../../tmp/servers/virsirnadb/542090327
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi11431aagaatcctcacaataccgca21
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 223.....................243100
X02763.1 Hepatitis b virus genome (serotype adw2) 1632.....................1652100
X65257.1 Hepatitis B virus (ayw,patient C) PreS1, PreS2, PreC, C, X and polyme225.....................245100
X65258.1 Hepatitis B virus (ayw,patient CI) genes PreS1, PreS2, PreC, C, X and225.....................245100
X65259.1 Hepatitis B virus (ayw,patient E) genes PreS1, PreS2, PreC, C, X and 225.....................245100
X68292.1 Hepatitis B Virus DNA 225.....................245100
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 223.....................243100
V01460.1 Hepatitis B virus (strain ayw) genome 2962.....................2942100
X02496.1 Human hepatitis B virus strain ayw variant 225.....................245100
S50225.1 {HBV variant} [hepatitis B virus HBV, surface antigen-negative patien225.....................245100
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 223.....................243100
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 225.....................245100
X59795.1 Hepatitis B virus (ayw subtype mutant) complete genome 204.....................224100
Z35716.1 Human hepatitis B virus (ayw4) genes for surface protein S, core prot225.....................245100
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot225.....................245100
X85254.1 Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polym225.....................245100
X80924.1 Hepatitis B virus (patient 4) complete genome 225.....................245100
X80926.1 Hepatitis B virus (patient 5) complete genome 225.....................245100
X80925.1 Hepatitis B virus (patient 6) complete genome 225.....................245100
X51970.1 Hepatitis B virus (HBV 991) complete genome 223.....................243100
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes223.....................243100
Z72479.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes223.....................243100
X97848.1 Hepatitis B virus (patient 2) complete genome 225.....................245100
X97849.1 Hepatitis B virus (patient 3) complete genome 225.....................245100
Y07587.1 Hepatitis B virus, complete genome 225.....................245100
U95551.1 Hepatitis B virus subtype ayw, complete genome 225.....................245100
AF043593.1 Hepatitis B virus isolate 6/89, complete genome 211.....................231100
AF043594.1 Hepatitis B virus isolate 1/91, complete genome 223.....................243100
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 223.....................243100
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 223.....................243100
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 225.....................245100
AF143298.1 Hepatitis B virus clone 7720-G8, complete genome 1568.....................1588100
AF143300.1 Hepatitis B virus clone 7832-G4, complete genome 1466.....................1486100
AF143301.1 Hepatitis B virus clone BW1903, complete genome 1436.....................1456100
AF143302.1 Hepatitis B virus clone HD1402, complete genome 1535.....................1555100
AF143303.1 Hepatitis B virus clone HD1406, complete genome 1535.....................1555100
AF143304.1 Hepatitis B virus clone HD319, complete genome 1544.....................1564100
AF143305.1 Hepatitis B virus clone RM501, complete genome 1499.....................1519100
AF143306.1 Hepatitis B virus clone RM517, complete genome 1535.....................1555100
AF143307.1 Hepatitis B virus clone RM518, complete genome 1370.....................1390100
AF143308.1 Hepatitis B virus clone WB1254, complete genome 1436.....................1456100
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 2071.....................2091100
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 2071.....................2091100
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 2071.....................2091100
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 2071.....................2091100
AF151735.1 Hepatitis B virus, complete genome 223.....................243100
AB033558.1 Hepatitis B virus DNA, complete genome, isolate:JYW796 223.....................243100
AB033559.1 Hepatitis B virus DNA, complete genome, isolate:PYW310 223.....................243100
AF121239.1 Hepatitis B virus isolate HBV/1303, complete genome 223.....................243100
AF121240.1 Hepatitis B virus isolate HBV/11066, complete genome 223.....................243100
AF121241.1 Hepatitis B virus isolate HBV/1758, complete genome 223.....................243100
AF160501.1 Hepatitis B virus strain IG29227, complete genome 223.....................243100
AF280817.1 Hepatitis B virus DNA, complete sequence, isolate: HBV-D1 223.....................243100
AF241410.1 Hepatitis B virus isolate 3270, complete genome 223.....................243100
AF241411.1 Hepatitis B virus isolate 8290, complete genome 223.....................243100
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 223.....................243100
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 223.....................243100
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 223.....................243100
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 223.....................243100
AY034878.1 Hepatitis B virus isolate HBVKL, complete genome 1619.....................1639100
AX155589.1 Sequence 1 from Patent WO0140279 223.....................243100
AJ309369.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 10223.....................243100
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11223.....................243100
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11223.....................243100
AF297619.1 Hepatitis B virus adw2, complete genome 223.....................243100
AF297620.1 Hepatitis B virus adw1, complete genome 223.....................243100
AF297621.1 Hepatitis B virus isolate 78, complete genome 223.....................243100
AF297622.1 Hepatitis B virus isolate 79, complete genome 223.....................243100
AF297623.1 Hepatitis B virus isolate 83, complete genome 172.....................192100
AF297624.1 Hepatitis B virus isolate 80, complete genome 223.....................243100
AF297625.1 Hepatitis B virus isolate 84, complete genome 223.....................243100
AB056513.1 Hepatitis B virus DNA, complete genome, clone:USG17 223.....................243100
AB056514.1 Hepatitis B virus DNA, complete genome, clone:USG15 214.....................234100
AB056515.1 Hepatitis B virus DNA, complete genome, clone:USG16 223.....................243100
AB056516.1 Hepatitis B virus DNA, complete genome, clone:USG18 501.....................521100
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 223.....................243100
AB064310.1 Hepatitis B virus DNA, complete genome, clone:USG769 223.....................243100
AB064311.1 Hepatitis B virus DNA, complete genome, clone:USG825 223.....................243100
AB064312.1 Hepatitis B virus DNA, complete genome, clone:USG916 223.....................243100
AB064313.1 Hepatitis B virus DNA, complete genome, clone:USG2638 223.....................243100
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 223.....................243100
AF461043.1 Hepatitis B virus, complete genome 223.....................243100
AF462041.1 Hepatitis B virus clone pAM6, complete genome 223.....................243100
AJ344115.1 Hepatitis B virus complete genome, genotype A, isolate X27 223.....................243100
AJ344116.1 Hepatitis B virus complete genome, genotype D, isolate GX27 223.....................243100
AJ344117.1 Hepatitis B virus complete genome, genotype D 223.....................243100
U87742.3 Hepatitis B virus isolate 7983, complete genome 225.....................245100
U87746.3 Hepatitis B virus isolate 7782, complete genome 225.....................245100
AY090453.1 Hepatitis B virus strain 14-94, complete genome 226.....................246100
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro223.....................243100
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro223.....................243100
AY128092.1 Hepatitis B virus clone pEco63, complete genome 225.....................245100
AF537371.1 Hepatitis B virus clone 3.4, complete genome 223.....................243100
AF537372.1 Hepatitis B virus clone 4B, complete genome 223.....................243100
AF418674.1 Hepatitis B virus patient 1185 clone 1, complete genome 225.....................245100
AF418675.1 Hepatitis B virus patient 1185 clone 2, complete genome 225.....................245100
AF418676.1 Hepatitis B virus patient 567 clone 1, complete genome 208.....................228100
AF418677.1 Hepatitis B virus patient 567 clone 2, complete genome 208.....................228100
AF418678.1 Hepatitis B virus patient 567 clone 3, complete genome 169.....................189100
AF418679.1 Hepatitis B virus patient 821 clone 1, complete genome 225.....................245100
AF418680.1 Hepatitis B virus patient 821 clone 2, complete genome 225.....................245100
AF418681.1 Hepatitis B virus patient 821 clone 3, complete genome 225.....................245100
AF418684.1 Hepatitis B virus patient 313 clone 1, complete genome 225.....................245100
AF418685.1 Hepatitis B virus patient 313 clone 2, complete genome 225.....................245100
AF418686.1 Hepatitis B virus patient 313 clone 3, complete genome 225.....................245100
AF418687.1 Hepatitis B virus patient 313 clone 4, complete genome 222.....................242100
AF418688.1 Hepatitis B virus patient 313 clone 5, complete genome 225.....................245100
AF418689.1 Hepatitis B virus patient 313 clone 6, complete genome 225.....................245100
AF418690.1 Hepatitis B virus patient 313 clone 7, complete genome 225.....................245100
AF418691.1 Hepatitis B virus patient 313 clone 8, complete genome 225.....................245100
AF418692.1 Hepatitis B virus patient 313 clone 9, complete genome 225.....................245100
AY152726.1 Hepatitis B virus isolate 8.22, complete genome 223.....................243100
AY161138.1 Hepatitis B virus clone S1.1 complete genome 223.....................243100
AY161139.1 Hepatitis B virus clone S1.2 complete genome 223.....................243100
AY161140.1 Hepatitis B virus clone S2.1 complete genome 223.....................243100
AY161141.1 Hepatitis B virus clone S2.2 complete genome 223.....................243100
AY161142.1 Hepatitis B virus clone S3.1, complete genome 169.....................189100
AY161143.1 Hepatitis B virus clone S3.2, complete genome 208.....................228100
AY161144.1 Hepatitis B virus clone S3.3, complete genome 208.....................228100
AY161147.1 Hepatitis B virus clone S5.1 complete genome 223.....................243100
AY161148.1 Hepatitis B virus clone S5.2 complete genome 221.....................241100
AY161149.1 Hepatitis B virus clone S5.3 complete genome 223.....................243100
AY161150.1 Hepatitis B virus clone S6.1 complete genome 223.....................243100
AY161151.1 Hepatitis B virus clone S6.2, complete genome 223.....................243100
AY161152.1 Hepatitis B virus clone S6.3, complete genome 223.....................243100
AY161153.1 Hepatitis B virus clone S6.4 complete genome 223.....................243100
AY161154.1 Hepatitis B virus clone S6.5, complete genome 223.....................243100
AY161155.1 Hepatitis B virus clone S6.6, complete genome 223.....................243100
AY161156.1 Hepatitis B virus clone S6.7, complete genome 223.....................243100
AY161157.1 Hepatitis B virus clone S7.1 complete genome 223.....................243100
AY161158.1 Hepatitis B virus clone S7.2 complete genome 223.....................243100
AY161159.1 Hepatitis B virus clone S8.1 complete genome 223.....................243100
AY161160.1 Hepatitis B virus clone S8.2 complete genome 223.....................243100
AY161161.1 Hepatitis B virus clone S9.1 complete genome 223.....................243100
AY161162.1 Hepatitis B virus clone S9.2 complete genome 223.....................243100
AY161163.1 Hepatitis B virus clone S9.3 complete genome 223.....................243100
AB078032.1 Hepatitis B virus complete genome, isolate:AH1-SY 223.....................243100
AB090268.1 Hepatitis B virus DNA, complete genome, strain:CH1-OHs 223.....................243100
AB090269.1 Hepatitis B virus DNA, complete genome, strain:CH2-OHf 223.....................243100
AB090270.1 Hepatitis B virus DNA, complete genome, strain:b-dono12 223.....................243100
AB078031.2 Hepatitis B virus complete genome, isolate:FH1-YS 223.....................243100
AB078033.2 Hepatitis B virus complete genome, isolate:IS1-OY 223.....................243100
AB104709.1 Hepatitis B virus DNA, complete sequence, isolate: EG64 225.....................245100
AB104710.1 Hepatitis B virus DNA, complete sequence, isolate: EG105 225.....................245100
AB104711.1 Hepatitis B virus DNA, complete sequence, isolate: EG104 225.....................245100
AB104712.1 Hepatitis B virus DNA, complete sequence, isolate: EG75 225.....................245100
AY233274.1 Hepatitis B virus isolate 0962 complete genome 223.....................243100
AY233275.1 Hepatitis B virus isolate 163 complete genome 223.....................243100
AY233276.1 Hepatitis B virus isolate 1839 complete genome 223.....................243100
AY233277.1 Hepatitis B virus isolate 1848 complete genome 223.....................243100
AY233278.1 Hepatitis B virus isolate 1 complete genome 223.....................243100
AY233279.1 Hepatitis B virus isolate 28 complete genome 223.....................243100
AY233280.1 Hepatitis B virus isolate 2 complete genome 223.....................243100
AY233281.1 Hepatitis B virus isolate 303 complete genome 223.....................243100
AY233282.1 Hepatitis B virus isolate 306 complete genome 223.....................243100
AY233283.1 Hepatitis B virus isolate 4038 complete genome 223.....................243100
AY233284.1 Hepatitis B virus isolate 5283 complete genome 223.....................243100
AY233285.1 Hepatitis B virus isolate 795 complete genome 223.....................243100
AY233286.1 Hepatitis B virus isolate 818 complete genome 223.....................243100
AY233287.1 Hepatitis B virus isolate 8225 complete genome 223.....................243100
AY233288.1 Hepatitis B virus isolate 823 complete genome 223.....................243100
AY233289.1 Hepatitis B virus isolate 833 complete genome 223.....................243100
AY233291.1 Hepatitis B virus isolate 179 complete genome 223.....................243100
AY233292.1 Hepatitis B virus isolate 184 complete genome 223.....................243100
AY233293.1 Hepatitis B virus isolate 12 complete genome 223.....................243100
AY233294.1 Hepatitis B virus isolate 305 complete genome 223.....................243100
AY233295.1 Hepatitis B virus isolate 8 complete genome 223.....................243100
AY233296.1 Hepatitis B virus isolate 185 complete genome 223.....................243100
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co221.....................241100
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 223.....................243100
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 223.....................243100
AY373430.1 Hepatitis B virus clone SWT.3 complete genome 223.....................243100
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 223.....................243100
AY236160.1 Hepatitis B virus isolate 1A, complete genome 1585.....................1605100
AY236161.1 Hepatitis B virus isolate 12A, complete genome 1585.....................1605100
AY236162.1 Hepatitis B virus isolate 23 A, complete genome 1585.....................1605100
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 223.....................243100
AB126581.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU301 225.....................245100
AB112066.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY624 223.....................243100
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 223.....................243100
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 223.....................243100
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 223.....................243100
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 223.....................243100
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 223.....................243100
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 223.....................243100
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 223.....................243100
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 223.....................243100
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 223.....................243100
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 223.....................243100
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 223.....................243100
AB116087.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND8 223.....................243100
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 223.....................243100
AB116089.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP39 223.....................243100
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 223.....................243100
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 223.....................243100
AB116092.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH20 223.....................243100
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 223.....................243100
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 223.....................243100
AB116266.1 Hepatitis B virus DNA, complete genome, strain: Ehime TY:871225 223.....................243100
AY661792.1 Hepatitis B virus isolate ayw, complete genome 225.....................245100
AY661793.1 Hepatitis B virus isolate 2, complete genome 225.....................245100
AB120308.1 Hepatitis B virus DNA, complete genome, strain:Ehime-full 20:IM 82082223.....................243100
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 225.....................245100
AY721605.1 Hepatitis B virus isolate AK1.1, complete genome 225.....................245100
AY721606.1 Hepatitis B virus isolate AT1.2, complete genome 225.....................245100
AY721607.1 Hepatitis B virus isolate HIY1.3, complete genome 225.....................245100
AY721608.1 Hepatitis B virus isolate IB1.4, complete genome 225.....................245100
AY721609.1 Hepatitis B virus isolate AA1.5, complete genome 225.....................245100
AY721610.1 Hepatitis B virus isolate FK1.6, complete genome 225.....................245100
AY721611.1 Hepatitis B virus isolate SK1.7, complete genome 225.....................245100
AY721612.1 Hepatitis B virus isolate BL1.8, complete genome 225.....................245100
AY741794.1 Hepatitis B virus isolate IR-IPI-50, complete genome 225.....................245100
AY741795.1 Hepatitis B virus isolate IR-IPI-Hi, complete genome 225.....................245100
AY741796.1 Hepatitis B virus isolate IR-IPI-P3, complete genome 225.....................245100
AY741797.1 Hepatitis B virus isolate IR-IPI-21, complete genome 225.....................245100
AY796030.1 Hepatitis B virus isolate FC1.9, complete genome 225.....................245100
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 225.....................245100
AY796032.1 Hepatitis B virus isolate NA1.11, complete genome 225.....................245100
AB109475.1 Hepatitis B virus DNA, complete genome, strain:Ehime7: Iyo 0218004 223.....................243100
AB109476.1 Hepatitis B virus DNA, complete genome, strain:Ehime8: Iyo 8288043 223.....................243100
AB109477.1 Hepatitis B virus DNA, complete genome, strain:Ehime9: Iyo 529380 223.....................243100
AB109478.1 Hepatitis B virus DNA, complete genome, strain:Ehime10: Iyo 41676 223.....................243100
AB109479.1 Hepatitis B virus DNA, complete genome, strain:Ehime11: Iyo 529207 223.....................243100
AB110075.1 Hepatitis B virus DNA, complete genome, strain: Ehime12:IM 011025 223.....................243100
AY902768.1 Hepatitis B virus isolate MTB166, complete genome 223.....................243100
AY902769.1 Hepatitis B virus isolate MTB009, complete genome 223.....................243100
AY902770.1 Hepatitis B virus isolate MTB012, complete genome 223.....................243100
AY902772.1 Hepatitis B virus isolate MTB158, complete genome 223.....................243100
AY902773.1 Hepatitis B virus isolate MTB159, complete genome 223.....................243100
AY902774.1 Hepatitis B virus isolate MTB160, complete genome 223.....................243100
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 223.....................243100
AY902776.1 Hepatitis B virus isolate MTB163, complete genome 223.....................243100
AY902777.1 Hepatitis B virus isolate MTB004, complete genome 223.....................243100
AB188241.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA25 223.....................243100
AB188242.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA38 223.....................243100
AB205118.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ1-1-2 223.....................243100
AB205126.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF714-1 223.....................243100
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 223.....................243100
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 223.....................243100
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 223.....................243100
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 223.....................243100
AY817511.1 Hepatitis B virus isolate CHN-L49 from China, complete genome 223.....................243100
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 223.....................243100
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 223.....................243100
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 223.....................243100
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 223.....................243100
AY945307.1 Hepatitis B virus, complete genome 223.....................243100
AP007263.1 HBV genotype A DNA, complete genome, isolate: HB-JI444AF 223.....................243100
AP007264.1 HBV genotype G DNA, complete genome, isolate: HB-JI444GF 223.....................243100
AY903452.1 Hepatitis B virus serotype adw2, complete genome 223.....................243100
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 223.....................243100
AY934765.1 Hepatitis B virus isolate 24306, complete genome 223.....................243100
AY934767.1 Hepatitis B virus isolate 27178, complete genome 223.....................243100
AY934768.1 Hepatitis B virus isolate 25830, complete genome 223.....................243100
AY934769.1 Hepatitis B virus isolate 23719, complete genome 223.....................243100
AY934772.1 Hepatitis B virus isolate 1908, complete genome 223.....................243100
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 223.....................243100
AY934774.1 Hepatitis B virus isolate 9615549, complete genome 223.....................243100
DQ020002.1 Hepatitis B virus isolate 380, complete genome 223.....................243100
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 223.....................243100
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 223.....................243100
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 223.....................243100
AB194952.1 Hepatitis B virus DNA, complete genome, isolate: CMR711 223.....................243100
DQ078791.1 Hepatitis B virus from Thailand, complete genome 223.....................243100
DQ111987.1 Hepatitis B virus isolate MMU36, complete genome 223.....................243100
AY862860.1 Hepatitis B virus clone Q11, complete genome 223.....................243100
AY862861.1 Hepatitis B virus clone Q17, complete genome 223.....................243100
AY862862.1 Hepatitis B virus clone Q20, complete genome 223.....................243100
AY862863.1 Hepatitis B virus clone Q23, complete genome 223.....................243100
AY862864.1 Hepatitis B virus clone Q34, complete genome 223.....................243100
AY862865.1 Hepatitis B virus clone Q311, complete genome 223.....................243100
AY862866.1 Hepatitis B virus clone Q312, complete genome 225.....................245100
AY862867.1 Hepatitis B virus clone Q42, complete genome 223.....................243100
AY862868.1 Hepatitis B virus clone Q43, complete genome 223.....................243100
AB119251.1 Hepatitis B virus DNA, complete genome, strain:Ehime13:BD No2,2002082223.....................243100
AB119252.1 Hepatitis B virus DNA, complete genome, strain:Ehime14:BD No7,2002082223.....................243100
AB119253.1 Hepatitis B virus DNA, complete genome, strain:Ehime15:BD No27,H12.01223.....................243100
AB119254.1 Hepatitis B virus DNA, complete genome, strain:Ehime16:BD No53,200301223.....................243100
AB119255.1 Hepatitis B virus DNA, complete genome, strain:Ehime17:Iyo 0719039 223.....................243100
AB119256.1 Hepatitis B virus DNA, complete genome, strain:Ehime18:Iyo 529246 223.....................243100
AB188245.2 Hepatitis B virus DNA, complete genome, isolate:ALTAY136 223.....................243100
AB188243.2 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA27 223.....................243100
DQ207798.1 Hepatitis B virus strain N2829, complete genome 220.....................240100
DQ298162.1 Hepatitis B virus isolate LT3.12AM clone 2, complete genome 1624.....................1644100
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 1624.....................1644100
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 1624.....................1644100
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 1624.....................1644100
DQ304547.1 Hepatitis B virus isolate LT4 clone 1, complete genome 1585.....................1605100
DQ304551.1 Hepatitis B virus isolate LT4 clone 5, complete genome 1585.....................1605100
AJ627215.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 06115 223.....................243100
AJ627216.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 17707 223.....................243100
AJ627218.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21116 223.....................243100
AJ627219.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 24039 223.....................243100
AJ627220.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 29234 223.....................243100
AJ627221.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 30125 223.....................243100
AJ627222.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 31228 223.....................243100
AJ627223.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33720 223.....................243100
AJ627224.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33852 223.....................243100
AJ627226.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20952 214.....................234100
AJ627228.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 34408 211.....................231100
DQ315776.1 Hepatitis B virus isolate EI00615, complete genome 223.....................243100
DQ315777.1 Hepatitis B virus isolate EI03194, complete genome 223.....................243100
DQ315778.1 Hepatitis B virus isolate EI0388, complete genome 223.....................243100
DQ315779.1 Hepatitis B virus isolate EI0399, complete genome 223.....................243100
DQ315780.1 Hepatitis B virus isolate EI02456, complete genome 193.....................213100
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 223.....................243100
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 223.....................243100
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 223.....................243100
DQ399006.1 Hepatitis B virus isolate G1, complete genome 1505.....................1525100
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 223.....................243100
AB222709.1 Hepatitis B virus DNA, complete genome, isolate: UZBV34 223.....................243100
AB222710.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6M 223.....................243100
AB222711.1 Hepatitis B virus DNA, complete genome, isolate: UZNV24 223.....................243100
AB222712.1 Hepatitis B virus DNA, complete genome, isolate: UZBV61 223.....................243100
AB222713.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6 223.....................243100
AB210818.1 Hepatitis B virus DNA, complete genome, strain:Ehime 21-NM 223.....................243100
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 223.....................243100
AB210820.1 Hepatitis B virus DNA, complete genome, strain:Tokyo 1 223.....................243100
AB210821.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 1-OA 223.....................243100
AB210822.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 2-OS 223.....................243100
AM180623.1 Hepatitis B virus complete genome, isolate MAL36 223.....................243100
AM180624.1 Hepatitis B virus complete genome, isolate CAE168 223.....................243100
DQ478881.1 Hepatitis B virus isolate CHN-QH2, complete genome 223.....................243100
DQ478882.1 Hepatitis B virus isolate CHN-QH3, complete genome 223.....................243100
DQ478883.1 Hepatitis B virus isolate CHN-QH33, complete genome 223.....................243100
DQ478884.1 Hepatitis B virus isolate CHN-QH4, complete genome 223.....................243100
DQ478886.1 Hepatitis B virus isolate CHN-QH5, complete genome 223.....................243100
DQ478887.1 Hepatitis B virus isolate CHN-QH8, complete genome 223.....................243100
DQ478889.1 Hepatitis B virus isolate CHN-QH14, complete genome 223.....................243100
DQ478890.1 Hepatitis B virus isolate CHN-QH18, complete genome 223.....................243100
DQ478891.1 Hepatitis B virus isolate CHN-QH19, complete genome 223.....................243100
DQ478892.1 Hepatitis B virus isolate CHN-QH28, complete genome 223.....................243100
DQ478893.1 Hepatitis B virus isolate CHN-QH29, complete genome 223.....................243100
DQ478894.1 Hepatitis B virus isolate CHN-QH30, complete genome 223.....................243100
DQ478895.1 Hepatitis B virus isolate CHN-QH31, complete genome 223.....................243100
DQ478896.1 Hepatitis B virus isolate CHN-QH32, complete genome 223.....................243100
DQ478897.1 Hepatitis B virus isolate CHN-QH37, complete genome 223.....................243100
DQ478898.1 Hepatitis B virus isolate CHN-QH38, complete genome 223.....................243100
DQ486023.1 Hepatitis B virus isolate LT10, complete genome 1564.....................1584100
DQ486024.1 Hepatitis B virus isolate LT9, complete genome 1585.....................1605100
DQ486025.1 Hepatitis B virus isolate LT12, complete genome 1585.....................1605100
AB241114.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC01 223.....................243100
AB241115.1 Hepatitis B virus DNA, complete genome, isolate:PhCH09 223.....................243100
AM282986.1 Hepatitis B virus (SUBTYPE ADW2), genotype A, complete genome 223.....................243100
AB246317.1 Hepatitis B virus DNA, complete genome, isolate: TA112 187.....................207100
DQ788725.1 Hepatitis B virus clone S1, complete genome 223.....................243100
DQ788726.1 Hepatitis B virus clone S15, complete genome 217.....................237100
DQ788727.1 Hepatitis B virus clone S18, complete genome 217.....................237100
DQ788728.1 Hepatitis B virus clone S24, complete genome 217.....................237100
DQ788729.1 Hepatitis B virus clone L1, complete genome 217.....................237100
AM184126.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate N35 223.....................243100
AB246335.1 Hepatitis B virus DNA, complete genome, clone: Aa_IND 223.....................243100
AB246336.1 Hepatitis B virus DNA, complete genome, clone: Aa_SAF 223.....................243100
AB246337.1 Hepatitis B virus DNA, complete genome, clone: Ae_US 223.....................243100
AB246338.1 Hepatitis B virus DNA, complete genome, clone: Ae_JPN 223.....................243100
AB246347.1 Hepatitis B virus DNA, complete genome, clone: D_IND60 223.....................243100
AB246348.1 Hepatitis B virus DNA, complete genome, clone: D_US68 223.....................243100
AB267090.1 Hepatitis B virus ayw/Japan/Ehime 22-HS/2005 DNA, complete genome 223.....................243100
EF208113.1 Hepatitis B virus clone B-S3, complete genome 223.....................243100
EF208114.1 Hepatitis B virus clone B-S7, complete genome 223.....................243100
EF208115.1 Hepatitis B virus clone B-S8, complete genome 223.....................243100
AB270547.1 Hepatitis B virus DNA, complete genome, isolate: MGL295F 223.....................243100
AB270548.1 Hepatitis B virus DNA, complete genome, isolate: MGL207F 223.....................243100
AB270549.1 Hepatitis B virus DNA, complete genome, isolate: MGL79F 223.....................243100
AB270534.1 Hepatitis B virus DNA, complete genome, isolate: MGL110F 223.....................243100
AB270535.1 Hepatitis B virus DNA, complete genome, isolate: MGL50F 223.....................243100
AB270536.1 Hepatitis B virus DNA, complete genome, isolate: MGL226F 222.....................242100
AB270537.1 Hepatitis B virus DNA, complete genome, isolate: MGL22F 223.....................243100
AB270538.1 Hepatitis B virus DNA, complete genome, isolate: MGL231F 223.....................243100
AB270539.1 Hepatitis B virus DNA, complete genome, isolate: MGL200F 223.....................243100
AB270540.1 Hepatitis B virus DNA, complete genome, isolate: MGL241F 202.....................222100
AB270541.1 Hepatitis B virus DNA, complete genome, isolate: MGL47F 223.....................243100
AB270542.1 Hepatitis B virus DNA, complete genome, isolate: MGL12F 223.....................243100
AB270543.1 Hepatitis B virus DNA, complete genome, isolate: MGL209F 223.....................243100
AB270544.1 Hepatitis B virus DNA, complete genome, isolate: MGL215F 223.....................243100
AB270545.1 Hepatitis B virus DNA, complete genome, isolate: MGL108F 223.....................243100
AB270546.1 Hepatitis B virus DNA, complete genome, isolate: MGL88F 223.....................243100
EF103275.1 Hepatitis B virus isolate Ran11, complete genome 223.....................243100
EF103276.1 Hepatitis B virus isolate Ran22, complete genome 223.....................243100
EF103277.1 Hepatitis B virus isolate Ran33, complete genome 223.....................243100
EF103278.1 Hepatitis B virus isolate Ran60, complete genome 223.....................243100
EF103279.1 Hepatitis B virus isolate Ran99, complete genome 223.....................243100
EF103280.1 Hepatitis B virus isolate Ran100, complete genome 223.....................243100
EF103281.1 Hepatitis B virus isolate Ran102, complete genome 223.....................243100
EF103282.1 Hepatitis B virus isolate Ran103, complete genome 223.....................243100
EF103284.1 Hepatitis B virus isolate Ran113, complete genome 223.....................243100
EF103285.1 Hepatitis B virus isolate Ran128, complete genome 223.....................243100
AM295795.1 Hepatitis B virus complete genome, clone LB1Clone5 223.....................243100
AM295796.1 Hepatitis B virus complete genome, clone LB1Clone10 223.....................243100
AM295797.1 Hepatitis B virus complete genome, clone LB2Clone6 223.....................243100
AM295798.1 Hepatitis B virus complete genome, clone LB3Clone1 223.....................243100
AM295799.1 Hepatitis B virus complete genome, clone LB3Clone5 223.....................243100
AM295800.2 Hepatitis B virus complete genome, clone LB3Clone11 223.....................243100
EF137802.1 Hepatitis B virus strain JH4-1896-G, complete genome 223.....................243100
EF137803.1 Hepatitis B virus strain JH4-1896-A, complete genome 223.....................243100
AM422939.1 Hepatitis B virus, genotype D, complete genome, isolate X28 223.....................243100
EF634480.1 Hepatitis B virus clone G6, complete genome 223.....................243100
EF634481.1 Hepatitis B virus clone G1, complete genome 223.....................243100
EF464097.1 Hepatitis B virus isolate 06hac, complete genome 223.....................243100
EF464098.1 Hepatitis B virus isolate 09hgg, complete genome 223.....................243100
EF464099.1 Hepatitis B virus isolate 05hgg, complete genome 223.....................243100
EU086721.1 Hepatitis B virus isolate HRO/w4601-2002, complete genome 223.....................243100
EF494378.1 Hepatitis B virus isolate TW1244 genotype C, complete genome 223.....................243100
EU054331.1 Hepatitis B virus strain FE-929-MO, complete genome 223.....................243100
AB300366.1 Hepatitis B virus DNA, complete genome, isolate: patient8 223.....................243100
AB300367.1 Hepatitis B virus DNA, complete genome, isolate: patient9 223.....................243100
AB368296.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c223.....................243100
AB287320.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-1 223.....................243100
EU155893.1 Hepatitis B virus isolate 4, complete genome 223.....................243100
AB330368.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ54H223.....................243100
AB330369.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ5HB223.....................243100
AB330370.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ6HB223.....................243100
AB330371.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ23H223.....................243100
AB330372.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ22H223.....................243100
EU185780.1 Hepatitis B virus isolate H-IDU7 (Rec.Arg-1) D3/A2 recombinant, compl223.....................243100
AM494716.1 Hepatitis B virus complete genome, isolate CAR175 223.....................243100
AM494718.1 Hepatitis B virus complete genome, isolate CAR204 223.....................243100
EU410082.1 Hepatitis B virus isolate ph81, complete genome 223.....................243100
AM410963.1 Hepatitis B virus complete genome, clone LB3Clone24 223.....................243100
DQ991753.2 Hepatitis B virus isolate Irish-13, complete genome 223.....................243100
EU414133.1 Hepatitis B virus strain 28058, complete genome 223.....................243100
EU414135.1 Hepatitis B virus strain 28025, complete genome 223.....................243100
EU414136.1 Hepatitis B virus strain 28052, complete genome 223.....................243100
EU414137.1 Hepatitis B virus strain 28059, complete genome 223.....................243100
EU414138.1 Hepatitis B virus strain 28129, complete genome 223.....................243100
EU414139.1 Hepatitis B virus strain 28027, complete genome 223.....................243100
EU414141.1 Hepatitis B virus strain 28051, complete genome 223.....................243100
EU414142.1 Hepatitis B virus strain 28004, complete genome 223.....................243100
EU414143.1 Hepatitis B virus strain 28042, complete genome 223.....................243100
EU747320.1 Hepatitis B virus isolate V51, complete genome 223.....................243100
AB375165.1 Hepatitis B virus DNA, complete genome, strain: MEXICO8-G 223.....................243100
AB375166.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-G 223.....................243100
AB375167.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32-G 223.....................243100
AB375168.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-G 223.....................243100
AB375169.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-G 223.....................243100
AB375170.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-G 223.....................243100
EU594382.1 Hepatitis B virus strain 3798-91, complete genome 223.....................243100
EU594383.1 Hepatitis B virus strain 2000-00, complete genome 223.....................243100
EU594384.1 Hepatitis B virus strain 1906-99, complete genome 223.....................243100
EU594385.1 Hepatitis B virus strain 1898-98, complete genome 223.....................243100
EU594386.1 Hepatitis B virus strain 644-00, complete genome 223.....................243100
EU594387.1 Hepatitis B virus strain 3784-91, complete genome 223.....................243100
EU594388.1 Hepatitis B virus strain 3782-91, complete genome 223.....................243100
EU594389.1 Hepatitis B virus strain 4435-97, complete genome 223.....................243100
EU594390.1 Hepatitis B virus strain 4625-97, complete genome 223.....................243100
EU594391.1 Hepatitis B virus strain 4620-97, complete genome 223.....................243100
EU594392.1 Hepatitis B virus strain 4600-97, complete genome 223.....................243100
EU594393.1 Hepatitis B virus strain 4590-97, complete genome 223.....................243100
EU594394.1 Hepatitis B virus strain 4512-97, complete genome 223.....................243100
EU594395.1 Hepatitis B virus strain 4509-97, complete genome 223.....................243100
EU594396.1 Hepatitis B virus strain 4383-97, complete genome 223.....................243100
EU594397.1 Hepatitis B virus strain 4398-97, complete genome 223.....................243100
EU594398.1 Hepatitis B virus strain 4496-97, complete genome 223.....................243100
EU594399.1 Hepatitis B virus strain 4484-97, complete genome 223.....................243100
EU594400.1 Hepatitis B virus strain 2009-02, complete genome 223.....................243100
EU594401.1 Hepatitis B virus strain 1989-97, complete genome 223.....................243100
EU594402.1 Hepatitis B virus strain 1988-02, complete genome 223.....................243100
EU594403.1 Hepatitis B virus strain 1904-99, complete genome 223.....................243100
EU594406.1 Hepatitis B virus strain 321-96, complete genome 223.....................243100
EU594407.1 Hepatitis B virus strain 295-01, complete genome 223.....................243100
EU594408.1 Hepatitis B virus strain 281-01, complete genome 223.....................243100
EU594409.1 Hepatitis B virus strain 280-01, complete genome 223.....................243100
EU594410.1 Hepatitis B virus strain 279-01, complete genome 223.....................243100
EU594415.1 Hepatitis B virus strain 4374-97, complete genome 223.....................243100
EU594416.1 Hepatitis B virus strain 4373-97, complete genome 223.....................243100
EU594421.1 Hepatitis B virus strain 4658-97, complete genome 223.....................243100
EU594422.1 Hepatitis B virus strain 4655-97, complete genome 223.....................243100
EU594423.1 Hepatitis B virus strain 4652-97, complete genome 223.....................243100
EU594424.1 Hepatitis B virus strain 4651-97, complete genome 223.....................243100
EU594425.1 Hepatitis B virus strain 4635-97, complete genome 223.....................243100
EU594426.1 Hepatitis B virus strain 4630-97, complete genome 223.....................243100
EU594427.1 Hepatitis B virus strain 4628-97, complete genome 223.....................243100
EU594428.1 Hepatitis B virus strain 4385-97, complete genome 223.....................243100
EU594430.1 Hepatitis B virus strain 4565-97, complete genome 223.....................243100
EU594431.1 Hepatitis B virus strain 4547-97, complete genome 223.....................243100
EU594432.1 Hepatitis B virus strain 4545-97, complete genome 223.....................243100
EU594433.1 Hepatitis B virus strain 4605-97, complete genome 223.....................243100
EU594434.1 Hepatitis B virus strain 683-95, complete genome 223.....................243100
EU594435.1 Hepatitis B virus strain 320-95, complete genome 223.....................243100
EU594436.1 Hepatitis B virus strain 4550-97, complete genome 223.....................243100
EU787434.1 Hepatitis B virus isolate 92, complete genome 223.....................243100
EU787435.1 Hepatitis B virus isolate 114, complete genome 223.....................243100
EU787436.1 Hepatitis B virus isolate 165, complete genome 223.....................243100
EU787437.1 Hepatitis B virus isolate 17, complete genome 223.....................243100
EU787438.1 Hepatitis B virus isolate 7, complete genome 223.....................243100
EU787439.1 Hepatitis B virus isolate 89, complete genome 223.....................243100
EU787440.1 Hepatitis B virus isolate W17, complete genome 223.....................243100
EU787441.1 Hepatitis B virus isolate W32, complete genome 223.....................243100
EU787442.1 Hepatitis B virus isolate W37, complete genome 223.....................243100
EU787443.1 Hepatitis B virus isolate w40, complete genome 223.....................243100
EU787445.1 Hepatitis B virus isolate W51, complete genome 223.....................243100
EU787446.1 Hepatitis B virus isolate W75, complete genome 223.....................243100
EU787447.1 Hepatitis B virus isolate W46, complete genome 223.....................243100
AB453979.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH1 223.....................243100
AB453980.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH2 223.....................243100
AB453981.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH3 223.....................243100
AB453982.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH4 223.....................243100
AB453984.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH6 223.....................243100
AB453985.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH7 223.....................243100
AB453986.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH8 223.....................243100
AB453987.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH9 223.....................243100
AB453988.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH10 223.....................243100
AB453989.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH11 223.....................243100
AB453983.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH5 223.....................243100
EU921418.1 Hepatitis B virus isolate 22.165.07, complete genome 223.....................243100
EU921419.1 Hepatitis B virus isolate 22.252.07, complete genome 223.....................243100
EU919197.1 Hepatitis B virus isolate XJU, complete genome 223.....................243100
EU939681.1 Hepatitis B virus isolate D146, complete genome 223.....................243100
EU366129.2 Hepatitis B virus isolate BA92, complete genome 223.....................243100
AB367430.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 39/Adefovir211.....................231100
FJ023650.1 Hepatitis B virus isolate C2_M04-0341 S protein (S) and core protein 223.....................243100
FJ386590.1 Hepatitis B virus isolate 1841, complete genome 223.....................243100
FM199974.1 Hepatitis B virus complete genome, strain 45021 223.....................243100
FM199976.1 Hepatitis B virus complete genome, strain 45082 223.....................243100
FM199977.1 Hepatitis B virus complete genome, strain 45088 223.....................243100
FM199978.1 Hepatitis B virus complete genome, strain 49136 223.....................243100
FM199979.1 Hepatitis B virus complete genome, strain 49224 223.....................243100
FM199980.1 Hepatitis B virus complete genome, strain 49244 223.....................243100
FM199981.1 Hepatitis B virus complete genome, strain 49263 223.....................243100
AB493845.1 Hepatitis B virus DNA, complete genome, isolate: 07UC 203.....................223100
AB493846.1 Hepatitis B virus DNA, complete genome, isolate: 17UC 223.....................243100
AB493848.1 Hepatitis B virus DNA, complete genome, isolate: P7 202.....................222100
FJ349296.1 Hepatitis B virus strain 29-OYE-10, complete genome 223.....................243100
GQ167301.1 Hepatitis B virus isolate ZADGM452, complete genome 223.....................243100
GQ167302.1 Hepatitis B virus isolate ZADGM4521, complete genome 223.....................243100
AB362931.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon223.....................243100
GQ184322.1 Hepatitis B virus isolate ZADGM4522, complete genome 223.....................243100
GQ184323.1 Hepatitis B virus isolate ZADGM1121, complete genome 223.....................243100
GQ184324.1 Hepatitis B virus isolate ZADGM1122, complete genome 223.....................243100
FJ899792.1 Hepatitis B virus isolate D146-1, complete genome 223.....................243100
GQ414522.1 Hepatitis B virus strain GTA_CT, complete genome 2071.....................2091100
GQ377532.1 Hepatitis B virus isolate J37, complete genome 223.....................243100
GQ377589.1 Hepatitis B virus isolate J145, complete genome 223.....................243100
GQ377627.1 Hepatitis B virus isolate J231, complete genome 223.....................243100
GQ475313.1 Hepatitis B virus isolate KOR9CHB, complete genome 223.....................243100
GQ475315.1 Hepatitis B virus isolate KOR11CHB, complete genome 223.....................243100
GQ475344.1 Hepatitis B virus isolate KOR40HCC, complete genome 223.....................243100
AB471856.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C1 223.....................243100
AB471857.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C2 223.....................243100
AF043560.2 Hepatitis B virus isolate BA2, complete genome 223.....................243100
AF043580.2 Hepatitis B virus isolate BA3, complete genome 223.....................243100
FN594767.1 Hepatitis B virus complete genome, isolate bne127 223.....................243100
FN594768.1 Hepatitis B virus complete genome, isolate bne272 223.....................243100
FN594769.1 Hepatitis B virus complete genome, isolate bne281 223.....................243100
FN594770.1 Hepatitis B virus complete genome, isolate bne367 223.....................243100
FN594771.1 Hepatitis B virus complete genome, isolate bne442 223.....................243100
GU357846.1 Hepatitis B virus isolate Y10, complete genome 223.....................243100
GU565217.1 Hepatitis B virus strain CLB-DonX, complete genome 223.....................243100
AB549213.1 Hepatitis B virus DNA, complete genome, clone: G-C-F 223.....................243100
FN545826.1 Hepatitis B virus complete genome, strain 34010 223.....................243100
FN545831.1 Hepatitis B virus complete genome, strain 42002 223.....................243100
FN545836.1 Hepatitis B virus complete genome, strain 42128 223.....................243100
AB555496.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA31 223.....................243100
AB555497.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA37 223.....................243100
AB555500.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA64 223.....................243100
AB555501.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA65 223.....................243100
AB540584.1 HBV genotype C DNA, complete genome, strain: C0901190(NT16) 223.....................243100
AB480036.2 Hepatitis B virus DNA, complete genome, strain: 06-17 223.....................243100
AB480038.2 Hepatitis B virus DNA, complete genome, strain: 06-23 223.....................243100
AB480039.2 Hepatitis B virus DNA, complete genome, strain: 06-27 223.....................243100
AB480040.2 Hepatitis B virus DNA, complete genome, strain: 06-44 223.....................243100
AB480041.2 Hepatitis B virus DNA, complete genome, strain: 06-51 223.....................243100
FR714494.1 Hepatitis B virus complete genome, isolate NS052, X/C recombinant 223.....................243100
FR714504.1 Hepatitis B virus complete genome, isolate WL339, X/C recombinant 223.....................243100
GU177079.1 Hepatitis B virus isolate DN171, complete genome 223.....................243100
AB554016.1 HBV genotype D DNA, complete genome, isolate: TRF08226 223.....................243100
AB554023.1 HBV genotype D DNA, complete genome, isolate: GRS08457 223.....................243100
AB554024.1 HBV genotype D DNA, complete genome, isolate: GRS08538 223.....................243100
HQ236014.1 Hepatitis B virus isolate RS1, complete genome 223.....................243100
HQ236016.1 Hepatitis B virus isolate RS3, complete genome 223.....................243100
AB583679.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8134 223.....................243100
AB583680.1 Hepatitis B virus DNA, complete genome, isolate: Pkst7912 223.....................243100
AB583681.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8216 223.....................243100
JF491447.1 Hepatitis B virus isolate QH-13, complete genome 223.....................243100
JF491448.1 Hepatitis B virus isolate QH-29, complete genome 223.....................243100
JF491449.1 Hepatitis B virus isolate QH-32, complete genome 223.....................243100
JF491450.1 Hepatitis B virus isolate QH-33, complete genome 223.....................243100
JF491451.1 Hepatitis B virus isolate QH-35, complete genome 223.....................243100
JF491452.1 Hepatitis B virus isolate QH-53, complete genome 223.....................243100
JF491453.1 Hepatitis B virus isolate QH-90, complete genome 223.....................243100
JF491454.1 Hepatitis B virus isolate QH-79, complete genome 223.....................243100
JF491455.1 Hepatitis B virus isolate Tibet-31, complete genome 223.....................243100
JF491456.1 Hepatitis B virus isolate Tibet-53, complete genome 223.....................243100
EU414140.1 Hepatitis B virus strain 28050, complete genome 223..r..................24395
FN545825.1 Hepatitis B virus complete genome, strain 29137 223..r..................24395
FN545833.1 Hepatitis B virus complete genome, strain 42063 223..................r..24395
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 223..................a..24395
X01587.1 Hepatitis B virus subtype adr4 (HBV) 96..................a..11695
X14193.1 Hepatitis B virus DNA for adr mutant 223..................a..24395
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 97..................a..11795
D12980.1HPBCG Hepatitis B virus subtype adr(SRADR) DNA, complete genome 97..................a..11795
L08805.1HPBETNC Hepatitis B virus envelope, surface and nucleocapsid protein g225..................a..24595
M38454.1HPBADR1CG Hepatitis B virus , complete genome 2044..................a..206495
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 223..................a..24395
L27106.1HPBMUT Hepatitis B virus mutant complete genome 225...................a.24595
X75657.1 Human hepatitis virus (genotype E, Bas) preS1, preS2, S, C, X, antige223..a..................24395
X75664.1 Human hepatitis virus (genotype E, Kou) preS1, preS2, S, C, X, antige223..a..................24395
X75656.1 Human hepatitis virus (genotype C, Cha) preS1, preS2, S, C, X, antige223..................a..24395
X52939.1 Hepatitis B virus genome with a pre X orf 96..................a..11695
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 225..................a..24595
D23680.1HPBB4HST1 Hepatitis B virus (B4-HBVST1) complete genome sequence 223..................a..24395
D23681.1HPBC4HST2 Hepatitis B virus (C4-HBVST2) complete genome sequence 223..................a..24395
D23684.1HPBC6T588 Hepatitis B virus (C6-TKB588) complete genome sequence 223..................a..24395
S75184.1 S...preS2 [hepatitis B virus HBV, host=human plasma Nis 0859434, Geno223..................a..24395
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete225..................a..24595
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete225..................a..24595
D28880.1 Hepatitis B virus DNA, complete genome, strain Fukuoka Red Cross HBV 223..................a..24395
D50517.1 Hepatitis B virus clone HBV-ASA-EX1 genomic DNA, complete sequence 223..................a..24395
D50518.1 Hepatitis B virus clone HBV-ASA-EX2 genomic DNA, complete sequence 223..................a..24395
D50519.1 Hepatitis B virus clone HBV-ASA-EX3 genomic DNA, complete sequence 223..................a..24395
D50520.1 Hepatitis B virus clone HBV-ASA-EX4 genomic DNA, complete sequence 223..................a..24395
AB014360.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D01HCC 223..................a..24395
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 175..................a..19595
AB014362.1 Hepatitis B virus genomic DNA, complete sequence, isolate 03D03HCC 223..................a..24395
AB014363.1 Hepatitis B virus genomic DNA, complete sequence, isolate 04D04HCC 223..................a..24395
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 223..................a..24395
AB014365.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D06HCC 223..................a..24395
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 223..................a..24395
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 175..................a..19595
AB014373.1 Hepatitis B virus genomic DNA, complete sequence, isolate 14D14HCC 175..................a..19595
AB014374.1 Hepatitis B virus genomic DNA, complete sequence, isolate 15D15HCC 223..................a..24395
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 223..................a..24395
AB014377.1 Hepatitis B virus genomic DNA, complete sequence, isolate 18T03HCC 223..................a..24395
AB014378.1 Hepatitis B virus genomic DNA, complete sequence, isolate 19Y01HCC 223..................a..24395
AB014379.1 Hepatitis B virus genomic DNA, complete sequence, isolate 20Y02HCC 223..................a..24395
AB014387.1 Hepatitis B virus genomic DNA, complete sequence, isolate 28Y10HCC 178..................a..19895
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 223..................a..24395
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 184..................a..20495
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 223..................a..24395
AB014394.1 Hepatitis B virus genomic DNA, complete sequence, isolate 35Y17HCC 223..................a..24395
AB014395.1 Hepatitis B virus genomic DNA, complete sequence, isolate 36Y18HCC 210..................a..23095
AB014371.1 Hepatitis B virus genomic DNA, complete sequence, isolate 12D12HCC 223..................a..24395
AB014381.1 Hepatitis B virus genomic DNA, complete sequence, isolate 22Y04HCC 223..................a..24395
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 223..................a..24395
AB014383.1 Hepatitis B virus genomic DNA, complete sequence, isolate 24Y06HCC 223..................a..24395
AB014384.1 Hepatitis B virus genomic DNA, complete sequence, isolate 25Y07HCC 223..................a..24395
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 223..................a..24395
AB014388.1 Hepatitis B virus genomic DNA, complete sequence, isolate 29Y11HCC 169..................a..18995
AB014392.1 Hepatitis B virus genomic DNA, complete sequence, isolate 33Y15HCC 223..................a..24395
AB014393.1 Hepatitis B virus genomic DNA, complete sequence, isolate 34Y16HCC 223..................a..24395
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 223..................a..24395
AB014397.1 Hepatitis B virus genomic DNA, complete sequence, isolate 38Y20HCC 193..................a..21395
AB014398.1 Hepatitis B virus genomic DNA, complete sequence, isolate 39Y21HCC 175..................a..19595
AB014399.1 Hepatitis B virus genomic DNA, complete sequence, isolate 40Y22HCC 223..................a..24395
AJ131567.1 Hepatitis B virus complete genome, isolate gor97 1592..a..................161295
AF068756.1 Hepatitis B virus, complete genome 226..................a..24695
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 223..................a..24395
Y18856.1 Hepatitis B virus complete genome, isolate HBV-C5 223..................a..24395
Y18857.1 Hepatitis B virus complete genome, isolate HBV-C6 223..................a..24395
Y18858.1 Hepatitis B virus complete genome, isolate HBV-C7 223..................a..24395
AF143299.1 Hepatitis B virus clone 7744-G9, complete genome 1451..................a..147195
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 2071...................a.209195
AB031262.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietA-3223..................a..24395
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-2223..................a..24395
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 225..................a..24595
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 225..................a..24595
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 221..................a..24195
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 221..................a..24195
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 223..................a..24395
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 223..................a..24395
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 223..................a..24395
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 223..................a..24395
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 223..................a..24395
AB032431.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV/E-Ch195223..a..................24395
AB032432.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch256223..a..................24395
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch258223..a..................24395
AF121242.1 Hepatitis B virus isolate HBV/1218, complete genome 223...........a.........24395
AF222322.1 Hepatitis B virus isolate CH109, complete genome 225..a..................24595
AF222323.1 Hepatitis B virus isolate CH926, complete genome 225..a..................24595
AF242585.1 Hepatitis B virus isolate CHIMP_2, complete genome 223..a..................24395
AF242586.1 Hepatitis B virus isolate CHIMP_4, complete genome 223..a..................24395
AB046525.1 Hepatitis B virus genomic DNA, complete sequence, isolate:PttHBV-ChBa190..a..................21095
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 225..................a..24595
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 225..................a..24595
AF182804.1 Hepatitis B virus strain WLAP10, complete genome 225..................a..24595
AF182805.1 Hepatitis B virus strain WLAID, complete genome 192..................a..21295
AF241407.1 Hepatitis B virus isolate 11141, complete genome 223..a..................24395
AF241408.1 Hepatitis B virus isolate 14118, complete genome 223..a..................24395
AF241409.1 Hepatitis B virus isolate 6871, complete genome 223..a..................24395
AB050018.1 Hepatitis B virus DNA, complete genome 223..................a..24395
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 223..................a..24395
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 223..................a..24395
AB042285.1 Hepatitis B virus DNA, complete genome, isolate:NSS-4 223..................a..24395
AJ132335.1 Hepatitis B Virus complete genome, isolate PES1 223..a..................24395
AF305327.1 Hepatitis B virus isolate CB0376, complete genome 225..a..................24595
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 223..................a..24395
AB049610.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN29 223..................a..24395
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 223..................a..24395
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 223..................a..24395
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 223..................a..24395
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 223..................a..24395
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 223..................a..24395
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 223..................a..24395
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 223..................a..24395
AF223961.1 Hepatitis B virus strain C-1858 isolate ea8, complete genome 223..................a..24395
AB048704.1 Hepatitis B virus DNA, complete genome, serotype:ayw 223..................t..24395
AB048705.1 Hepatitis B virus DNA, complete genome, serotype:ayw 223..................t..24395
AF330110.1 Hepatitis B virus strain T-1858 genotype C, complete genome 223..................a..24395
AF363961.1 Hepatitis B virus strain G683-1, complete genome 1618..................a..163895
AF363962.1 Hepatitis B virus strain G683-2, complete genome 1585..................a..160595
AF363963.1 Hepatitis B virus strain G683-3, complete genome 1618..................a..163895
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 1618..................a..163895
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 1522..................a..154295
AY040627.1 Hepatitis B virus genotype C, complete genome 223..................a..24395
AF411408.1 Hepatitis B virus strain FMU#14, complete genome 225..................a..24595
AF411409.1 Hepatitis B virus strain FMC#16, complete genome 225..................a..24595
AF411410.1 Hepatitis B virus strain FMC#20, complete genome 198..................a..21895
AF411411.1 Hepatitis B virus strain FMC#97, complete genome 225..................a..24595
AF411412.1 Hepatitis B virus strain FMC#15, complete genome 225..................a..24595
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 223..................a..24395
AY066028.1 Hepatitis B virus isolate FH4, complete genome 225..................a..24595
AF458664.1 Hepatitis B virus isolate C84, complete genome 225..................a..24595
AF458665.1 Hepatitis B virus isolate C733, complete genome 225..................t..24595
AF461357.1 Hepatitis B virus isolate FH5, compete genome 225..................a..24595
AF461358.1 Hepatitis B virus isolate FH8, compete genome 225..................a..24595
AF461359.1 Hepatitis B virus isolate c16, compete genome 225..................a..24595
AF461361.1 Hepatitis B virus isolate FH3Q, compete genome 219..................a..23995
AF461363.1 Hepatitis B virus isolate C8, compete genome 225..................a..24595
AF473543.1 Hepatitis B virus isolate 2e, complete genome 223..................a..24395
AF405706.1 Hepatitis B virus isolate 235/01, complete genome 223..................a..24395
AB073823.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi35 223..................a..24395
AB073852.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry11 223..a..................24395
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 223..................a..24395
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 223..................a..24395
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 223..................a..24395
AY090452.1 Hepatitis B virus strain Z29, complete genome 226...................a.24695
AY123424.1 Hepatitis B virus, complete genome 225..................a..24595
AY123041.1 Hepatitis B virus serotype adr, complete genome 97..................a..11795
AF286594.1 Hepatitis B virus subtype adr, complete genome 223..................a..24395
AF536524.1 Hepatitis B virus clone 2A, complete genome 223..................a..24395
AF498266.1 Hepatitis B virus isolate FG, complete genome 223..a..................24395
AY148342.1 Hepatitis B virus, complete genome 1588..................a..160895
AB091255.1 Hepatitis B virus DNA, complete genome, isplate:ABI-129 223..a..................24395
AB091256.1 Hepatitis B virus DNA, complete genome, isplate:ABI-212 223..a..................24395
AY217371.1 Hepatitis B virus isolate 1-7, complete genome 223..................a..24395
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 206..................a..22695
AY217373.1 Hepatitis B virus isolate 594, complete genome 223..................a..24395
AY217374.1 Hepatitis B virus isolate 595, complete genome 208..................a..22895
AY217375.1 Hepatitis B virus isolate 599, complete genome 223..................a..24395
AY217376.1 Hepatitis B virus isolate Q1-1, complete genome 223..................a..24395
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 223..................a..24395
AB106564.1 Hepatitis B virus DNA, complete genome, isolate:HBV-GA325 223..a..................24395
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 223..................a..24395
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 223..................a..24395
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 223..................a..24395
AY206374.1 Hepatitis B virus strain FMU003 complete genome 225..................a..24595
AY206378.1 Hepatitis B virus strain FMU007 complete genome 189..................a..20995
AY206382.1 Hepatitis B virus strain FMU011 complete genome 225..................a..24595
AY206384.1 Hepatitis B virus strain FMU013 complete genome 225..................a..24595
AY206385.1 Hepatitis B virus strain FMU014 complete genome 192..................a..21295
AY206386.1 Hepatitis B virus strain FMU015 complete genome 225..................a..24595
AY206388.1 Hepatitis B virus strain FMU017 complete genome 225..................a..24595
AY206389.1 Hepatitis B virus strain FMU018 complete genome 225..................a..24595
AY206392.1 Hepatitis B virus strain FMU021 complete genome 225..................a..24595
AY206393.1 Hepatitis B virus strain FMU022 complete genome 225..................a..24595
AY220699.1 Hepatitis B virus strain MH15, complete genome 225..................a..24595
AY220700.1 Hepatitis B virus strain MH534978, complete genome 225..................a..24595
AY220701.1 Hepatitis B virus strain WJQ310, complete genome 225..................a..24595
AY220702.1 Hepatitis B virus strain WJQ650, complete genome 225..................a..24595
AY306136.1 Hepatitis B virus isolate H85, complete genome 223..................a..24395
AY233290.1 Hepatitis B virus isolate 85 complete genome 223..a..................24395
AY167090.1 Hepatitis B virus isolate Ib, complete genome 223..................a..24395
AY167091.1 Hepatitis B virus isolate Ic, complete genome 223..................a..24395
AY167092.1 Hepatitis B virus isolate Id, complete genome 187..................a..20795
AY167095.1 Hepatitis B virus isolate IIc, complete genome 223..................a..24395
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 223..................a..24395
AY167099.1 Hepatitis B virus isolate IVb, complete genome 223..................a..24395
AY330911.1 Hepatitis B virus isolate Louisa complete genome 223..a..................24395
AY330912.1 Hepatitis B virus isolate Osang complete genome 223..a..................24395
AB105172.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 2 223..................a..24395
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 16223..................a..24395
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 60223..................a..24395
AY373431.1 Hepatitis B virus clone SWT.4 complete genome 223..............a......24395
AY236163.1 Hepatitis B virus isolate 29, complete genome 1537..........g..........155795
AY236164.1 Hepatitis B virus isolate 30, complete genome 1585..........g..........160595
AB111112.1 Hepatitis B virus DNA, complete genome, clone: HS-0 223..................a..24395
AB111113.1 Hepatitis B virus DNA, complete genome, clone: HS-6 223..................a..24395
AB111114.1 Hepatitis B virus DNA, complete genome, clone: HS-12 223..................a..24395
AB111115.1 Hepatitis B virus DNA, complete genome, clone: K5-0 162..................a..18295
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 162..................a..18295
AB111117.1 Hepatitis B virus DNA, complete genome, clone: K5-13 175..................a..19595
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 300..................a..32095
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 223..................a..24395
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 223..................a..24395
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 223..................a..24395
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 223..................a..24395
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 223..................a..24395
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 223..................a..24395
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 223..................a..24395
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 223..................a..24395
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 223..................a..24395
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 214..................a..23495
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 223..................a..24395
AB112472.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH124 223..................a..24395
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 223..................a..24395
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 223..................a..24395
AB106895.1 Hepatitis B virus DNA, complete genome, isolate:pHB4-4 223..................a..24395
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 223..................a..24395
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 223..................a..24395
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 223..................a..24395
AB176643.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NK1 167..................a..18795
AY741798.1 Hepatitis B virus isolate IR-IPI-P4, complete genome 225..................a..24595
AY641558.1 Hepatitis B virus isolate He74, complete genome 223..................a..24395
AY641559.1 Hepatitis B virus isolate He53, complete genome 223..................a..24395
AY641560.1 Hepatitis B virus isolate He100, complete genome 223..................a..24395
AY641561.1 Hepatitis B virus isolate He127, complete genome 223..................a..24395
AY641562.1 Hepatitis B virus isolate He82, complete genome 223..................a..24395
AY641563.1 Hepatitis B virus isolate He52, complete genome 223..................a..24395
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 223..................a..24395
AB113875.1 Hepatitis B virus DNA, complete genome, strain:HCC-1-MC 223..................a..24395
AB113876.1 Hepatitis B virus DNA, complete genome, strain:HCC-2-NY 223..................a..24395
AB113877.1 Hepatitis B virus DNA, complete genome, strain:HCC-3-TT 223..................a..24395
AB113878.1 Hepatitis B virus DNA, complete genome, strain:Ehime-Lam-MM1-001208 223..................a..24395
AB113879.1 Hepatitis B virus DNA, complete genome, strain:AH-1-ON980424 223..................a..24395
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 223..................a..24395
AB198077.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.2 223..................a..24395
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 223..................a..24395
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 223..................a..24395
AB198080.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.5 223..................a..24395
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 223..................a..24395
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 223..................a..24395
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 223..................a..24395
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 223..................a..24395
AY739674.1 Hepatitis B virus clone A1-33, complete genome 223..a..................24395
AY739675.1 Hepatitis B virus clone A1-35, complete genome 223..a..................24395
AY738139.1 Hepatitis B virus clone A1, complete genome 223..................a..24395
AY738140.1 Hepatitis B virus clone A2, complete genome 223..................a..24395
AY738141.1 Hepatitis B virus clone A3, complete genome 223..................a..24395
AY738142.1 Hepatitis B virus clone A4, complete genome 223..................a..24395
AY738143.1 Hepatitis B virus clone A11, complete genome 223..................a..24395
AY738144.1 Hepatitis B virus clone B3, complete genome 223..a..................24395
AY738145.1 Hepatitis B virus clone B5, complete genome 223..a..................24395
AY738146.1 Hepatitis B virus clone B9, complete genome 223..a..................24395
AY738147.1 Hepatitis B virus clone B11, complete genome 223..a..................24395
AB188244.1 Hepatitis B virus DNA, complete genome, isolate:UZ24 223...................a.24395
AJ748098.1 Hepatitis B virus complete genome, genotype C 223..................a..24395
AB205121.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF720-1 223..a..................24395
AB205123.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CN578-1 223..................a..24395
AB205124.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ3-1-1 223..................a..24395
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 223..................a..24395
AB205128.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU316-1 223.......t.............24395
AB205129.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758-2 223..a..................24395
AP007262.1 HBV genotype E DNA, complete genome, isolate: HB-JI411F 223..a..................24395
AY935700.1 Hepatitis B virus isolate TH-HBV-012, complete genome 223..a..................24395
AY934764.1 Hepatitis B virus isolate 9210699, complete genome 223..a..................24395
AY934766.1 Hepatitis B virus isolate 24233, complete genome 223..a..................24395
AY934770.1 Hepatitis B virus isolate 953642, complete genome 223..a..................24395
AY934771.1 Hepatitis B virus isolate 27439, complete genome 223..................t..24395
AB205188.1 Hepatitis B virus DNA, complete genome, isolate: HBV-GA283 208..a..................22895
AB205189.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G138 223..a..................24395
AB205190.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G123 223..a..................24395
AB205191.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G166 223..a..................24395
AB205192.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758 223..a..................24395
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 223..a..................24395
AB194948.1 Hepatitis B virus DNA, complete genome, isolate: CMR936 223..a..................24395
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 223..a..................24395
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 190..................a..21095
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 223..................a..24395
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 223..................a..24395
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 223..................a..24395
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 223..................a..24395
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 223..................a..24395
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 223..................a..24395
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 223..................a..24395
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 223..................a..24395
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 223..................a..24395
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 223..................a..24395
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 223..................a..24395
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 223..................a..24395
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 223..................a..24395
DQ089771.1 Hepatitis B virus isolate HK1629, complete genome 223..................a..24395
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 223..................a..24395
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 223..................a..24395
DQ089775.1 Hepatitis B virus isolate HK290, complete genome 223..................a..24395
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 223..................a..24395
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 223..................a..24395
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 223..................a..24395
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 223..................a..24395
DQ089780.1 Hepatitis B virus isolate HK947, complete genome 223..................a..24395
DQ089781.1 Hepatitis B virus isolate HK1476, complete genome 223..................a..24395
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 223..................a..24395
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 223..................a..24395
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 223..................a..24395
DQ089785.1 Hepatitis B virus isolate HK1386, complete genome 223..................a..24395
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 223..................a..24395
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 223..................a..24395
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 223..................a..24395
DQ089790.1 Hepatitis B virus isolate HK1248, complete genome 223..................a..24395
DQ089791.1 Hepatitis B virus isolate HK1205, complete genome 223..................a..24395
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 223..................a..24395
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 223..................a..24395
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 176..................a..19695
DQ089795.1 Hepatitis B virus isolate HK1465, complete genome 223..................a..24395
DQ089796.1 Hepatitis B virus isolate HK751, complete genome 223..................a..24395
DQ089797.1 Hepatitis B virus isolate HK1169, complete genome 223..................a..24395
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 223..................a..24395
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 223..................a..24395
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 184..................a..20495
DQ089801.1 Hepatitis B virus isolate HK2100, complete genome 223..................a..24395
DQ089802.1 Hepatitis B virus isolate HK1371, complete genome 223..a..................24395
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 223..................a..24395
DQ089804.1 Hepatitis B virus isolate HK262, complete genome 223..................a..24395
DQ060822.1 Hepatitis B virus isolate 8510-91, complete genome 223..a..................24395
DQ060823.1 Hepatitis B virus isolate 8504-91, complete genome 223..a..................24395
DQ060824.1 Hepatitis B virus isolate 0121-20, complete genome 223..a..................24395
DQ060825.1 Hepatitis B virus isolate 0262-09, complete genome 223..a..................24395
DQ060826.1 Hepatitis B virus isolate 0433-20, complete genome 223..a..................24395
DQ060827.1 Hepatitis B virus isolate 0317-04, complete genome 223..a..................24395
DQ060828.1 Hepatitis B virus isolate 0443-03, complete genome 223..a..................24395
DQ060829.1 Hepatitis B virus isolate 0350-03, complete genome 223..a..................24395
DQ060830.1 Hepatitis B virus isolate 235-01, complete genome 223..a..................24395
DQ111986.1 Hepatitis B virus isolate MBT181, complete genome 223...................a.24395
AY862869.1 Hepatitis B virus clone Q80, complete genome 223..................a..24395
AB201287.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds223..a..................24395
AB201288.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds223..a..................24395
AB201289.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds223..a..................24395
AB201290.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds223..a..................24395
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 223..a..................24395
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 2039..................a..205995
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 2021..................a..204195
AB219529.1 Hepatitis B virus DNA, complete genome, isolate:UK1 211..a..................23195
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 223..a..................24395
AB219531.1 Hepatitis B virus DNA, complete genome, isolate:UK3 223..a..................24395
AB219532.1 Hepatitis B virus DNA, complete genome, isolate:UK4 223..a..................24395
AB219533.1 Hepatitis B virus DNA, complete genome, isolate:UK5 223..a..................24395
AB219534.1 Hepatitis B virus DNA, complete genome, isolate:UK6 193..a..................21395
DQ246215.1 Hepatitis B virus isolate GZ-DYH, complete genome 223..................a..24395
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 1624........c............164495
DQ304548.1 Hepatitis B virus isolate LT4 clone 2, complete genome 1585..c..................160595
DQ304549.1 Hepatitis B virus isolate LT4 clone 3, complete genome 1585..c..................160595
DQ304550.1 Hepatitis B virus isolate LT4 clone 4, complete genome 1585..c..................160595
AB182589.1 Hepatitis B virus DNA, complete genome, isolate:CH:Mat-Ko 223..................a..24395
DQ329356.1 Hepatitis B virus isolate LT1 clone 1, complete genome 1580..........g..........160095
DQ329357.1 Hepatitis B virus isolate LT1 clone 2, complete genome 1580..........g..........160095
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 202..................a..22295
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 223..................a..24395
DQ377160.1 Hepatitis B virus isolate WJT16, complete genome 223..................a..24395
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 223..................a..24395
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 223..................a..24395
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 223..................a..24395
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 223..................a..24395
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 223..................a..24395
AB247916.1 Hepatitis B virus DNA, complete genome, lamivudine resistance with in223..................a..24395
AJ627217.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20953 223............c........24395
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 223...........t.........24395
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 223..................a..24395
DQ315782.1 Hepatitis B virus isolate EI0423, complete genome 214..................a..23495
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 223..................a..24395
AB250109.1 Hepatitis B virus DNA, complete genome, isolate: IH030213 173..................a..19395
AB205152.1 Hepatitis B virus DNA, complete genome, isolate: HB-JFH7-99 223..................a..24395
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 223..a..................24395
AB222714.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7 223..................a..24395
AB222715.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7M 223..................a..24395
DQ463787.1 Hepatitis B virus isolate 928-9_1979, complete genome 223..a..................24395
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 223..a..................24395
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 223..a..................24395
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 223..a..................24395
DQ463791.1 Hepatitis B virus isolate 539-16_1979, complete genome 223..a..................24395
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 223..a..................24395
DQ463793.1 Hepatitis B virus isolate 462-4_1979, complete genome 223..a..................24395
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 223..a..................24395
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 223..a..................24395
DQ463797.1 Hepatitis B virus isolate 650-15_2004, complete genome 223..a..................24395
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 223..a..................24395
DQ463800.1 Hepatitis B virus isolate 524-3_2004, complete genome 223..a..................24395
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 223..a..................24395
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 223..a..................24395
DQ478885.1 Hepatitis B virus isolate CHN-D12, complete genome 223..................a..24395
DQ478888.1 Hepatitis B virus isolate CHN-QH9, complete genome 223..a..................24395
DQ478899.1 Hepatitis B virus isolate CHN-D20, complete genome 223..................a..24395
DQ478901.1 Hepatitis B virus isolate CHN-H155, complete genome 223..................a..24395
DQ486021.1 Hepatitis B virus isolate LT13, complete genome 1585..........g..........160595
DQ486022.1 Hepatitis B virus isolate LT11, complete genome 1585..........g..........160595
DQ536410.1 Hepatitis B virus isolate JeF339 clone JeF339U-3, complete genome 223..................a..24395
DQ536411.1 Hepatitis B virus isolate JeF339 clone JeF339U-1, complete genome 223..................a..24395
DQ536412.1 Hepatitis B virus isolate JeF339 clone JeF339U-2, complete genome 223..................a..24395
DQ683578.1 Hepatitis B virus from South Korea, complete genome 223..................a..24395
AM184125.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate O64 223..................a..24395
DQ922649.1 Hepatitis B virus strain B0024, complete genome 225..................a..24595
DQ922650.1 Hepatitis B virus strain C0955, complete genome 225..................a..24595
DQ922651.1 Hepatitis B virus strain F0691, complete genome 225..................a..24595
DQ975272.1 Hepatitis B virus strain C1248, complete genome 225..................a..24595
DQ975273.1 Hepatitis B virus strain e1013, complete genome 225..................a..24595
DQ975274.1 Hepatitis B virus strain F0885, complete genome 225..................a..24595
AM117394.1 Hepatitis B virus, isolate CHIMP_DJA, complete genome 222..a..................24295
AM117395.1 Hepatitis B virus, isolate CHIMP_MAK, complete genome 222..a..................24295
AM117396.1 Hepatitis B virus, isolate CHIMP_BAT, complete genome 222..a..................24295
AM117397.1 Hepatitis B virus, isolate CHIMP_ED, complete genome 222..a..................24295
DQ993181.1 Hepatitis B virus strain A0583, complete genome 225..................a..24595
DQ980547.1 Hepatitis B virus strain E0113, complete genome 225..................a..24595
DQ980549.1 Hepatitis B virus strain B0949, complete genome 192..................a..21295
DQ980550.1 Hepatitis B virus strain B0206, complete genome 168..................a..18895
DQ980551.1 Hepatitis B virus strain A0712, complete genome 192..................a..21295
DQ986375.1 Hepatitis B virus strain 616-93, complete genome 225..................a..24595
AB246344.1 Hepatitis B virus DNA, complete genome, clone: C_JPN22 223..................a..24395
AB246345.1 Hepatitis B virus DNA, complete genome, clone: C_JPNAT 223..................a..24395
AB246346.1 Hepatitis B virus DNA, complete genome, clone: C_HK74 223..................a..24395
AB288026.1 Hepatitis B virus DNA, complete genome, genotype: C, country: Japan, 223..................a..24395
AB270550.1 Hepatitis B virus DNA, complete genome, isolate: MGL247F 223...................a.24395
AB274969.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB320 223..a..................24395
AB274970.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB291 223..a..................24395
AB274971.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB295 223..a..................24395
AB274972.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB250 168..a..................18895
AB274973.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB18 217..a..................23795
AB274974.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB60 223..a..................24395
AB274975.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB241 223..a..................24395
AB274976.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB382 223..a..................24395
AB274977.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB183 223..a..................24395
AB274978.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB261 223..a..................24395
AB274979.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB302 223..a..................24395
AB274980.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB90 223..a..................24395
AB274981.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB331 223..a..................24395
AB274982.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB130 223..a..................24395
AB274983.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB85 223..a..................24395
AB274984.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB109 223..a..................24395
AB274985.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB145 217..a..................23795
DQ890381.1 Hepatitis B virus strain S40U, complete genome 223..................a..24395
EF536065.1 Hepatitis B virus strain XZK pre-t, complete genome 225..................a..24595
EF536066.1 Mutant Hepatitis B virus strain XZK t-w128, complete genome 225..................a..24595
AB195930.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-1 223..................a..24395
AB195931.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-2 223..................a..24395
AB195932.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-3 223..................a..24395
AB195936.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-1 223..................a..24395
AB195937.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-2 223..................a..24395
AB195938.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-3 223..................a..24395
AB195939.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-1 223..................a..24395
AB195940.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-2 223..................a..24395
AB195941.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-3 223..................a..24395
AB195942.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-1 223..................a..24395
AB195943.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-2 223..................a..24395
AB195944.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-3 223..................a..24395
AB195945.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-1 223..................a..24395
AB195946.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-2 178..................a..19895
AB195947.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-1 223..................a..24395
AB195948.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-2 223..................a..24395
AB195949.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-1 223..................a..24395
AB195950.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-2 223..................a..24395
AB195951.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-3 223..................a..24395
AB195952.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-1 223..................a..24395
AB195953.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-2 223..................a..24395
AB195954.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-3 223..................a..24395
AB195955.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-1 223..................a..24395
AB195956.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-2 223..................a..24395
AB195957.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-3 223..................a..24395
DQ993688.1 Hepatitis B virus isolate 209-0519-Nature1.2-unSero, complete genome 223..................a..24395
DQ993689.1 Hepatitis B virus isolate 209-1119-Nature1.1-unSero, complete genome 223..................a..24395
DQ993690.1 Hepatitis B virus isolate 204-1113-Nature1.1-unSero, complete genome 223..................a..24395
DQ993691.1 Hepatitis B virus isolate 4007-0803-Nature2.2-unSero, complete genome223..................a..24395
DQ993692.1 Hepatitis B virus isolate 4007-0810-Nature2.1-unSero, complete genome223..................a..24395
DQ993693.1 Hepatitis B virus isolate 232-1125-Nature1.1-unSero, complete genome 223..................a..24395
EF688062.1 Hepatitis B virus isolate GZ28-1, complete genome 223..................a..24395
AB202071.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-1 223..................a..24395
AB202072.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-2 199..................a..21995
EF494376.1 Hepatitis B virus isolate TW706 genotype C, complete genome 223..................a..24395
EF494379.1 Hepatitis B virus isolate TW8585 genotype C, complete genome 223..................a..24395
AB298720.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1S 223..................a..24395
AB298721.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1C 223..................a..24395
AB300359.1 Hepatitis B virus DNA, complete genome, isolate: patient1 223..................a..24395
AB300360.1 Hepatitis B virus DNA, complete genome, isolate: patient2 223..................a..24395
AB300361.1 Hepatitis B virus DNA, complete genome, isolate: patient3 223..................a..24395
AB300362.1 Hepatitis B virus DNA, complete genome, isolate: patient4 223..................a..24395
AB300363.1 Hepatitis B virus DNA, complete genome, isolate: patient5 223..................a..24395
AB300365.1 Hepatitis B virus DNA, complete genome, isolate: patient7 223..................a..24395
AB300368.1 Hepatitis B virus DNA, complete genome, isolate: patient10 223..................a..24395
AB300372.1 Hepatitis B virus DNA, complete genome, isolate: patient14 223..................a..24395
AB300373.1 Hepatitis B virus DNA, complete genome, isolate: patient15 199..................a..21995
EF473976.1 Hepatitis B virus isolate Alr049East, complete genome 223..a..................24395
AB368297.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c223..................a..24395
EU239217.1 Hepatitis B virus isolate G2451, complete genome 223..a..................24395
EU239218.1 Hepatitis B virus isolate BD2, complete genome 223..a..................24395
EU239219.1 Hepatitis B virus isolate PW3, complete genome 223..a..................24395
EU239220.1 Hepatitis B virus isolate PW5, complete genome 223..a..................24395
EU239221.1 Hepatitis B virus isolate PW1, complete genome 223..a..................24395
EU239222.1 Hepatitis B virus isolate PW2, complete genome 223..a..................24395
EU239223.1 Hepatitis B virus isolate PW4, complete genome 223..a..................24395
EU239224.1 Hepatitis B virus isolate BD1, complete genome 223..a..................24395
EU239225.1 Hepatitis B virus isolate PW7, complete genome 220..a..................24095
EU239226.1 Hepatitis B virus isolate PW6, complete genome 223..a..................24395
AB287314.1 Hepatitis B virus DNA, complete genome, isolate: Alaska433 223..a..................24395
AB287315.1 Hepatitis B virus DNA, complete genome, isolate: Alaska419 223..a..................24395
AB287316.1 Hepatitis B virus DNA, complete genome, isolate: Alaska427 223..a..................24395
AB287317.1 Hepatitis B virus DNA, complete genome, isolate: Alaska416 223..a..................24395
AB287318.1 Hepatitis B virus DNA, complete genome, isolate: Alaska2 223..a..................24395
AB287321.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-2 223..a..................24395
AB287322.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-3 223..a..................24395
AB287324.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-5 223..a..................24395
AB287325.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-6 223..a..................24395
EU155895.1 Hepatitis B virus isolate 5b, complete genome 223...........g.........24395
D00220.2HPBVCG Hepatitis B virus DNA, complete genome, strain: LSH 223..a..................24395
AB330366.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ2HB223...................a.24395
AB330367.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ14H223.........a...........24395
EU185786.1 Hepatitis B virus isolate S-IDU11, complete genome 223..................a..24395
EU185788.1 Hepatitis B virus isolate S-IDU19, complete genome 223..................a..24395
EU185789.1 Hepatitis B virus isolate S-IDU8, complete genome 223..................a..24395
EU305540.1 Hepatitis B virus isolate G67-123, complete genome 223..................a..24395
EU305541.1 Hepatitis B virus isolate G67-190, complete genome 223..................a..24395
EU305542.1 Hepatitis B virus isolate G67-1251, complete genome 223..................a..24395
AM494689.1 Hepatitis B virus complete genome, isolate CAR006 211..a..................23195
AM494690.1 Hepatitis B virus complete genome, isolate CAR008 223..a..................24395
AM494691.1 Hepatitis B virus complete genome, isolate CAR024 223..a..................24395
AM494692.1 Hepatitis B virus complete genome, isolate CAR026 223..a..................24395
AM494693.1 Hepatitis B virus complete genome, isolate CAR039 223..a..................24395
AM494694.1 Hepatitis B virus complete genome, isolate CAR047 223..a..................24395
AM494695.1 Hepatitis B virus complete genome, isolate CAR053 223..a..................24395
AM494696.1 Hepatitis B virus complete genome, isolate CAR060 223..a..................24395
AM494697.1 Hepatitis B virus complete genome, isolate CAR063 223..a..................24395
AM494698.1 Hepatitis B virus complete genome, isolate CAR066 202..a..................22295
AM494699.1 Hepatitis B virus complete genome, isolate CAR082 223..a..................24395
AM494700.1 Hepatitis B virus complete genome, isolate CAR083 223..a..................24395
AM494701.1 Hepatitis B virus complete genome, isolate CAR097 223..a..................24395
AM494702.1 Hepatitis B virus complete genome, isolate CAR106 223..a..................24395
AM494703.1 Hepatitis B virus complete genome, isolate CAR107 223..a..................24395
AM494704.1 Hepatitis B virus complete genome, isolate CAR112 223..a..................24395
AM494705.1 Hepatitis B virus complete genome, isolate CAR115 223..a..................24395
AM494706.1 Hepatitis B virus complete genome, isolate CAR131 223..a..................24395
AM494707.1 Hepatitis B virus complete genome, isolate CAR137 223..a..................24395
AM494708.1 Hepatitis B virus complete genome, isolate CAR138 223..a..................24395
AM494709.1 Hepatitis B virus complete genome, isolate CAR143 223..a..................24395
AM494710.1 Hepatitis B virus complete genome, isolate CAR144 223..a..................24395
AM494711.1 Hepatitis B virus complete genome, isolate CAR146 220..a..................24095
AM494712.1 Hepatitis B virus complete genome, isolate CAR150 220..a..................24095
AM494713.1 Hepatitis B virus complete genome, isolate CAR154 223..a..................24395
AM494714.1 Hepatitis B virus complete genome, isolate CAR165 223..a..................24395
AM494715.1 Hepatitis B virus complete genome, isolate CAR171 223..a..................24395
AM494717.1 Hepatitis B virus complete genome, isolate CAR187 223..a..................24395
EU306673.1 Hepatitis B virus clone 213-10, complete genome 223..................a..24395
EU306674.1 Hepatitis B virus clone 213-6, complete genome 223..................a..24395
EU306675.1 Hepatitis B virus clone 213-21, complete genome 223..................a..24395
EU306685.1 Hepatitis B virus clone 327-4, complete genome 223..................a..24395
EU306686.1 Hepatitis B virus clone 327-28, complete genome 223..................a..24395
EU306687.1 Hepatitis B virus clone 327-6, complete genome 223..................a..24395
EU306688.1 Hepatitis B virus clone 327-54, complete genome 223..................a..24395
EU306690.1 Hepatitis B virus clone 327-71, complete genome 223..................a..24395
EU306691.1 Hepatitis B virus clone 327-57, complete genome 223..................a..24395
EU306692.1 Hepatitis B virus clone 327-73, complete genome 223..................a..24395
EU306693.1 Hepatitis B virus clone 327-67, complete genome 223..................a..24395
EU306694.1 Hepatitis B virus clone 327-46, complete genome 223..................a..24395
EU306713.1 Hepatitis B virus clone 602-27, complete genome 223..................a..24395
EU306714.1 Hepatitis B virus clone 602-77, complete genome 223..................a..24395
EU306715.1 Hepatitis B virus clone 602(son)-17, complete genome 223..................a..24395
EU306716.1 Hepatitis B virus clone 602(son)-18, complete genome 223..................a..24395
EU306717.1 Hepatitis B virus clone 602(son)-22, complete genome 223..................a..24395
EU306718.1 Hepatitis B virus clone 602(son)-24, complete genome 223..................a..24395
EU306719.1 Hepatitis B virus clone 602(son)-23, complete genome 223..................a..24395
EU306720.1 Hepatitis B virus clone 602(son)-68, complete genome 223..................a..24395
EU306722.1 Hepatitis B virus clone 6022-28-, complete genome 223..................a..24395
EU306723.1 Hepatitis B virus clone 6022-19, complete genome 223..................a..24395
EU306724.1 Hepatitis B virus clone 6022-2-, complete genome 223..................a..24395
EU306725.1 Hepatitis B virus clone 6022-17, complete genome 223..................a..24395
EU306726.1 Hepatitis B virus clone 6022-12-, complete genome 223..................a..24395
EU306727.1 Hepatitis B virus clone 6022-5-, complete genome 223..................a..24395
EU306728.1 Hepatitis B virus clone 6022-43, complete genome 223..................a..24395
EU306729.1 Hepatitis B virus clone 6022-33, complete genome 223..................a..24395
EU439005.1 Hepatitis B virus clone 6022-35 from China, complete genome 223..................a..24395
EU439006.1 Hepatitis B virus clone 602(S)-3 from China, complete genome 223..................a..24395
EU439007.1 Hepatitis B virus clone 602(S)-39 from China, complete genome 223..................a..24395
EU439008.1 Hepatitis B virus clone 6023-27 from China, complete genome 223..................a..24395
EU439010.1 Hepatitis B virus clone 6023-38 from China, complete genome 223..................a..24395
EU439015.1 Hepatitis B virus clone zgh-26 from China, complete genome 223..................a..24395
EU439016.1 Hepatitis B virus clone zgh-9 from China, complete genome 223..................a..24395
AB365451.1 Hepatitis B virus DNA, complete genome, isolate: BOL196 223..................a..24395
AB426467.1 Hepatitis B virus DNA, complete genome, clone: HBVFH0204 223..................a..24395
EU547558.1 Hepatitis B virus isolate MC01, complete genome 223..................a..24395
EU547559.1 Hepatitis B virus isolate MC02, complete genome 190..................a..21095
EU547561.1 Hepatitis B virus isolate MC04, complete genome 223..................a..24395
AB299858.1 Hepatitis B virus subtype adr DNA, complete genome, clone: HBVFH0204 223..................a..24395
EU554535.1 Hepatitis B virus isolate S472-20, complete genome 223..................a..24395
EU554536.1 Hepatitis B virus isolate S472-24, complete genome 223..................a..24395
EU554537.1 Hepatitis B virus isolate S541-13, complete genome 223..................a..24395
EU554538.1 Hepatitis B virus isolate S541-15, complete genome 223..................a..24395
EU554539.1 Hepatitis B virus isolate S541-21, complete genome 223..................a..24395
EU554540.1 Hepatitis B virus isolate S304-10, complete genome 223..................a..24395
EU554541.1 Hepatitis B virus isolate S696-1, complete genome 223..................a..24395
EU554542.1 Hepatitis B virus isolate S696-4, complete genome 223..................a..24395
EU562215.1 Hepatitis B virus isolate 11, complete genome 223..................a..24395
EU562216.1 Hepatitis B virus isolate 13, complete genome 223..................a..24395
EU562217.1 Hepatitis B virus isolate 16, complete genome 223..................a..24395
EU562218.1 Hepatitis B virus isolate 7, complete genome 223..................a..24395
EU562219.1 Hepatitis B virus isolate 5, complete genome 223..................a..24395
EU560438.1 Hepatitis B virus isolate 2-B74, complete genome 223..................a..24395
EU560439.1 Hepatitis B virus isolate 7-B74, complete genome 223..................a..24395
EU560440.1 Hepatitis B virus isolate 1-S869, complete genome 223..................a..24395
EU560441.1 Hepatitis B virus isolate 4-S869, complete genome 223..................a..24395
EU570067.1 Hepatitis B virus isolate 18-S541, complete genome 223..................a..24395
EU570068.1 Hepatitis B virus isolate 26-S541, complete genome 223..................a..24395
EU570072.1 Hepatitis B virus isolate 1-B74, complete genome 223..................a..24395
EU570073.1 Hepatitis B virus isolate 8-S698, complete genome 223..................a..24395
EU570074.1 Hepatitis B virus isolate 11-S698, complete genome 223..................a..24395
EU579443.1 Hepatitis B virus isolate 2 genotype C, complete genome 223..................a..24395
EU589336.1 Hepatitis B virus isolate S1175-1, complete genome 223..................a..24395
EU589337.1 Hepatitis B virus isolate S710-2, complete genome 217..................a..23795
EU589340.1 Hepatitis B virus isolate S852-7, complete genome 178..................a..19895
EU589341.1 Hepatitis B virus isolate S852-10, complete genome 178..................a..19895
EU589342.1 Hepatitis B virus isolate S852-13, complete genome 178..................a..19895
EU589343.1 Hepatitis B virus isolate S852-15, complete genome 178..................a..19895
EU589345.1 Hepatitis B virus isolate S624-2, complete genome 208..................a..22895
EU717211.1 Hepatitis B virus isolate D23K-6, complete genome 225..................a..24595
EU717212.1 Hepatitis B virus isolate D26K-7, complete genome 225..................a..24595
EU796069.1 Hepatitis B virus strain 4364, complete genome 223..................a..24395
EU796070.1 Hepatitis B virus strain 4460, complete genome 223..................a..24395
EU796072.1 Hepatitis B virus strain 5131, complete genome 223..................a..24395
EU871969.1 Hepatitis B virus isolate 6-024-1, complete genome 223..................a..24395
EU871970.1 Hepatitis B virus isolate 6-024-3, complete genome 223..................a..24395
EU871972.1 Hepatitis B virus isolate 6-024-8, complete genome 223..................a..24395
EU871973.1 Hepatitis B virus isolate 6-024-99-5, complete genome 223..................a..24395
EU871974.1 Hepatitis B virus isolate 6-024A-1, complete genome 223..................a..24395
EU871976.1 Hepatitis B virus isolate 179-04-3, complete genome 223..................a..24395
EU871978.1 Hepatitis B virus isolate 252-95-2, complete genome 223..................a..24395
EU871979.1 Hepatitis B virus isolate 252-95-4, complete genome 223..................a..24395
EU871981.1 Hepatitis B virus isolate 318-95-3, complete genome 223..................a..24395
EU871982.1 Hepatitis B virus isolate 318-96-2, complete genome 223..................a..24395
EU871983.1 Hepatitis B virus isolate 318-97-2, complete genome 223..................a..24395
EU871984.1 Hepatitis B virus isolate 490-00-1, complete genome 223..................a..24395
EU871985.1 Hepatitis B virus isolate 490-00-3, complete genome 223..................a..24395
EU871986.1 Hepatitis B virus isolate 490-1, complete genome 223..................a..24395
EU871987.1 Hepatitis B virus isolate 490-01-1, complete genome 223..................a..24395
EU871988.1 Hepatitis B virus isolate 490-01-3, complete genome 223..................a..24395
EU871989.1 Hepatitis B virus isolate 490-03-3, complete genome 223..................a..24395
EU871990.1 Hepatitis B virus isolate 490-04-1, complete genome 223..................a..24395
EU871991.1 Hepatitis B virus isolate 490-04-3, complete genome 223..................a..24395
EU871992.1 Hepatitis B virus isolate 490-99-1, complete genome 223..................a..24395
EU871993.1 Hepatitis B virus isolate 490-99-2, complete genome 223..................a..24395
EU871994.1 Hepatitis B virus isolate 490A-3, complete genome 223..................a..24395
EU871995.1 Hepatitis B virus isolate 490A-4, complete genome 223..................a..24395
EU871996.1 Hepatitis B virus isolate 490A-6, complete genome 223..................a..24395
EU871997.1 Hepatitis B virus isolate 530-00-3, complete genome 223..................a..24395
EU871999.1 Hepatitis B virus isolate 530-00-7, complete genome 223..................a..24395
EU872000.1 Hepatitis B virus isolate 530-92-2, complete genome 223..................a..24395
EU872001.1 Hepatitis B virus isolate 530-92-8, complete genome 223..................a..24395
EU872002.1 Hepatitis B virus isolate 530-97-1, complete genome 223..................a..24395
EU872003.1 Hepatitis B virus isolate 530-97-2, complete genome 223..................a..24395
EU872004.1 Hepatitis B virus isolate 530-97-3, complete genome 223..................a..24395
EU872006.1 Hepatitis B virus isolate 318-92-1, complete genome 223..................a..24395
EU872007.1 Hepatitis B virus isolate 252-92-6, complete genome 223..................a..24395
EU872008.1 Hepatitis B virus isolate 252A-8, complete genome 223..................a..24395
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 208..................a..22895
EU872010.1 Hepatitis B virus isolate 252-92-3, complete genome 223..................a..24395
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 208..................a..22895
EU872012.1 Hepatitis B virus isolate 318-99-5, complete genome 223..................a..24395
EU872013.1 Hepatitis B virus isolate 318-99-6, complete genome 208..................a..22895
EU872014.1 Hepatitis B virus isolate 490-96-3, complete genome 168..................a..18895
EU872015.1 Hepatitis B virus isolate 490-96-1, complete genome 168..................a..18895
EU872016.1 Hepatitis B virus isolate 490A-1, complete genome 223..................a..24395
EU872017.1 Hepatitis B virus isolate 530-00-6, complete genome 223..................a..24395
EU594404.1 Hepatitis B virus strain 1901-98, complete genome 223...................a.24395
EU594405.1 Hepatitis B virus strain 620-98, complete genome 223.....c...............24395
EU787444.1 Hepatitis B virus isolate W41, complete genome 223..................a..24395
EU939536.1 Hepatitis B virus isolate C3, complete genome 223..................a..24395
EU939536.1 Hepatitis B virus isolate C3, complete genome 834__.........t..a...___84966
EU939537.1 Hepatitis B virus isolate C8, complete genome 169..................a..18995
EU939538.1 Hepatitis B virus isolate C9, complete genome 223..................a..24395
EU939540.1 Hepatitis B virus isolate C24, complete genome 223..................a..24395
EU939541.1 Hepatitis B virus isolate C25, complete genome 223..................a..24395
EU939542.1 Hepatitis B virus isolate C26, complete genome 223..................a..24395
EU939543.1 Hepatitis B virus isolate C38, complete genome 223..................a..24395
EU939544.1 Hepatitis B virus isolate C39, complete genome 223..................a..24395
EU939545.1 Hepatitis B virus isolate C41, complete genome 223..................a..24395
EU939546.1 Hepatitis B virus isolate C44, complete genome 223..................a..24395
EU939547.1 Hepatitis B virus isolate C45, complete genome 223..................a..24395
EU939548.1 Hepatitis B virus isolate C46, complete genome 223..................a..24395
EU939549.1 Hepatitis B virus isolate C49, complete genome 223..................a..24395
EU939550.1 Hepatitis B virus isolate C55, complete genome 223..................a..24395
EU939551.1 Hepatitis B virus isolate C56, complete genome 223..................a..24395
EU939552.1 Hepatitis B virus isolate C57, complete genome 223..................a..24395
EU939553.1 Hepatitis B virus isolate C60, complete genome 223..................a..24395
EU939554.1 Hepatitis B virus isolate C61, complete genome 223..................a..24395
EU939555.1 Hepatitis B virus isolate C63, complete genome 223..................a..24395
EU939556.1 Hepatitis B virus isolate C64, complete genome 214..................a..23495
EU939557.1 Hepatitis B virus isolate C65, complete genome 211..................a..23195
EU939560.1 Hepatitis B virus isolate C69, complete genome 190..................a..21095
EU939561.1 Hepatitis B virus isolate C70, complete genome 223..................a..24395
EU939562.1 Hepatitis B virus isolate C75, complete genome 223..................a..24395
EU939563.1 Hepatitis B virus isolate C76, complete genome 223..................a..24395
EU939564.1 Hepatitis B virus isolate C77, complete genome 223..................a..24395
EU939565.1 Hepatitis B virus isolate C86, complete genome 223..................a..24395
EU939566.1 Hepatitis B virus isolate C88, complete genome 223..................a..24395
EU939567.1 Hepatitis B virus isolate C91, complete genome 223..................a..24395
EU939569.1 Hepatitis B virus isolate C102, complete genome 223..................a..24395
EU939570.1 Hepatitis B virus isolate C103, complete genome 223..................a..24395
EU939571.1 Hepatitis B virus isolate C104, complete genome 223..................a..24395
EU939572.1 Hepatitis B virus isolate C105, complete genome 223..................a..24395
EU939573.1 Hepatitis B virus isolate C106, complete genome 223..................a..24395
EU939574.1 Hepatitis B virus isolate C109, complete genome 195..................a..21595
EU939575.1 Hepatitis B virus isolate C113, complete genome 219..................a..23995
EU939576.1 Hepatitis B virus isolate C115, complete genome 193..................a..21395
EU939577.1 Hepatitis B virus isolate C116, complete genome 223..................a..24395
EU939578.1 Hepatitis B virus isolate C119, complete genome 223..................a..24395
EU939579.1 Hepatitis B virus isolate C120, complete genome 223..................a..24395
EU939580.1 Hepatitis B virus isolate B1, complete genome 223..................a..24395
EU939581.1 Hepatitis B virus isolate B16, complete genome 223..................a..24395
EU939582.1 Hepatitis B virus isolate B25, complete genome 223..................a..24395
EU939583.1 Hepatitis B virus isolate B31, complete genome 181..................a..20195
EU939584.1 Hepatitis B virus isolate B107, complete genome 223..................a..24395
EU939585.1 Hepatitis B virus isolate B126, complete genome 223..................a..24395
EU939586.1 Hepatitis B virus isolate B142, complete genome 223..................a..24395
EU939587.1 Hepatitis B virus isolate C2, complete genome 223..................a..24395
EU939588.1 Hepatitis B virus isolate C173, complete genome 223..................a..24395
EU939589.1 Hepatitis B virus isolate C175, complete genome 223..................a..24395
EU939590.1 Hepatitis B virus isolate C127, complete genome 223..................a..24395
EU939591.1 Hepatitis B virus isolate C131, complete genome 223..................a..24395
EU939592.1 Hepatitis B virus isolate C141, complete genome 223..................a..24395
EU939593.1 Hepatitis B virus isolate C144, complete genome 223..................a..24395
EU939594.1 Hepatitis B virus isolate C146, complete genome 223..................a..24395
EU939595.1 Hepatitis B virus isolate C147, complete genome 223..................a..24395
EU939596.1 Hepatitis B virus isolate C149, complete genome 223..................a..24395
EU939597.1 Hepatitis B virus isolate C151, complete genome 223..................a..24395
EU939598.1 Hepatitis B virus isolate C164, complete genome 223..................a..24395
EU939599.1 Hepatitis B virus isolate C172, complete genome 220..................a..24095
EU939600.1 Hepatitis B virus isolate C176, complete genome 223..................a..24395
EU939601.1 Hepatitis B virus isolate C177, complete genome 223..................a..24395
EU939602.1 Hepatitis B virus isolate C179, complete genome 223..................a..24395
EU939604.1 Hepatitis B virus isolate C192, complete genome 223..................a..24395
EU939605.1 Hepatitis B virus isolate C200, complete genome 223..................a..24395
EU939606.1 Hepatitis B virus isolate C206, complete genome 223..................a..24395
EU939607.1 Hepatitis B virus isolate C207, complete genome 223..................a..24395
EU939609.1 Hepatitis B virus isolate C209, complete genome 223..................a..24395
EU939610.1 Hepatitis B virus isolate C211, complete genome 223..................a..24395
EU939611.1 Hepatitis B virus isolate C212, complete genome 223..................a..24395
EU939612.1 Hepatitis B virus isolate C213, complete genome 223..................a..24395
EU939613.1 Hepatitis B virus isolate C214, complete genome 223..................a..24395
EU939614.1 Hepatitis B virus isolate C217, complete genome 223..................a..24395
EU939615.1 Hepatitis B virus isolate C226, complete genome 223..................a..24395
EU939616.1 Hepatitis B virus isolate C228, complete genome 223..................a..24395
EU939617.1 Hepatitis B virus isolate C229, complete genome 223..................a..24395
EU939618.1 Hepatitis B virus isolate C230, complete genome 223..................a..24395
EU939619.1 Hepatitis B virus isolate C233, complete genome 223..................a..24395
EU939620.1 Hepatitis B virus isolate B140, complete genome 223..................a..24395
EU939621.1 Hepatitis B virus isolate C94, complete genome 223..................a..24395
EU939622.1 Hepatitis B virus isolate C124, complete genome 223..................a..24395
EU939623.1 Hepatitis B virus isolate C126, complete genome 223..................a..24395
EU939625.1 Hepatitis B virus isolate C167, complete genome 223..................a..24395
EU939626.1 Hepatitis B virus isolate D158, complete genome 223..................a..24395
EU939628.1 Hepatitis B virus isolate C72, complete genome 216..................a..23695
EU939630.1 Hepatitis B virus isolate C122, complete genome 223..................a..24395
EU939634.1 Hepatitis B virus isolate C19, complete genome 223..................a..24395
EU939640.1 Hepatitis B virus isolate C239, complete genome 223..................a..24395
EU939641.1 Hepatitis B virus isolate D18, complete genome 169..................a..18995
EU939642.1 Hepatitis B virus isolate D20, complete genome 223..................a..24395
EU939643.1 Hepatitis B virus isolate D32, complete genome 223..................a..24395
EU939644.1 Hepatitis B virus isolate D36, complete genome 223..................a..24395
EU939645.1 Hepatitis B virus isolate D38, complete genome 223..................a..24395
EU939646.1 Hepatitis B virus isolate D88, complete genome 223..................a..24395
EU939647.1 Hepatitis B virus isolate D90, complete genome 223..................a..24395
EU939648.1 Hepatitis B virus isolate D96, complete genome 223..................a..24395