....................22986100
EU371560.1 SARS coronavirus BJ182a, complete genome 10072.t..a.ta...........t.1005276
EU371561.1 SARS coronavirus BJ182b, complete genome 22966.....................22986100
EU371561.1 SARS coronavirus BJ182b, complete genome 10072.t..a.ta...........t.1005276
EU371562.1 SARS coronavirus BJ182-4, complete genome 22966.....................22986100
EU371562.1 SARS coronavirus BJ182-4, complete genome 10072.t..a.ta...........t.1005276
EU371563.1 SARS coronavirus BJ182-8, complete genome 22966.....................22986100
EU371563.1 SARS coronavirus BJ182-8, complete genome 10072.t..a.ta...........t.1005276
EU371564.1 SARS coronavirus BJ182-12, complete genome 22966.....................22986100
EU371564.1 SARS coronavirus BJ182-12, complete genome 10072.t..a.ta...........t.1005276
FJ882963.1 SARS coronavirus P2, complete genome 22947.....................22967100
FJ882963.1 SARS coronavirus P2, complete genome 10053.t..a.ta...........t.1003376
FJ959407.1 SARS coronavirus isolate A001, complete genome 22895.....................22915100
FJ959407.1 SARS coronavirus isolate A001, complete genome 10001.t..a.ta...........t.998176
FJ882926.1 SARS coronavirus ExoN1, complete genome 22934.....................22954100
FJ882926.1 SARS coronavirus ExoN1, complete genome 10040.t..a.ta...........t.1002076
FJ882927.1 SARS coronavirus wtic-MB isolate P1pp1, complete genome 22946.....................22966100
FJ882927.1 SARS coronavirus wtic-MB isolate P1pp1, complete genome 10052.t..a.ta...........t.1003276
FJ882928.1 SARS coronavirus ExoN1 isolate P1pp1, complete genome 22946.....................22966100
FJ882928.1 SARS coronavirus ExoN1 isolate P1pp1, complete genome 10052.t..a.ta...........t.1003276
FJ882929.1 SARS coronavirus ExoN1 isolate P3pp1, complete genome 22945.....................22965100
FJ882929.1 SARS coronavirus ExoN1 isolate P3pp1, complete genome 10051.t..a.ta...........t.1003176
FJ882930.1 SARS coronavirus ExoN1, complete genome 22946.....................22966100
FJ882930.1 SARS coronavirus ExoN1, complete genome 10052.t..a.ta...........t.1003276
FJ882931.1 SARS coronavirus ExoN1 isolate P3pp12, complete genome 22926.....................22946100
FJ882931.1 SARS coronavirus ExoN1 isolate P3pp12, complete genome 10032.t..a.ta...........t.1001276
FJ882932.1 SARS coronavirus wtic-MB isolate P3pp14, complete genome 22926.....................22946100
FJ882932.1 SARS coronavirus wtic-MB isolate P3pp14, complete genome 10032.t..a.ta...........t.1001276
FJ882933.1 SARS coronavirus wtic-MB isolate P3pp6, complete genome 22928.....................22948100
FJ882933.1 SARS coronavirus wtic-MB isolate P3pp6, complete genome 10034.t..a.ta...........t.1001476
FJ882934.1 SARS coronavirus wtic-MB isolate P3pp29, complete genome 22926.....................22946100
FJ882934.1 SARS coronavirus wtic-MB isolate P3pp29, complete genome 10032.t..a.ta...........t.1001276
FJ882935.1 SARS coronavirus wtic-MB isolate P3pp21, complete genome 22927.....................22947100
FJ882935.1 SARS coronavirus wtic-MB isolate P3pp21, complete genome 10033.t..a.ta...........t.1001376
FJ882936.1 SARS coronavirus wtic-MB isolate P3pp2, complete genome 22926.....................22946100
FJ882936.1 SARS coronavirus wtic-MB isolate P3pp2, complete genome 10032.t..a.ta...........t.1001276
FJ882937.1 SARS coronavirus wtic-MB isolate P3pp18, complete genome 22928.....................22948100
FJ882937.1 SARS coronavirus wtic-MB isolate P3pp18, complete genome 10034.t..a.ta...........t.1001476
FJ882938.1 SARS coronavirus wtic-MB, complete genome 22946.....................22966100
FJ882938.1 SARS coronavirus wtic-MB, complete genome 10052.t..a.ta...........t.1003276
FJ882939.1 SARS coronavirus wtic-MB isolate P3pp16, complete genome 22926.....................22946100
FJ882939.1 SARS coronavirus wtic-MB isolate P3pp16, complete genome 10032.t..a.ta...........t.1001276
FJ882940.1 SARS coronavirus ExoN1 isolate P3pp37, complete genome 22926.....................22946100
FJ882940.1 SARS coronavirus ExoN1 isolate P3pp37, complete genome 10032.t..a.ta...........t.1001276
FJ882941.1 SARS coronavirus ExoN1 isolate P3pp8, complete genome 22945.....................22965100
FJ882941.1 SARS coronavirus ExoN1 isolate P3pp8, complete genome 10051.t..a.ta...........t.1003176
FJ882942.1 SARS coronavirus MA15 ExoN1 isolate P3pp5, complete genome 22959.....................22979100
FJ882942.1 SARS coronavirus MA15 ExoN1 isolate P3pp5, complete genome 10065.t..a.ta...........t.1004576
FJ882943.1 SARS coronavirus MA15 ExoN1, complete genome 22959.....................22979100
FJ882943.1 SARS coronavirus MA15 ExoN1, complete genome 10065.t..a.ta...........t.1004576
FJ882944.1 SARS coronavirus ExoN1 isolate P3pp23, complete genome 22908.....................22928100
FJ882944.1 SARS coronavirus ExoN1 isolate P3pp23, complete genome 10014.t..a.ta...........t.999476
FJ882945.1 SARS coronavirus MA15 isolate P3pp6, complete genome 22959.....................22979100
FJ882945.1 SARS coronavirus MA15 isolate P3pp6, complete genome 10065.t..a.ta...........t.1004576
FJ882946.1 SARS coronavirus wtic-MB isolate P3pp13, complete genome 22927.....................22947100
FJ882946.1 SARS coronavirus wtic-MB isolate P3pp13, complete genome 10033.t..a.ta...........t.1001376
FJ882947.1 SARS coronavirus wtic-MB isolate P3pp7, complete genome 22926.....................22946100
FJ882947.1 SARS coronavirus wtic-MB isolate P3pp7, complete genome 10032.t..a.ta...........t.1001276
FJ882948.1 SARS coronavirus MA15 isolate P3pp3, complete genome 22959.....................22979100
FJ882948.1 SARS coronavirus MA15 isolate P3pp3, complete genome 10065.t..a.ta...........t.1004576
FJ882949.1 SARS coronavirus wtic-MB isolate P3pp23, complete genome 22927.....................22947100
FJ882949.1 SARS coronavirus wtic-MB isolate P3pp23, complete genome 10033.t..a.ta...........t.1001376
FJ882950.1 SARS coronavirus ExoN1 isolate P3pp60, complete genome 22926.....................22946100
FJ882950.1 SARS coronavirus ExoN1 isolate P3pp60, complete genome 10032.t..a.ta...........t.1001276
FJ882951.1 SARS coronavirus MA15 ExoN1 isolate P3pp3, complete genome 22959.....................22979100
FJ882951.1 SARS coronavirus MA15 ExoN1 isolate P3pp3, complete genome 10065.t..a.ta...........t.1004576
FJ882952.1 SARS coronavirus MA15 isolate P3pp4, complete genome 22959.....................22979100
FJ882952.1 SARS coronavirus MA15 isolate P3pp4, complete genome 10065.t..a.ta...........t.1004576
FJ882953.1 SARS coronavirus MA15 ExoN1 isolate P3pp4, complete genome 22928.....................22948100
FJ882953.1 SARS coronavirus MA15 ExoN1 isolate P3pp4, complete genome 10034.t..a.ta...........t.1001476
FJ882954.1 SARS coronavirus ExoN1 isolate P3pp46, complete genome 22919.....................22939100
FJ882954.1 SARS coronavirus ExoN1 isolate P3pp46, complete genome 10025.t..a.ta...........t.1000576
FJ882955.1 SARS coronavirus ExoN1 isolate P3pp19, complete genome 22926.....................22946100
FJ882955.1 SARS coronavirus ExoN1 isolate P3pp19, complete genome 10032.t..a.ta...........t.1001276
FJ882956.1 SARS coronavirus ExoN1 isolate P3pp53, complete genome 22926.....................22946100
FJ882956.1 SARS coronavirus ExoN1 isolate P3pp53, complete genome 10032.t..a.ta...........t.1001276
FJ882957.1 SARS coronavirus MA15, complete genome 22959.....................22979100
FJ882957.1 SARS coronavirus MA15, complete genome 10065.t..a.ta...........t.1004576
FJ882958.1 SARS coronavirus MA15 isolate P3pp7, complete genome 22959.....................22979100
FJ882958.1 SARS coronavirus MA15 isolate P3pp7, complete genome 10065.t..a.ta...........t.1004576
FJ882959.1 SARS coronavirus MA15 ExoN1 isolate P3pp6, complete genome 22959.....................22979100
FJ882959.1 SARS coronavirus MA15 ExoN1 isolate P3pp6, complete genome 10065.t..a.ta...........t.1004576
FJ882960.1 SARS coronavirus ExoN1 isolate P3pp34, complete genome 22926.....................22946100
FJ882960.1 SARS coronavirus ExoN1 isolate P3pp34, complete genome 10032.t..a.ta...........t.1001276
FJ882961.1 SARS coronavirus MA15 isolate P3pp5, complete genome 22959.....................22979100
FJ882961.1 SARS coronavirus MA15 isolate P3pp5, complete genome 10065.t..a.ta...........t.1004576
FJ882962.1 SARS coronavirus MA15 ExoN1 isolate P3pp10, complete genome 22959.....................22979100
FJ882962.1 SARS coronavirus MA15 ExoN1 isolate P3pp10, complete genome 10065.t..a.ta...........t.1004576
GU553363.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00001, complete genom22926.....................22946100
GU553363.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00001, complete genom10032.t..a.ta...........t.1001276
GU553364.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00002, complete genom22926.....................22946100
GU553364.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00002, complete genom10032.t..a.ta...........t.1001276
GU553365.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00003, complete genom22926.....................22946100
GU553365.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00003, complete genom10032.t..a.ta...........t.1001276
HQ890526.1 SARS coronavirus MA15 ExoN1 isolate d2ym1, complete genome 22926.....................22946100
HQ890526.1 SARS coronavirus MA15 ExoN1 isolate d2ym1, complete genome 10032.t..a.ta...........t.1001276
HQ890527.1 SARS coronavirus MA15 ExoN1 isolate d2ym2, complete genome 22926.....................22946100
HQ890527.1 SARS coronavirus MA15 ExoN1 isolate d2ym2, complete genome 10032.t..a.ta...........t.1001276
HQ890528.1 SARS coronavirus MA15 ExoN1 isolate d2ym3, complete genome 22926.....................22946100
HQ890528.1 SARS coronavirus MA15 ExoN1 isolate d2ym3, complete genome 10032.t..a.ta...........t.1001276
HQ890529.1 SARS coronavirus MA15 ExoN1 isolate d2ym4, complete genome 22926.....................22946100
HQ890529.1 SARS coronavirus MA15 ExoN1 isolate d2ym4, complete genome 10032.t..a.ta...........t.1001276
HQ890530.1 SARS coronavirus MA15 ExoN1 isolate d2ym5, complete genome 22926.....................22946100
HQ890530.1 SARS coronavirus MA15 ExoN1 isolate d2ym5, complete genome 10032.t..a.ta...........t.1001276
HQ890531.1 SARS coronavirus MA15 ExoN1 isolate d4ym1, complete genome 22926.....................22946100
HQ890531.1 SARS coronavirus MA15 ExoN1 isolate d4ym1, complete genome 10032.t..a.ta...........t.1001276
HQ890532.1 SARS coronavirus MA15 ExoN1 isolate d4ym2, complete genome 22926.....................22946100
HQ890532.1 SARS coronavirus MA15 ExoN1 isolate d4ym2, complete genome 10032.t..a.ta...........t.1001276
HQ890533.1 SARS coronavirus MA15 ExoN1 isolate d4ym3, complete genome 22926.....................22946100
HQ890533.1 SARS coronavirus MA15 ExoN1 isolate d4ym3, complete genome 10032.t..a.ta...........t.1001276
HQ890534.1 SARS coronavirus MA15 ExoN1 isolate d2om1, complete genome 22926.....................22946100
HQ890534.1 SARS coronavirus MA15 ExoN1 isolate d2om1, complete genome 10032.t..a.ta...........t.1001276
HQ890535.1 SARS coronavirus MA15 ExoN1 isolate d2om2, complete genome 22926.....................22946100
HQ890535.1 SARS coronavirus MA15 ExoN1 isolate d2om2, complete genome 10032.t..a.ta...........t.1001276
HQ890536.1 SARS coronavirus MA15 ExoN1 isolate d2om3, complete genome 22926.....................22946100
HQ890536.1 SARS coronavirus MA15 ExoN1 isolate d2om3, complete genome 10032.t..a.ta...........t.1001276
HQ890537.1 SARS coronavirus MA15 ExoN1 isolate d2om4, complete genome 22926.....................22946100
HQ890537.1 SARS coronavirus MA15 ExoN1 isolate d2om4, complete genome 10032.t..a.ta...........t.1001276
HQ890538.1 SARS coronavirus MA15 ExoN1 isolate d2om5, complete genome 22926.....................22946100
HQ890538.1 SARS coronavirus MA15 ExoN1 isolate d2om5, complete genome 10032.t..a.ta...........t.1001276
HQ890539.1 SARS coronavirus MA15 ExoN1 isolate d3om1, complete genome 22926.....................22946100
HQ890539.1 SARS coronavirus MA15 ExoN1 isolate d3om1, complete genome 10032.t..a.ta...........t.1001276
HQ890540.1 SARS coronavirus MA15 ExoN1 isolate d3om2, complete genome 22926.....................22946100
HQ890540.1 SARS coronavirus MA15 ExoN1 isolate d3om2, complete genome 10032.t..a.ta...........t.1001276
HQ890541.1 SARS coronavirus MA15 isolate d2ym1, complete genome 22926.....................22946100
HQ890541.1 SARS coronavirus MA15 isolate d2ym1, complete genome 10032.t..a.ta...........t.1001276
HQ890542.1 SARS coronavirus MA15 isolate d2om1, complete genome 22926.....................22946100
HQ890542.1 SARS coronavirus MA15 isolate d2om1, complete genome 10032.t..a.ta...........t.1001276
HQ890543.1 SARS coronavirus MA15 isolate d2om2, complete genome 22926.....................22946100
HQ890543.1 SARS coronavirus MA15 isolate d2om2, complete genome 10032.t..a.ta...........t.1001276
HQ890544.1 SARS coronavirus MA15 isolate d2om3, complete genome 22926.....................22946100
HQ890544.1 SARS coronavirus MA15 isolate d2om3, complete genome 10032.t..a.ta...........t.1001276
HQ890545.1 SARS coronavirus MA15 isolate d2om4, complete genome 22926.....................22946100
HQ890545.1 SARS coronavirus MA15 isolate d2om4, complete genome 10032.t..a.ta...........t.1001276
HQ890546.1 SARS coronavirus MA15 isolate d2om5, complete genome 22926.....................22946100
HQ890546.1 SARS coronavirus MA15 isolate d2om5, complete genome 10032.t..a.ta...........t.1001276
JF292902.1 SARS coronavirus MA15 ExoN1 isolate d4ym4, complete genome 22926.....................22946100
JF292902.1 SARS coronavirus MA15 ExoN1 isolate d4ym4, complete genome 10032.t..a.ta...........t.1001276
JF292903.1 SARS coronavirus MA15 ExoN1 isolate d4ym5, complete genome 22926.....................22946100
JF292903.1 SARS coronavirus MA15 ExoN1 isolate d4ym5, complete genome 10032.t..a.ta...........t.1001276
JF292904.1 SARS coronavirus MA15 ExoN1 isolate d3om3, complete genome 22926.....................22946100
JF292904.1 SARS coronavirus MA15 ExoN1 isolate d3om3, complete genome 10032.t..a.ta...........t.1001276
JF292905.1 SARS coronavirus MA15 ExoN1 isolate d3om4, complete genome 22926.....................22946100
JF292905.1 SARS coronavirus MA15 ExoN1 isolate d3om4, complete genome 10032.t..a.ta...........t.1001276
JF292906.1 SARS coronavirus MA15 ExoN1 isolate d3om5, complete genome 22926.....................22946100
JF292906.1 SARS coronavirus MA15 ExoN1 isolate d3om5, complete genome 10032.t..a.ta...........t.1001276
JF292907.1 SARS coronavirus MA15 isolate d2ym2, complete genome 22926.....................22946100
JF292907.1 SARS coronavirus MA15 isolate d2ym2, complete genome 10032.t..a.ta...........t.1001276
JF292908.1 SARS coronavirus MA15 isolate d2ym3, complete genome 22926.....................22946100
JF292908.1 SARS coronavirus MA15 isolate d2ym3, complete genome 10032.t..a.ta...........t.1001276
JF292909.1 SARS coronavirus MA15 isolate d2ym4, complete genome 22926.....................22946100
JF292909.1 SARS coronavirus MA15 isolate d2ym4, complete genome 10032.t..a.ta...........t.1001276
JF292910.1 SARS coronavirus MA15 isolate d2ym5, complete genome 22926.....................22946100
JF292910.1 SARS coronavirus MA15 isolate d2ym5, complete genome 10032.t..a.ta...........t.1001276
JF292911.1 SARS coronavirus MA15 isolate d4ym1, complete genome 22926.....................22946100
JF292911.1 SARS coronavirus MA15 isolate d4ym1, complete genome 10032.t..a.ta...........t.1001276
JF292912.1 SARS coronavirus MA15 isolate d4ym2, complete genome 22926.....................22946100
JF292912.1 SARS coronavirus MA15 isolate d4ym2, complete genome 10032.t..a.ta...........t.1001276
JF292913.1 SARS coronavirus MA15 isolate d4ym3, complete genome 22926.....................22946100
JF292913.1 SARS coronavirus MA15 isolate d4ym3, complete genome 10032.t..a.ta...........t.1001276
JF292914.1 SARS coronavirus MA15 isolate d4ym4, complete genome 22926.....................22946100
JF292914.1 SARS coronavirus MA15 isolate d4ym4, complete genome 10032.t..a.ta...........t.1001276
JF292915.1 SARS coronavirus MA15 isolate d4ym5, complete genome 22926.....................22946100
JF292915.1 SARS coronavirus MA15 isolate d4ym5, complete genome 10032.t..a.ta...........t.1001276
JF292916.1 SARS coronavirus MA15 isolate d3om1, complete genome 22926.....................22946100
JF292916.1 SARS coronavirus MA15 isolate d3om1, complete genome 10032.t..a.ta...........t.1001276
JF292917.1 SARS coronavirus MA15 isolate d3om2, complete genome 22926.....................22946100
JF292917.1 SARS coronavirus MA15 isolate d3om2, complete genome 10032.t..a.ta...........t.1001276
JF292918.1 SARS coronavirus MA15 isolate d3om3, complete genome 22926.....................22946100
JF292918.1 SARS coronavirus MA15 isolate d3om3, complete genome 10032.t..a.ta...........t.1001276
JF292919.1 SARS coronavirus MA15 isolate d3om4, complete genome 22926.....................22946100
JF292919.1 SARS coronavirus MA15 isolate d3om4, complete genome 10032.t..a.ta...........t.1001276
JF292920.1 SARS coronavirus MA15 isolate d3om5, complete genome 22926.....................22946100
JF292920.1 SARS coronavirus MA15 isolate d3om5, complete genome 10032.t..a.ta...........t.1001276
JF292921.1 SARS coronavirus wtic-MB isolate c1P1, complete genome 22926.....................22946100
JF292921.1 SARS coronavirus wtic-MB isolate c1P1, complete genome 10032.t..a.ta...........t.1001276
JF292922.1 SARS coronavirus ExoN1 isolate c5P1, complete genome 22926.....................22946100
JF292922.1 SARS coronavirus ExoN1 isolate c5P1, complete genome 10032.t..a.ta...........t.1001276
DQ412042.1 Bat SARS coronavirus Rf1, complete genome 10653..t.a.t.........g..._1063476
DQ648856.1 Bat coronavirus (BtCoV/273/2005), complete genome 10656..t.a.t.........g..._1063776
DQ071615.1 Bat SARS coronavirus Rp3, complete genome 10066.t..a.ta...........t.1004676
FJ588686.1 Bat SARS CoV Rs672/2006, complete genome 9474.t..a.ta...........t.945476