../../tmp/servers/virsirnadb/105693906
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi22361aactggcacactacttgtcga21
AY278491.2 SARS coronavirus HKU-39849, complete genome 20858.....................20878100
AY278554.2 SARS coronavirus CUHK-W1, complete genome 20843.....................20863100
AY278741.1 SARS coronavirus Urbani, complete genome 20858.....................20878100
AY278488.2 SARS coronavirus BJ01, complete genome 20839.....................20859100
AY283794.1 SARS coronavirus Sin2500, complete genome 20842.....................20862100
AY283795.1 SARS coronavirus Sin2677, complete genome 20842.....................20862100
AY283796.1 SARS coronavirus Sin2679, complete genome 20842.....................20862100
AY283797.1 SARS coronavirus Sin2748, complete genome 20842.....................20862100
AY291451.1 SARS coronavirus TW1, complete genome 20858.....................20878100
AY297028.1 SARS coronavirus ZJ01, complete genome 20849.....................20869100
AY278489.2 SARS coronavirus GD01, complete genome 20842.....................20862100
AY278490.3 SARS coronavirus BJ03, complete genome 20854.....................20874100
AY279354.2 SARS coronavirus BJ04, complete genome 20842.....................20862100
AY291315.1 SARS coronavirus Frankfurt 1, complete genome 20858.....................20878100
AY321118.1 SARS coronavirus TWC, complete genome 20858.....................20878100
AY338174.1 SARS coronavirus Taiwan TC1, complete genome 20789.....................20809100
AY338175.1 SARS coronavirus Taiwan TC2, complete genome 20789.....................20809100
AY345986.1 SARS coronavirus CUHK-AG01, complete genome 20843.....................20863100
AY345987.1 SARS coronavirus CUHK-AG02, complete genome 20843.....................20863100
AY345988.1 SARS coronavirus CUHK-AG03, complete genome 20843.....................20863100
AY323977.2 SARS coronavirus HSR 1, complete genome 20858.....................20878100
AY348314.1 SARS coronavirus Taiwan TC3, complete genome 20789.....................20809100
AY351680.1 SARS coronavirus ZMY 1, complete genome 20878.....................20898100
AP006557.1 SARS coronavirus TWH genomic RNA, complete genome 20858.....................20878100
AP006558.1 SARS coronavirus TWJ genomic RNA, complete genome 20858.....................20878100
AP006559.1 SARS coronavirus TWK genomic RNA, complete genome 20858.....................20878100
AP006560.1 SARS coronavirus TWS genomic RNA, complete genome 20858.....................20878100
AP006561.1 SARS coronavirus TWY genomic RNA, complete genome 20858.....................20878100
AY362698.1 SARS coronavirus TWC2, complete genome 20858.....................20878100
AY362699.1 SARS coronavirus TWC3, complete genome 20858.....................20878100
AY310120.1 SARS coronavirus FRA, complete genome 20858.....................20878100
AY304486.1 SARS coronavirus SZ3, complete genome 20843.....................20863100
AY304488.1 SARS coronavirus SZ16, complete genome 20843.....................20863100
AY304495.1 SARS coronavirus GZ50, complete genome 20843.....................20863100
AY283798.2 SARS coronavirus Sin2774, complete genome 20842.....................20862100
AY427439.1 SARS coronavirus AS, complete genome 20842.....................20862100
AY394978.1 SARS coronavirus GZ-B, complete genome 20786.....................20806100
AY394979.1 SARS coronavirus GZ-C, complete genome 20806.....................20826100
AY394980.1 SARS coronavirus GZ-D, partial genome 20812.....................20832100
AY394981.1 SARS coronavirus HGZ8L1-A, partial genome 20807.....................20827100
AY394982.1 SARS coronavirus HGZ8L1-B, partial genome 20806.....................20826100
AY394983.1 SARS coronavirus HSZ2-A, complete genome 20806.....................20826100
AY394984.1 SARS coronavirus HSZ-A, partial genome 20811.....................20831100
AY394985.1 SARS coronavirus HSZ-Bb, complete genome 20608.....................20628100
AY394986.1 SARS coronavirus HSZ-Cb, complete genome 20807.....................20827100
AY394987.1 SARS coronavirus HZS2-Fb, complete genome 20816.....................20836100
AY394988.1 SARS coronavirus JMD, partial genome 20772.....................20792100
AY394989.1 SARS coronavirus HZS2-D, complete genome 20843.....................20863100
AY394990.1 SARS coronavirus HZS2-E, complete genome 20843.....................20863100
AY394991.1 SARS coronavirus HZS2-Fc, complete genome 20843.....................20863100
AY394992.1 SARS coronavirus HZS2-C, complete genome 20843.....................20863100
AY394993.1 SARS coronavirus HGZ8L2, complete genome 20843.....................20863100
AY394994.1 SARS coronavirus HSZ-Bc, complete genome 20843.....................20863100
AY394995.1 SARS coronavirus HSZ-Cc, complete genome 20843.....................20863100
AY394996.1 SARS coronavirus ZS-B, complete genome 20843.....................20863100
AY394997.1 SARS coronavirus ZS-A, complete genome 20843.....................20863100
AY394998.1 SARS coronavirus LC1, complete genome 20843.....................20863100
AY394999.1 SARS coronavirus LC2, complete genome 20843.....................20863100
AY395000.1 SARS coronavirus LC3, complete genome 20843.....................20863100
AY395001.1 SARS coronavirus LC4, complete genome 20843.....................20863100
AY395002.1 SARS coronavirus LC5, complete genome 20843.....................20863100
AY395003.1 SARS coronavirus ZS-C, complete genome 20807.....................20827100
AY395004.1 SARS coronavirus HZS2-Bb, partial genome 20811.....................20831100
AY313906.1 SARS coronavirus GD69, complete genome 20869.....................20889100
AY350750.1 SARS coronavirus PUMC01, complete genome 20845.....................20865100
AY357075.1 SARS coronavirus PUMC02, complete genome 20844.....................20864100
AY357076.1 SARS coronavirus PUMC03, complete genome 20844.....................20864100
AY282752.2 SARS coronavirus CUHK-Su10, complete genome 20843.....................20863100
AY461660.1 SARS coronavirus SoD, complete genome 20843.....................20863100
AY485277.1 SARS coronavirus Sino1-11, complete genome 20858.....................20878100
AY485278.1 SARS coronavirus Sino3-11, complete genome 20858.....................20878100
AY463059.1 SARS coronavirus ShanghaiQXC1, complete genome 20779.....................20799100
AY463060.1 SARS coronavirus ShanghaiQXC2, complete genome 20200.....................20220100
AY502923.1 SARS coronavirus TW10, complete genome 20858.....................20878100
AY502924.1 SARS coronavirus TW11, complete genome 20858.....................20878100
AY502925.1 SARS coronavirus TW2, complete genome 20858.....................20878100
AY502926.1 SARS coronavirus TW3, complete genome 20858.....................20878100
AY502927.1 SARS coronavirus TW4, complete genome 20858.....................20878100
AY502928.1 SARS coronavirus TW5, complete genome 20858.....................20878100
AY502929.1 SARS coronavirus TW6, complete genome 20858.....................20878100
AY502930.1 SARS coronavirus TW7, complete genome 20858.....................20878100
AY502931.1 SARS coronavirus TW8, complete genome 20858.....................20878100
AY502932.1 SARS coronavirus TW9, complete genome 20858.....................20878100
AY394850.2 SARS coronavirus WHU, complete genome 20858.....................20878100
AY508724.1 SARS coronavirus NS-1, complete genome 20842.....................20862100
AY390556.1 SARS coronavirus GZ02, complete genome 20858.....................20878100
AY515512.1 SARS coronavirus HC/SZ/61/03, complete genome 20835.....................20855100
AY545914.1 SARS coronavirus isolate HC/SZ/79/03, complete genome 20835.....................20855100
AY545915.1 SARS coronavirus isolate HC/SZ/DM1/03, complete genome 20826.....................20846100
AY545916.1 SARS coronavirus isolate HC/SZ/266/03, complete genome 20824.....................20844100
AY545918.1 SARS coronavirus isolate HC/GZ/32/03, complete genome 20824.....................20844100
AY545919.1 SARS coronavirus isolate CFB/SZ/94/03, complete genome 20837.....................20857100
AY559081.1 SARS coronavirus Sin842, complete genome 20846.....................20866100
AY559082.1 SARS coronavirus Sin852, complete genome 20857.....................20877100
AY559083.1 SARS coronavirus Sin3408, complete genome 20892.....................20912100
AY559084.1 SARS coronavirus Sin3765V, complete genome 20842.....................20862100
AY559085.1 SARS coronavirus Sin848, complete genome 20842.....................20862100
AY559086.1 SARS coronavirus Sin849, complete genome 20842.....................20862100
AY559087.1 SARS coronavirus Sin3725V, complete genome 20842.....................20862100
AY559088.1 SARS coronavirus SinP1, complete genome 20843.....................20863100
AY559089.1 SARS coronavirus SinP2, complete genome 20849.....................20869100
AY559090.1 SARS coronavirus SinP3, complete genome 20851.....................20871100
AY559091.1 SARS coronavirus SinP4, complete genome 20842.....................20862100
AY559092.1 SARS coronavirus SinP5, complete genome 20842.....................20862100
AY559093.1 SARS coronavirus Sin845, complete genome 20842.....................20862100
AY559094.1 SARS coronavirus Sin846, complete genome 20844.....................20864100
AY559095.1 SARS coronavirus Sin847, complete genome 20848.....................20868100
AY559096.1 SARS coronavirus Sin850, complete genome 20850.....................20870100
AY559097.1 SARS coronavirus Sin3408L, complete genome 20843.....................20863100
AY568539.1 SARS coronavirus GZ0401, complete genome 20808.....................20828100
AY595412.1 SARS coronavirus LLJ-2004, complete genome 20836.....................20856100
AY654624.1 SARS coronavirus TJF, complete genome 20857.....................20877100
AY572034.1 SARS coronavirus civet007, complete genome 20832.....................20852100
AY572035.1 SARS coronavirus civet010, complete genome 20810.....................20830100
AY572038.1 SARS coronavirus civet020, complete genome 20787.....................20807100
AY714217.1 SARS Coronavirus CDC#200301157, complete genome 20858.....................20878100
AY613947.1 SARS coronavirus GZ0402, complete genome 20808.....................20828100
AY613948.1 SARS coronavirus PC4-13, complete genome 20808.....................20828100
AY613949.1 SARS coronavirus PC4-136, complete genome 20808.....................20828100
AY686864.1 SARS coronavirus B039, complete genome 20817.....................20837100
CQ918584.1 Sequence 1 from Patent WO2004096842 20843.....................20863100
CQ918585.1 Sequence 2 from Patent WO2004096842 20843.....................20863100
CQ918598.1 Sequence 15 from Patent WO2004096842 20858.....................20878100
AY686863.1 SARS coronavirus A022, complete genome 20807.....................20827100
AY772062.1 SARS coronavirus WH20, complete genome 20868.....................20888100
CS079026.1 Sequence 14 from Patent WO2005035556 20858.....................20878100
CS079027.1 Sequence 15 from Patent WO2005035556 20858.....................20878100
CS079028.1 Sequence 16 from Patent WO2005035556 20858.....................20878100
CS079029.1 Sequence 17 from Patent WO2005035556 20843.....................20863100
AY864805.1 SARS coronavirus BJ162, complete genome 20858.....................20878100
AY864806.1 SARS coronavirus BJ202, complete genome 20858.....................20878100
DQ182595.1 SARS coronavirus ZJ0301 from China, complete genome 20842.....................20862100
CS254197.1 Sequence 67 from Patent WO2004011647 20858.....................20878100
AB257344.1 SARS coronavirus Frankfurt 1 genomic RNA, nearly complete genome, clo20817.....................20837100
DQ497008.1 SARS coronavirus strain MA-15, complete genome 20858.....................20878100
DQ640652.1 SARS coronavirus GDH-BJH01, complete genome 20864.....................20884100
DQ898174.1 SARS coronavirus strain CV7, complete genome 20858.....................20878100
CS569493.1 Sequence 1 from Patent WO2006039656 20858.....................20878100
EU371559.1 SARS coronavirus ZJ02, complete genome 20858.....................20878100
EU371560.1 SARS coronavirus BJ182a, complete genome 20858.....................20878100
EU371561.1 SARS coronavirus BJ182b, complete genome 20858.....................20878100
EU371562.1 SARS coronavirus BJ182-4, complete genome 20858.....................20878100
EU371563.1 SARS coronavirus BJ182-8, complete genome 20858.....................20878100
EU371564.1 SARS coronavirus BJ182-12, complete genome 20858.....................20878100
FJ882963.1 SARS coronavirus P2, complete genome 20839.....................20859100
FJ588686.1 Bat SARS CoV Rs672/2006, complete genome 20260.....................20280100
FJ959407.1 SARS coronavirus isolate A001, complete genome 20787.....................20807100
FJ882926.1 SARS coronavirus ExoN1, complete genome 20826.....................20846100
FJ882927.1 SARS coronavirus wtic-MB isolate P1pp1, complete genome 20838.....................20858100
FJ882928.1 SARS coronavirus ExoN1 isolate P1pp1, complete genome 20838.....................20858100
FJ882929.1 SARS coronavirus ExoN1 isolate P3pp1, complete genome 20837.....................20857100
FJ882930.1 SARS coronavirus ExoN1, complete genome 20838.....................20858100
FJ882931.1 SARS coronavirus ExoN1 isolate P3pp12, complete genome 20818.....................20838100
FJ882932.1 SARS coronavirus wtic-MB isolate P3pp14, complete genome 20818.....................20838100
FJ882933.1 SARS coronavirus wtic-MB isolate P3pp6, complete genome 20820.....................20840100
FJ882934.1 SARS coronavirus wtic-MB isolate P3pp29, complete genome 20818.....................20838100
FJ882935.1 SARS coronavirus wtic-MB isolate P3pp21, complete genome 20819.....................20839100
FJ882936.1 SARS coronavirus wtic-MB isolate P3pp2, complete genome 20818.....................20838100
FJ882937.1 SARS coronavirus wtic-MB isolate P3pp18, complete genome 20820.....................20840100
FJ882938.1 SARS coronavirus wtic-MB, complete genome 20838.....................20858100
FJ882939.1 SARS coronavirus wtic-MB isolate P3pp16, complete genome 20818.....................20838100
FJ882940.1 SARS coronavirus ExoN1 isolate P3pp37, complete genome 20818.....................20838100
FJ882941.1 SARS coronavirus ExoN1 isolate P3pp8, complete genome 20837.....................20857100
FJ882942.1 SARS coronavirus MA15 ExoN1 isolate P3pp5, complete genome 20851.....................20871100
FJ882943.1 SARS coronavirus MA15 ExoN1, complete genome 20851.....................20871100
FJ882944.1 SARS coronavirus ExoN1 isolate P3pp23, complete genome 20800.....................20820100
FJ882945.1 SARS coronavirus MA15 isolate P3pp6, complete genome 20851.....................20871100
FJ882946.1 SARS coronavirus wtic-MB isolate P3pp13, complete genome 20819.....................20839100
FJ882947.1 SARS coronavirus wtic-MB isolate P3pp7, complete genome 20818.....................20838100
FJ882948.1 SARS coronavirus MA15 isolate P3pp3, complete genome 20851.....................20871100
FJ882949.1 SARS coronavirus wtic-MB isolate P3pp23, complete genome 20819.....................20839100
FJ882950.1 SARS coronavirus ExoN1 isolate P3pp60, complete genome 20818.....................20838100
FJ882951.1 SARS coronavirus MA15 ExoN1 isolate P3pp3, complete genome 20851.....................20871100
FJ882952.1 SARS coronavirus MA15 isolate P3pp4, complete genome 20851.....................20871100
FJ882953.1 SARS coronavirus MA15 ExoN1 isolate P3pp4, complete genome 20820.....................20840100
FJ882954.1 SARS coronavirus ExoN1 isolate P3pp46, complete genome 20811.....................20831100
FJ882955.1 SARS coronavirus ExoN1 isolate P3pp19, complete genome 20818.....................20838100
FJ882956.1 SARS coronavirus ExoN1 isolate P3pp53, complete genome 20818.....................20838100
FJ882957.1 SARS coronavirus MA15, complete genome 20851.....................20871100
FJ882958.1 SARS coronavirus MA15 isolate P3pp7, complete genome 20851.....................20871100
FJ882959.1 SARS coronavirus MA15 ExoN1 isolate P3pp6, complete genome 20851.....................20871100
FJ882960.1 SARS coronavirus ExoN1 isolate P3pp34, complete genome 20818.....................20838100
FJ882961.1 SARS coronavirus MA15 isolate P3pp5, complete genome 20851.....................20871100
FJ882962.1 SARS coronavirus MA15 ExoN1 isolate P3pp10, complete genome 20851.....................20871100
GU553363.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00001, complete genom20818.....................20838100
GU553364.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00002, complete genom20818.....................20838100
GU553365.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00003, complete genom20818.....................20838100
HQ890526.1 SARS coronavirus MA15 ExoN1 isolate d2ym1, complete genome 20818.....................20838100
HQ890527.1 SARS coronavirus MA15 ExoN1 isolate d2ym2, complete genome 20818.....................20838100
HQ890528.1 SARS coronavirus MA15 ExoN1 isolate d2ym3, complete genome 20818.....................20838100
HQ890529.1 SARS coronavirus MA15 ExoN1 isolate d2ym4, complete genome 20818.....................20838100
HQ890530.1 SARS coronavirus MA15 ExoN1 isolate d2ym5, complete genome 20818.....................20838100
HQ890531.1 SARS coronavirus MA15 ExoN1 isolate d4ym1, complete genome 20818.....................20838100
HQ890532.1 SARS coronavirus MA15 ExoN1 isolate d4ym2, complete genome 20818.....................20838100
HQ890533.1 SARS coronavirus MA15 ExoN1 isolate d4ym3, complete genome 20818.....................20838100
HQ890534.1 SARS coronavirus MA15 ExoN1 isolate d2om1, complete genome 20818.....................20838100
HQ890535.1 SARS coronavirus MA15 ExoN1 isolate d2om2, complete genome 20818.....................20838100
HQ890536.1 SARS coronavirus MA15 ExoN1 isolate d2om3, complete genome 20818.....................20838100
HQ890537.1 SARS coronavirus MA15 ExoN1 isolate d2om4, complete genome 20818.....................20838100
HQ890538.1 SARS coronavirus MA15 ExoN1 isolate d2om5, complete genome 20818.....................20838100
HQ890539.1 SARS coronavirus MA15 ExoN1 isolate d3om1, complete genome 20818.....................20838100
HQ890540.1 SARS coronavirus MA15 ExoN1 isolate d3om2, complete genome 20818.....................20838100
HQ890541.1 SARS coronavirus MA15 isolate d2ym1, complete genome 20818.....................20838100
HQ890542.1 SARS coronavirus MA15 isolate d2om1, complete genome 20818.....................20838100
HQ890543.1 SARS coronavirus MA15 isolate d2om2, complete genome 20818.....................20838100
HQ890544.1 SARS coronavirus MA15 isolate d2om3, complete genome 20818.....................20838100
HQ890545.1 SARS coronavirus MA15 isolate d2om4, complete genome 20818.....................20838100
HQ890546.1 SARS coronavirus MA15 isolate d2om5, complete genome 20818.....................20838100
JF292902.1 SARS coronavirus MA15 ExoN1 isolate d4ym4, complete genome 20818.....................20838100
JF292903.1 SARS coronavirus MA15 ExoN1 isolate d4ym5, complete genome 20818.....................20838100
JF292904.1 SARS coronavirus MA15 ExoN1 isolate d3om3, complete genome 20818.....................20838100
JF292905.1 SARS coronavirus MA15 ExoN1 isolate d3om4, complete genome 20818.....................20838100
JF292906.1 SARS coronavirus MA15 ExoN1 isolate d3om5, complete genome 20818.....................20838100
JF292907.1 SARS coronavirus MA15 isolate d2ym2, complete genome 20818.....................20838100
JF292908.1 SARS coronavirus MA15 isolate d2ym3, complete genome 20818.....................20838100
JF292909.1 SARS coronavirus MA15 isolate d2ym4, complete genome 20818.....................20838100
JF292910.1 SARS coronavirus MA15 isolate d2ym5, complete genome 20818.....................20838100
JF292911.1 SARS coronavirus MA15 isolate d4ym1, complete genome 20818.....................20838100
JF292912.1 SARS coronavirus MA15 isolate d4ym2, complete genome 20818.....................20838100
JF292913.1 SARS coronavirus MA15 isolate d4ym3, complete genome 20818.....................20838100
JF292914.1 SARS coronavirus MA15 isolate d4ym4, complete genome 20818.....................20838100
JF292915.1 SARS coronavirus MA15 isolate d4ym5, complete genome 20818.....................20838100
JF292916.1 SARS coronavirus MA15 isolate d3om1, complete genome 20818.....................20838100
JF292917.1 SARS coronavirus MA15 isolate d3om2, complete genome 20818.....................20838100
JF292918.1 SARS coronavirus MA15 isolate d3om3, complete genome 20818.....................20838100
JF292919.1 SARS coronavirus MA15 isolate d3om4, complete genome 20818.....................20838100
JF292920.1 SARS coronavirus MA15 isolate d3om5, complete genome 20818.....................20838100
JF292921.1 SARS coronavirus wtic-MB isolate c1P1, complete genome 20818.....................20838100
JF292922.1 SARS coronavirus ExoN1 isolate c5P1, complete genome 20818.....................20838100
AY278487.3 SARS coronavirus BJ02, complete genome 20859_....................2087895
AY545917.1 SARS coronavirus isolate HC/GZ/81/03, complete genome 20822..t..................2084295
AY613950.1 SARS coronavirus PC4-227, complete genome 20808..t..................2082895
DQ084199.1 bat SARS coronavirus HKU3-2, complete genome 20820..................t..2084095
DQ084200.1 bat SARS coronavirus HKU3-3, complete genome 20820..................t..2084095
DQ071615.1 Bat SARS coronavirus Rp3, complete genome 20852..................t..2087295
DQ022305.2 Bat SARS coronavirus HKU3-1, complete genome 20837..................t..2085795
DQ412042.1 Bat SARS coronavirus Rf1, complete genome 20839..t..................2085995
DQ412043.1 Bat SARS coronavirus Rm1, complete genome 20872..................t..2089295
DQ648856.1 Bat coronavirus (BtCoV/273/2005), complete genome 20842..t..................2086295
GQ153539.1 Bat SARS coronavirus HKU3-4, complete genome 20837..................t..2085795
GQ153540.1 Bat SARS coronavirus HKU3-5, complete genome 20837..................t..2085795
GQ153541.1 Bat SARS coronavirus HKU3-6, complete genome 20837..................t..2085795
GQ153544.1 Bat SARS coronavirus HKU3-9, complete genome 20828..................t..2084895
GQ153545.1 Bat SARS coronavirus HKU3-10, complete genome 20828..................t..2084895
GQ153546.1 Bat SARS coronavirus HKU3-11, complete genome 20828..................t..2084895
GQ153547.1 Bat SARS coronavirus HKU3-12, complete genome 20837..................t..2085795
GQ153548.1 Bat SARS coronavirus HKU3-13, complete genome 20810..................t..2083095
DQ648857.1 Bat coronavirus (BtCoV/279/2005), complete genome 20875.......g..........t..2089590
GQ153542.1 Bat SARS coronavirus HKU3-7, complete genome 20849...c..............t..2086990
GQ153543.1 Bat SARS coronavirus HKU3-8, complete genome 20849...c..............t..2086990