../../tmp/servers/virsirnadb/170726909
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18651aagacatagagatggtgtccggagac26
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 95771..........................95796100
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 116094___.a.........a..a._______11610950
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 92014____________.c..........c.9200146
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 115110___.........gc..._________11512346
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 89844____________..........g.__8985542
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 7563___.........._____________757238
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 7623___.........._____________763238
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 7803___.........._____________781238
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 7890___.........._____________789938
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 56993__..........______________5698438
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 109899________________..........10989038
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 51979__..g.cg.g........._______5199550
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 93518________.........g.tat..._9350250
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 120216________.........c.g.at.._12020050
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 58552___.a.........____________5856238
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 63763__........._______________6375534
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 93036__________........._______9302834
NC_009334.1 Human herpesvirus 4, complete genome 96683..........................96708100
NC_009334.1 Human herpesvirus 4, complete genome 156745...........gg...__________15673053
NC_009334.1 Human herpesvirus 4, complete genome 162034.t..........._____________16202246
NC_009334.1 Human herpesvirus 4, complete genome 117002___.a.........a..a._______11701750
NC_009334.1 Human herpesvirus 4, complete genome 92926____________.c..........c.9291346
NC_009334.1 Human herpesvirus 4, complete genome 116018___.........gc..._________11603146
NC_009334.1 Human herpesvirus 4, complete genome 90757____________..........g.__9076842
NC_009334.1 Human herpesvirus 4, complete genome 57174__..........______________5716538
NC_009334.1 Human herpesvirus 4, complete genome 110810________________..........11080138
NC_009334.1 Human herpesvirus 4, complete genome 52160__..g.cg.g........._______5217650
NC_009334.1 Human herpesvirus 4, complete genome 94430________.........g.tat..._9441450
NC_009334.1 Human herpesvirus 4, complete genome 58667___.a.........____________5867738
NC_009334.1 Human herpesvirus 4, complete genome 84789_.........a.______________8479938
NC_009334.1 Human herpesvirus 4, complete genome 139671_____________.........t.__13968138
NC_009334.1 Human herpesvirus 4, complete genome 63881__........._______________6387334
NC_009334.1 Human herpesvirus 4, complete genome 80136____........._____________8014434
NC_009334.1 Human herpesvirus 4, complete genome 93948__________........._______9394034
NC_009334.1 Human herpesvirus 4, complete genome 131132........._________________13114034
NC_009334.1 Human herpesvirus 4, complete genome 131493__........._______________13148534
NC_009334.1 Human herpesvirus 4, complete genome 132105___________.........______13211334