../../tmp/servers/virsirnadb/964435401
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi11251aagaggactcttggactctc20
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 1656....................1675100
X01587.1 Hepatitis B virus subtype adr4 (HBV) 1528....................1547100
X14193.1 Hepatitis B virus DNA for adr mutant 1653....................1672100
X65257.1 Hepatitis B virus (ayw,patient C) PreS1, PreS2, PreC, C, X and polyme1658....................1677100
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 1656....................1675100
V01460.1 Hepatitis B virus (strain ayw) genome 1529....................1510100
X02496.1 Human hepatitis B virus strain ayw variant 1658....................1677100
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 1530....................1549100
D12980.1HPBCG Hepatitis B virus subtype adr(SRADR) DNA, complete genome 1530....................1549100
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 1656....................1675100
X59795.1 Hepatitis B virus (ayw subtype mutant) complete genome 1637....................1656100
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 1653....................1672100
M32138.1HPBHBVAA Hepatitis B virus variant HBV-alpha1, complete genome 1658....................1677100
L27106.1HPBMUT Hepatitis B virus mutant complete genome 1661....................1680100
X75657.1 Human hepatitis virus (genotype E, Bas) preS1, preS2, S, C, X, antige1656....................1675100
X75664.1 Human hepatitis virus (genotype E, Kou) preS1, preS2, S, C, X, antige1656....................1675100
X75656.1 Human hepatitis virus (genotype C, Cha) preS1, preS2, S, C, X, antige1656....................1675100
X52939.1 Hepatitis B virus genome with a pre X orf 1529....................1548100
Z35716.1 Human hepatitis B virus (ayw4) genes for surface protein S, core prot1658....................1677100
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 1658....................1677100
D23680.1HPBB4HST1 Hepatitis B virus (B4-HBVST1) complete genome sequence 1656....................1675100
D23681.1HPBC4HST2 Hepatitis B virus (C4-HBVST2) complete genome sequence 1656....................1675100
D23682.1HPBB5HKO1 Hepatitis B virus (B5-HBVKO1) complete genome sequence 1656....................1675100
D23683.1HPBC5HKO2 Hepatitis B virus (C5-HBVKO2) complete genome sequence 1656....................1675100
D23684.1HPBC6T588 Hepatitis B virus (C6-TKB588) complete genome sequence 1656....................1675100
S75184.1 S...preS2 [hepatitis B virus HBV, host=human plasma Nis 0859434, Geno1656....................1675100
D50489.1HPBA11A Hepatitis B virus DNA, complete genome, isolate:A11 1658....................1677100
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete1658....................1677100
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete1658....................1677100
X80924.1 Hepatitis B virus (patient 4) complete genome 1658....................1677100
X80926.1 Hepatitis B virus (patient 5) complete genome 1658....................1677100
X97848.1 Hepatitis B virus (patient 2) complete genome 1658....................1677100
X97849.1 Hepatitis B virus (patient 3) complete genome 1658....................1677100
Y07587.1 Hepatitis B virus, complete genome 1658....................1677100
U95551.1 Hepatitis B virus subtype ayw, complete genome 1658....................1677100
D28880.1 Hepatitis B virus DNA, complete genome, strain Fukuoka Red Cross HBV 1656....................1675100
D50517.1 Hepatitis B virus clone HBV-ASA-EX1 genomic DNA, complete sequence 1656....................1675100
D50518.1 Hepatitis B virus clone HBV-ASA-EX2 genomic DNA, complete sequence 1656....................1675100
D50519.1 Hepatitis B virus clone HBV-ASA-EX3 genomic DNA, complete sequence 1656....................1675100
D50520.1 Hepatitis B virus clone HBV-ASA-EX4 genomic DNA, complete sequence 1656....................1675100
AF043593.1 Hepatitis B virus isolate 6/89, complete genome 1644....................1663100
AF043594.1 Hepatitis B virus isolate 1/91, complete genome 1656....................1675100
AB014360.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D01HCC 1656....................1675100
AB014362.1 Hepatitis B virus genomic DNA, complete sequence, isolate 03D03HCC 1656....................1675100
AB014363.1 Hepatitis B virus genomic DNA, complete sequence, isolate 04D04HCC 1656....................1675100
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 1656....................1675100
AB014365.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D06HCC 1656....................1675100
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 1608....................1627100
AB014369.1 Hepatitis B virus genomic DNA, complete sequence, isolate 10D10HCC 1656....................1675100
AB014372.1 Hepatitis B virus genomic DNA, complete sequence, isolate 13D13HCC 1656....................1675100
AB014373.1 Hepatitis B virus genomic DNA, complete sequence, isolate 14D14HCC 1620....................1639100
AB014374.1 Hepatitis B virus genomic DNA, complete sequence, isolate 15D15HCC 1656....................1675100
AB014375.1 Hepatitis B virus genomic DNA, complete sequence, isolate 16T01HCC 1611....................1630100
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 1656....................1675100
AB014377.1 Hepatitis B virus genomic DNA, complete sequence, isolate 18T03HCC 1656....................1675100
AB014378.1 Hepatitis B virus genomic DNA, complete sequence, isolate 19Y01HCC 1656....................1675100
AB014379.1 Hepatitis B virus genomic DNA, complete sequence, isolate 20Y02HCC 1656....................1675100
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 1617....................1636100
AB014394.1 Hepatitis B virus genomic DNA, complete sequence, isolate 35Y17HCC 1656....................1675100
AB014395.1 Hepatitis B virus genomic DNA, complete sequence, isolate 36Y18HCC 1643....................1662100
AB014371.1 Hepatitis B virus genomic DNA, complete sequence, isolate 12D12HCC 1662....................1681100
AB014381.1 Hepatitis B virus genomic DNA, complete sequence, isolate 22Y04HCC 1656....................1675100
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 1656....................1675100
AB014383.1 Hepatitis B virus genomic DNA, complete sequence, isolate 24Y06HCC 1656....................1675100
AB014384.1 Hepatitis B virus genomic DNA, complete sequence, isolate 25Y07HCC 1656....................1675100
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 1656....................1675100
AB014386.1 Hepatitis B virus genomic DNA, complete sequence, isolate 27Y09HCC 1455....................1474100
AB014388.1 Hepatitis B virus genomic DNA, complete sequence, isolate 29Y11HCC 1602....................1621100
AB014392.1 Hepatitis B virus genomic DNA, complete sequence, isolate 33Y15HCC 1656....................1675100
AB014393.1 Hepatitis B virus genomic DNA, complete sequence, isolate 34Y16HCC 1656....................1675100
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 1656....................1675100
AB014397.1 Hepatitis B virus genomic DNA, complete sequence, isolate 38Y20HCC 1626....................1645100
AB014398.1 Hepatitis B virus genomic DNA, complete sequence, isolate 39Y21HCC 1608....................1627100
AB014399.1 Hepatitis B virus genomic DNA, complete sequence, isolate 40Y22HCC 1656....................1675100
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 1658....................1677100
AF068756.1 Hepatitis B virus, complete genome 1659....................1678100
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 1653....................1672100
Y18856.1 Hepatitis B virus complete genome, isolate HBV-C5 1653....................1672100
Y18857.1 Hepatitis B virus complete genome, isolate HBV-C6 1653....................1672100
Y18858.1 Hepatitis B virus complete genome, isolate HBV-C7 1653....................1672100
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 283....................302100
AF151735.1 Hepatitis B virus, complete genome 1656....................1675100
AB031262.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietA-31656....................1675100
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-21656....................1675100
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 1658....................1677100
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 1658....................1677100
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 1654....................1673100
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 1654....................1673100
AB026815.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 2:full 1654....................1673100
AB033550.1 Hepatitis B virus DNA, complete genome 1656....................1675100
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 1656....................1675100
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 1656....................1675100
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 1656....................1675100
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 1656....................1675100
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 1656....................1675100
AB033558.1 Hepatitis B virus DNA, complete genome, isolate:JYW796 1656....................1675100
AB032431.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV/E-Ch1951656....................1675100
AF121239.1 Hepatitis B virus isolate HBV/1303, complete genome 1656....................1675100
AF121240.1 Hepatitis B virus isolate HBV/11066, complete genome 1656....................1675100
AF121241.1 Hepatitis B virus isolate HBV/1758, complete genome 1656....................1675100
AF121242.1 Hepatitis B virus isolate HBV/1218, complete genome 1656....................1675100
AF280817.1 Hepatitis B virus DNA, complete sequence, isolate: HBV-D1 1656....................1675100
AF241410.1 Hepatitis B virus isolate 3270, complete genome 1656....................1675100
AF241411.1 Hepatitis B virus isolate 8290, complete genome 1656....................1675100
AB050018.1 Hepatitis B virus DNA, complete genome 1656....................1675100
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 1656....................1675100
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 1656....................1675100
AB042284.1 Hepatitis B virus DNA, complete genome, isolate:NSS-3 1656....................1675100
AB042285.1 Hepatitis B virus DNA, complete genome, isolate:NSS-4 1656....................1675100
AJ132335.1 Hepatitis B Virus complete genome, isolate PES1 1656....................1675100
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 1656....................1675100
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 1656....................1675100
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 1656....................1675100
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 1656....................1675100
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 1656....................1675100
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 1656....................1675100
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 1656....................1675100
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 1656....................1675100
AF223961.1 Hepatitis B virus strain C-1858 isolate ea8, complete genome 1656....................1675100
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 1656....................1675100
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1656....................1675100
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1656....................1675100
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1656....................1675100
AB048705.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1656....................1675100
AF330110.1 Hepatitis B virus strain T-1858 genotype C, complete genome 1656....................1675100
AF363961.1 Hepatitis B virus strain G683-1, complete genome 3051....................3070100
AF363962.1 Hepatitis B virus strain G683-2, complete genome 3018....................3037100
AF363963.1 Hepatitis B virus strain G683-3, complete genome 3050....................3069100
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 3051....................3070100
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 2961....................2980100
AY040627.1 Hepatitis B virus genotype C, complete genome 1656....................1675100
AF297619.1 Hepatitis B virus adw2, complete genome 1656....................1675100
AF297620.1 Hepatitis B virus adw1, complete genome 1656....................1675100
AF411408.1 Hepatitis B virus strain FMU#14, complete genome 1658....................1677100
AF411411.1 Hepatitis B virus strain FMC#97, complete genome 1658....................1677100
AF411412.1 Hepatitis B virus strain FMC#15, complete genome 1658....................1677100
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 1656....................1675100
AY066028.1 Hepatitis B virus isolate FH4, complete genome 1658....................1677100
AF458665.1 Hepatitis B virus isolate C733, complete genome 1658....................1677100
AF461357.1 Hepatitis B virus isolate FH5, compete genome 1658....................1677100
AF461363.1 Hepatitis B virus isolate C8, compete genome 1658....................1677100
AF461043.1 Hepatitis B virus, complete genome 1656....................1675100
AJ344117.1 Hepatitis B virus complete genome, genotype D 1656....................1675100
AF473543.1 Hepatitis B virus isolate 2e, complete genome 1656....................1675100
U87742.3 Hepatitis B virus isolate 7983, complete genome 1661....................1680100
AB073840.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw36 1656....................1675100
AB073841.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw30 1656....................1675100
AB073852.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry11 1656....................1675100
AB073858.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Shin 1656....................1675100
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 1656....................1675100
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 1656....................1675100
AY090452.1 Hepatitis B virus strain Z29, complete genome 1659....................1678100
AY090453.1 Hepatitis B virus strain 14-94, complete genome 1659....................1678100
AY123041.1 Hepatitis B virus serotype adr, complete genome 1530....................1549100
AF286594.1 Hepatitis B virus subtype adr, complete genome 1656....................1675100
AF533983.1 Hepatitis B virus genotype C, complete genome 1656....................1675100
AF418674.1 Hepatitis B virus patient 1185 clone 1, complete genome 1656....................1675100
AF418675.1 Hepatitis B virus patient 1185 clone 2, complete genome 1656....................1675100
AF418679.1 Hepatitis B virus patient 821 clone 1, complete genome 1658....................1677100
AF418680.1 Hepatitis B virus patient 821 clone 2, complete genome 1658....................1677100
AF418681.1 Hepatitis B virus patient 821 clone 3, complete genome 1658....................1677100
AF418684.1 Hepatitis B virus patient 313 clone 1, complete genome 1656....................1675100
AF418685.1 Hepatitis B virus patient 313 clone 2, complete genome 1656....................1675100
AF418686.1 Hepatitis B virus patient 313 clone 3, complete genome 1652....................1671100
AF418687.1 Hepatitis B virus patient 313 clone 4, complete genome 1653....................1672100
AF418688.1 Hepatitis B virus patient 313 clone 5, complete genome 1654....................1673100
AF418689.1 Hepatitis B virus patient 313 clone 6, complete genome 1655....................1674100
AF418690.1 Hepatitis B virus patient 313 clone 7, complete genome 1656....................1675100
AF418691.1 Hepatitis B virus patient 313 clone 8, complete genome 1655....................1674100
AF418692.1 Hepatitis B virus patient 313 clone 9, complete genome 1657....................1676100
AY163869.1 Hepatitis B virus isolate FMClx-1, complete genome 1658....................1677100
AY163870.1 Hepatitis B virus isolate FMU001, complete genome 1658....................1677100
AY161140.1 Hepatitis B virus clone S2.1 complete genome 1656....................1675100
AY161141.1 Hepatitis B virus clone S2.2 complete genome 1656....................1675100
AY161147.1 Hepatitis B virus clone S5.1 complete genome 1655....................1674100
AY161148.1 Hepatitis B virus clone S5.2 complete genome 1653....................1672100
AY161149.1 Hepatitis B virus clone S5.3 complete genome 1655....................1674100
AY161150.1 Hepatitis B virus clone S6.1 complete genome 1656....................1675100
AY161151.1 Hepatitis B virus clone S6.2, complete genome 1656....................1675100
AY161152.1 Hepatitis B virus clone S6.3, complete genome 1656....................1675100
AY161153.1 Hepatitis B virus clone S6.4 complete genome 1656....................1675100
AY161154.1 Hepatitis B virus clone S6.5, complete genome 1656....................1675100
AY161155.1 Hepatitis B virus clone S6.6, complete genome 1656....................1675100
AY161156.1 Hepatitis B virus clone S6.7, complete genome 1656....................1675100
AY161157.1 Hepatitis B virus clone S7.1 complete genome 1656....................1675100
AY161158.1 Hepatitis B virus clone S7.2 complete genome 1656....................1675100
AY161159.1 Hepatitis B virus clone S8.1 complete genome 1656....................1675100
AY161160.1 Hepatitis B virus clone S8.2 complete genome 1656....................1675100
AY161161.1 Hepatitis B virus clone S9.1 complete genome 1656....................1675100
AY161162.1 Hepatitis B virus clone S9.2 complete genome 1656....................1675100
AY161163.1 Hepatitis B virus clone S9.3 complete genome 1656....................1675100
AY148342.1 Hepatitis B virus, complete genome 3020....................3039100
AB078032.1 Hepatitis B virus complete genome, isolate:AH1-SY 1656....................1675100
AB090268.1 Hepatitis B virus DNA, complete genome, strain:CH1-OHs 1656....................1675100
AB090269.1 Hepatitis B virus DNA, complete genome, strain:CH2-OHf 1656....................1675100
AB090270.1 Hepatitis B virus DNA, complete genome, strain:b-dono12 1656....................1675100
AB091255.1 Hepatitis B virus DNA, complete genome, isplate:ABI-129 1656....................1675100
AB091256.1 Hepatitis B virus DNA, complete genome, isplate:ABI-212 1656....................1675100
AY217371.1 Hepatitis B virus isolate 1-7, complete genome 1656....................1675100
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 1638....................1657100
AY217373.1 Hepatitis B virus isolate 594, complete genome 1660....................1679100
AY217375.1 Hepatitis B virus isolate 599, complete genome 1656....................1675100
AY217375.1 Hepatitis B virus isolate 599, complete genome 1685....................1704100
AY217376.1 Hepatitis B virus isolate Q1-1, complete genome 1656....................1675100
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 1657....................1676100
AY217378.1 Hepatitis B virus isolate Q3-2, complete genome 1645....................1664100
AY217365.1 Hepatitis B virus isolate Q7-1, complete genome 1656....................1675100
AB106564.1 Hepatitis B virus DNA, complete genome, isolate:HBV-GA325 1656....................1675100
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 1656....................1675100
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 1656....................1675100
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 1656....................1675100
AY206376.1 Hepatitis B virus strain FMU005 complete genome 1658....................1677100
AY206378.1 Hepatitis B virus strain FMU007 complete genome 1622....................1641100
AY206379.1 Hepatitis B virus strain FMU008 complete genome 1658....................1677100
AY206388.1 Hepatitis B virus strain FMU017 complete genome 1658....................1677100
AY206389.1 Hepatitis B virus strain FMU018 complete genome 1658....................1677100
AY206392.1 Hepatitis B virus strain FMU021 complete genome 1658....................1677100
AY206393.1 Hepatitis B virus strain FMU022 complete genome 1658....................1677100
AB078031.2 Hepatitis B virus complete genome, isolate:FH1-YS 1656....................1675100
AB078033.2 Hepatitis B virus complete genome, isolate:IS1-OY 1656....................1675100
AY220699.1 Hepatitis B virus strain MH15, complete genome 1658....................1677100
AY220700.1 Hepatitis B virus strain MH534978, complete genome 1658....................1677100
AY220701.1 Hepatitis B virus strain WJQ310, complete genome 1658....................1677100
AY220702.1 Hepatitis B virus strain WJQ650, complete genome 1658....................1677100
AB104709.1 Hepatitis B virus DNA, complete sequence, isolate: EG64 1658....................1677100
AB104710.1 Hepatitis B virus DNA, complete sequence, isolate: EG105 1658....................1677100
AB104711.1 Hepatitis B virus DNA, complete sequence, isolate: EG104 1658....................1677100
AB104712.1 Hepatitis B virus DNA, complete sequence, isolate: EG75 1658....................1677100
AY233291.1 Hepatitis B virus isolate 179 complete genome 1656....................1675100
AY233292.1 Hepatitis B virus isolate 184 complete genome 1656....................1675100
AY233293.1 Hepatitis B virus isolate 12 complete genome 1656....................1675100
AY233294.1 Hepatitis B virus isolate 305 complete genome 1656....................1675100
AY233295.1 Hepatitis B virus isolate 8 complete genome 1656....................1675100
AY233296.1 Hepatitis B virus isolate 185 complete genome 1656....................1675100
AY167090.1 Hepatitis B virus isolate Ib, complete genome 1656....................1675100
AY167092.1 Hepatitis B virus isolate Id, complete genome 1620....................1639100
AY167095.1 Hepatitis B virus isolate IIc, complete genome 1656....................1675100
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 1656....................1675100
AY167099.1 Hepatitis B virus isolate IVb, complete genome 1656....................1675100
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co1654....................1673100
AB105172.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 2 1656....................1675100
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 161656....................1675100
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 601656....................1675100
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 1656....................1675100
AY373431.1 Hepatitis B virus clone SWT.4 complete genome 1656....................1675100
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 1656....................1675100
AY236162.1 Hepatitis B virus isolate 23 A, complete genome 3018....................3037100
AY236163.1 Hepatitis B virus isolate 29, complete genome 3000....................3019100
AB126581.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU301 1658....................1677100
AB111112.1 Hepatitis B virus DNA, complete genome, clone: HS-0 1656....................1675100
AB111113.1 Hepatitis B virus DNA, complete genome, clone: HS-6 1656....................1675100
AB111114.1 Hepatitis B virus DNA, complete genome, clone: HS-12 1656....................1675100
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 1733....................1752100
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 1656....................1675100
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 1656....................1675100
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 1656....................1675100
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 1656....................1675100
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 1656....................1675100
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 1656....................1675100
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 1656....................1675100
AB112066.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY624 1656....................1675100
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 1656....................1675100
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 1656....................1675100
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 1656....................1675100
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 1656....................1675100
AB116087.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND8 1656....................1675100
AB116089.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP39 1656....................1675100
AB116092.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH20 1656....................1675100
AB116266.1 Hepatitis B virus DNA, complete genome, strain: Ehime TY:871225 1656....................1675100
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 1656....................1675100
AB106895.1 Hepatitis B virus DNA, complete genome, isolate:pHB4-4 1656....................1675100
AY661792.1 Hepatitis B virus isolate ayw, complete genome 1658....................1677100
AY661793.1 Hepatitis B virus isolate 2, complete genome 1658....................1677100
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 1656....................1675100
AB120308.1 Hepatitis B virus DNA, complete genome, strain:Ehime-full 20:IM 820821656....................1675100
AY721605.1 Hepatitis B virus isolate AK1.1, complete genome 1658....................1677100
AY721606.1 Hepatitis B virus isolate AT1.2, complete genome 1658....................1677100
AY721607.1 Hepatitis B virus isolate HIY1.3, complete genome 1658....................1677100
AY721608.1 Hepatitis B virus isolate IB1.4, complete genome 1658....................1677100
AY721609.1 Hepatitis B virus isolate AA1.5, complete genome 1658....................1677100
AY721610.1 Hepatitis B virus isolate FK1.6, complete genome 1658....................1677100
AY721611.1 Hepatitis B virus isolate SK1.7, complete genome 1658....................1677100
AY721612.1 Hepatitis B virus isolate BL1.8, complete genome 1658....................1677100
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 1656....................1675100
AB176643.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NK1 1612....................1631100
AY741797.1 Hepatitis B virus isolate IR-IPI-21, complete genome 1658....................1677100
AY741798.1 Hepatitis B virus isolate IR-IPI-P4, complete genome 1661....................1680100
AY641558.1 Hepatitis B virus isolate He74, complete genome 1656....................1675100
AY641559.1 Hepatitis B virus isolate He53, complete genome 1656....................1675100
AY641560.1 Hepatitis B virus isolate He100, complete genome 1656....................1675100
AY641561.1 Hepatitis B virus isolate He127, complete genome 1656....................1675100
AY641562.1 Hepatitis B virus isolate He82, complete genome 1656....................1675100
AY800389.1 Hepatitis B virus isolate ZY041024, complete genome 1656....................1675100
AY796030.1 Hepatitis B virus isolate FC1.9, complete genome 1658....................1677100
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 1658....................1677100
AY796032.1 Hepatitis B virus isolate NA1.11, complete genome 1658....................1677100
AB113875.1 Hepatitis B virus DNA, complete genome, strain:HCC-1-MC 1656....................1675100
AB113876.1 Hepatitis B virus DNA, complete genome, strain:HCC-2-NY 1656....................1675100
AB113877.1 Hepatitis B virus DNA, complete genome, strain:HCC-3-TT 1656....................1675100
AB113878.1 Hepatitis B virus DNA, complete genome, strain:Ehime-Lam-MM1-001208 1656....................1675100
AB113879.1 Hepatitis B virus DNA, complete genome, strain:AH-1-ON980424 1656....................1675100
AB109475.1 Hepatitis B virus DNA, complete genome, strain:Ehime7: Iyo 0218004 1656....................1675100
AB109476.1 Hepatitis B virus DNA, complete genome, strain:Ehime8: Iyo 8288043 1656....................1675100
AB109477.1 Hepatitis B virus DNA, complete genome, strain:Ehime9: Iyo 529380 1656....................1675100
AB109478.1 Hepatitis B virus DNA, complete genome, strain:Ehime10: Iyo 41676 1656....................1675100
AB109479.1 Hepatitis B virus DNA, complete genome, strain:Ehime11: Iyo 529207 1656....................1675100
AB110075.1 Hepatitis B virus DNA, complete genome, strain: Ehime12:IM 011025 1656....................1675100
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 1656....................1675100
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 1656....................1675100
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 1656....................1675100
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 1656....................1675100
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 1656....................1675100
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 1656....................1675100
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 1656....................1675100
AY739674.1 Hepatitis B virus clone A1-33, complete genome 1656....................1675100
AY739675.1 Hepatitis B virus clone A1-35, complete genome 1656....................1675100
AY738144.1 Hepatitis B virus clone B3, complete genome 1656....................1675100
AY738145.1 Hepatitis B virus clone B5, complete genome 1656....................1675100
AY738146.1 Hepatitis B virus clone B9, complete genome 1656....................1675100
AY738147.1 Hepatitis B virus clone B11, complete genome 1656....................1675100
AY902768.1 Hepatitis B virus isolate MTB166, complete genome 1656....................1675100
AY902769.1 Hepatitis B virus isolate MTB009, complete genome 1656....................1675100
AY902770.1 Hepatitis B virus isolate MTB012, complete genome 1656....................1675100
AY902772.1 Hepatitis B virus isolate MTB158, complete genome 1656....................1675100
AY902773.1 Hepatitis B virus isolate MTB159, complete genome 1656....................1675100
AY902774.1 Hepatitis B virus isolate MTB160, complete genome 1656....................1675100
AY902776.1 Hepatitis B virus isolate MTB163, complete genome 1656....................1675100
AY902777.1 Hepatitis B virus isolate MTB004, complete genome 1656....................1675100
AB188241.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA25 1656....................1675100
AB188242.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA38 1656....................1675100
AB188244.1 Hepatitis B virus DNA, complete genome, isolate:UZ24 1656....................1675100
AJ748098.1 Hepatitis B virus complete genome, genotype C 1656....................1675100
AB205124.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ3-1-1 1656....................1675100
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 1656....................1675100
AB205126.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF714-1 1656....................1675100
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 1656....................1675100
AB205128.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU316-1 1656....................1675100
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 1656....................1675100
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 1656....................1675100
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 1656....................1675100
AY817511.1 Hepatitis B virus isolate CHN-L49 from China, complete genome 1656....................1675100
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 1656....................1675100
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 1656....................1675100
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 1656....................1675100
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 1656....................1675100
AY945307.1 Hepatitis B virus, complete genome 1656....................1675100
AP007262.1 HBV genotype E DNA, complete genome, isolate: HB-JI411F 1656....................1675100
AY935700.1 Hepatitis B virus isolate TH-HBV-012, complete genome 1656....................1675100
AB205188.1 Hepatitis B virus DNA, complete genome, isolate: HBV-GA283 1641....................1660100
AB205189.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G138 1656....................1675100
AB205190.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G123 1656....................1675100
AB205191.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G166 1656....................1675100
AB214516.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BL597 1656....................1675100
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 1656....................1675100
AB194948.1 Hepatitis B virus DNA, complete genome, isolate: CMR936 1656....................1675100
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 1656....................1675100
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 1623....................1642100
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 1656....................1675100
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 1656....................1675100
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 1656....................1675100
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 1656....................1675100
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 1656....................1675100
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 1656....................1675100
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 1656....................1675100
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 1656....................1675100
DQ089765.1 Hepatitis B virus isolate HK428, complete genome 1656....................1675100
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 1656....................1675100
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 1656....................1675100
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 1656....................1675100
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 1656....................1675100
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 1656....................1675100
DQ089771.1 Hepatitis B virus isolate HK1629, complete genome 1656....................1675100
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 1656....................1675100
DQ089774.1 Hepatitis B virus isolate HK858, complete genome 1656....................1675100
DQ089775.1 Hepatitis B virus isolate HK290, complete genome 1656....................1675100
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 1656....................1675100
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 1656....................1675100
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 1656....................1675100
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 1656....................1675100
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 1656....................1675100
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 1656....................1675100
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 1656....................1675100
DQ089785.1 Hepatitis B virus isolate HK1386, complete genome 1656....................1675100
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 1656....................1675100
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 1656....................1675100
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 1656....................1675100
DQ089790.1 Hepatitis B virus isolate HK1248, complete genome 1656....................1675100
DQ089791.1 Hepatitis B virus isolate HK1205, complete genome 1656....................1675100
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 1656....................1675100
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 1656....................1675100
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 1609....................1628100
DQ089795.1 Hepatitis B virus isolate HK1465, complete genome 1659....................1678100
DQ089796.1 Hepatitis B virus isolate HK751, complete genome 1656....................1675100
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 1656....................1675100
DQ089804.1 Hepatitis B virus isolate HK262, complete genome 1656....................1675100
DQ060822.1 Hepatitis B virus isolate 8510-91, complete genome 1656....................1675100
DQ060823.1 Hepatitis B virus isolate 8504-91, complete genome 1656....................1675100
DQ060824.1 Hepatitis B virus isolate 0121-20, complete genome 1656....................1675100
DQ060825.1 Hepatitis B virus isolate 0262-09, complete genome 1656....................1675100
DQ060826.1 Hepatitis B virus isolate 0433-20, complete genome 1656....................1675100
DQ060827.1 Hepatitis B virus isolate 0317-04, complete genome 1656....................1675100
DQ060828.1 Hepatitis B virus isolate 0443-03, complete genome 1656....................1675100
DQ060829.1 Hepatitis B virus isolate 0350-03, complete genome 1656....................1675100
DQ060830.1 Hepatitis B virus isolate 235-01, complete genome 1656....................1675100
DQ111986.1 Hepatitis B virus isolate MBT181, complete genome 1656....................1675100
DQ111987.1 Hepatitis B virus isolate MMU36, complete genome 1656....................1675100
AY862860.1 Hepatitis B virus clone Q11, complete genome 1656....................1675100
AY862861.1 Hepatitis B virus clone Q17, complete genome 1656....................1675100
AY862864.1 Hepatitis B virus clone Q34, complete genome 1656....................1675100
AY862865.1 Hepatitis B virus clone Q311, complete genome 1656....................1675100
AY862866.1 Hepatitis B virus clone Q312, complete genome 1658....................1677100
AY862869.1 Hepatitis B virus clone Q80, complete genome 1656....................1675100
AB201288.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1656....................1675100
AB201289.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1656....................1675100
AB201290.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1656....................1675100
AB119251.1 Hepatitis B virus DNA, complete genome, strain:Ehime13:BD No2,20020821656....................1675100
AB119252.1 Hepatitis B virus DNA, complete genome, strain:Ehime14:BD No7,20020821656....................1675100
AB119253.1 Hepatitis B virus DNA, complete genome, strain:Ehime15:BD No27,H12.011656....................1675100
AB119254.1 Hepatitis B virus DNA, complete genome, strain:Ehime16:BD No53,2003011656....................1675100
AB119255.1 Hepatitis B virus DNA, complete genome, strain:Ehime17:Iyo 0719039 1656....................1675100
AB119256.1 Hepatitis B virus DNA, complete genome, strain:Ehime18:Iyo 529246 1656....................1675100
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 257....................276100
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 3472....................3491100
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 239....................258100
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 3454....................3473100
AB188245.2 Hepatitis B virus DNA, complete genome, isolate:ALTAY136 1656....................1675100
AB188243.2 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA27 1656....................1675100
AB219529.1 Hepatitis B virus DNA, complete genome, isolate:UK1 1644....................1663100
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 1656....................1675100
AB219531.1 Hepatitis B virus DNA, complete genome, isolate:UK3 1656....................1675100
AB219532.1 Hepatitis B virus DNA, complete genome, isolate:UK4 1656....................1675100
AB219533.1 Hepatitis B virus DNA, complete genome, isolate:UK5 1662....................1681100
AB219534.1 Hepatitis B virus DNA, complete genome, isolate:UK6 1626....................1645100
DQ246215.1 Hepatitis B virus isolate GZ-DYH, complete genome 1656....................1675100
DQ304547.1 Hepatitis B virus isolate LT4 clone 1, complete genome 3018....................3037100
DQ304548.1 Hepatitis B virus isolate LT4 clone 2, complete genome 3018....................3037100
DQ304549.1 Hepatitis B virus isolate LT4 clone 3, complete genome 3018....................3037100
DQ304550.1 Hepatitis B virus isolate LT4 clone 4, complete genome 3018....................3037100
DQ304551.1 Hepatitis B virus isolate LT4 clone 5, complete genome 3018....................3037100
AB182589.1 Hepatitis B virus DNA, complete genome, isolate:CH:Mat-Ko 1656....................1675100
DQ329356.1 Hepatitis B virus isolate LT1 clone 1, complete genome 3013....................3032100
DQ329357.1 Hepatitis B virus isolate LT1 clone 2, complete genome 3013....................3032100
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 1656....................1675100
DQ377160.1 Hepatitis B virus isolate WJT16, complete genome 1656....................1675100
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 1656....................1675100
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 1656....................1675100
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 1656....................1675100
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 1656....................1675100
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 1656....................1675100
AB247916.1 Hepatitis B virus DNA, complete genome, lamivudine resistance with in1656....................1675100
AJ627215.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 06115 1656....................1675100
AJ627216.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 17707 1656....................1675100
AJ627217.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20953 1656....................1675100
AJ627218.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21116 1656....................1675100
AJ627219.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 24039 1656....................1675100
AJ627220.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 29234 1656....................1675100
AJ627221.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 30125 1656....................1675100
AJ627223.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33720 1656....................1675100
AJ627224.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33852 1656....................1675100
DQ315776.1 Hepatitis B virus isolate EI00615, complete genome 1656....................1675100
DQ315777.1 Hepatitis B virus isolate EI03194, complete genome 1656....................1675100
DQ315778.1 Hepatitis B virus isolate EI0388, complete genome 1656....................1675100
DQ315779.1 Hepatitis B virus isolate EI0399, complete genome 1656....................1675100
DQ315780.1 Hepatitis B virus isolate EI02456, complete genome 1626....................1645100
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 1656....................1675100
DQ315782.1 Hepatitis B virus isolate EI0423, complete genome 1647....................1666100
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 1656....................1675100
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 1656....................1675100
AB250109.1 Hepatitis B virus DNA, complete genome, isolate: IH030213 1606....................1625100
AB205152.1 Hepatitis B virus DNA, complete genome, isolate: HB-JFH7-99 1656....................1675100
DQ399006.1 Hepatitis B virus isolate G1, complete genome 2947....................2966100
AB222709.1 Hepatitis B virus DNA, complete genome, isolate: UZBV34 1656....................1675100
AB222710.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6M 1656....................1675100
AB222711.1 Hepatitis B virus DNA, complete genome, isolate: UZNV24 1656....................1675100
AB222712.1 Hepatitis B virus DNA, complete genome, isolate: UZBV61 1656....................1675100
AB222713.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6 1656....................1675100
AB222714.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7 1656....................1675100
AB222715.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7M 1656....................1675100
AB210818.1 Hepatitis B virus DNA, complete genome, strain:Ehime 21-NM 1656....................1675100
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 1656....................1675100
AB210820.1 Hepatitis B virus DNA, complete genome, strain:Tokyo 1 1656....................1675100
AB210821.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 1-OA 1656....................1675100
AB210822.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 2-OS 1656....................1675100
DQ478881.1 Hepatitis B virus isolate CHN-QH2, complete genome 1656....................1675100
DQ478882.1 Hepatitis B virus isolate CHN-QH3, complete genome 1656....................1675100
DQ478883.1 Hepatitis B virus isolate CHN-QH33, complete genome 1665....................1684100
DQ478884.1 Hepatitis B virus isolate CHN-QH4, complete genome 1656....................1675100
DQ478885.1 Hepatitis B virus isolate CHN-D12, complete genome 1656....................1675100
DQ478886.1 Hepatitis B virus isolate CHN-QH5, complete genome 1656....................1675100
DQ478888.1 Hepatitis B virus isolate CHN-QH9, complete genome 1656....................1675100
DQ478890.1 Hepatitis B virus isolate CHN-QH18, complete genome 1656....................1675100
DQ478891.1 Hepatitis B virus isolate CHN-QH19, complete genome 1656....................1675100
DQ478892.1 Hepatitis B virus isolate CHN-QH28, complete genome 1656....................1675100
DQ478893.1 Hepatitis B virus isolate CHN-QH29, complete genome 1656....................1675100
DQ478894.1 Hepatitis B virus isolate CHN-QH30, complete genome 1656....................1675100
DQ478895.1 Hepatitis B virus isolate CHN-QH31, complete genome 1656....................1675100
DQ478896.1 Hepatitis B virus isolate CHN-QH32, complete genome 1656....................1675100
DQ478897.1 Hepatitis B virus isolate CHN-QH37, complete genome 1656....................1675100
DQ478898.1 Hepatitis B virus isolate CHN-QH38, complete genome 1656....................1675100
DQ478899.1 Hepatitis B virus isolate CHN-D20, complete genome 1656....................1675100
DQ478900.1 Hepatitis B virus isolate CHN-H172, complete genome 1656....................1675100
DQ478901.1 Hepatitis B virus isolate CHN-H155, complete genome 1656....................1675100
DQ486023.1 Hepatitis B virus isolate LT10, complete genome 2997....................3016100
DQ486024.1 Hepatitis B virus isolate LT9, complete genome 3018....................3037100
DQ486025.1 Hepatitis B virus isolate LT12, complete genome 3018....................3037100
AB241109.1 Hepatitis B virus DNA, complete genome, isolate:PhCH24 1656....................1675100
AB241110.1 Hepatitis B virus DNA, complete genome, isolate:PhLC03 1656....................1675100
AB241111.1 Hepatitis B virus DNA, complete genome, isolate:PhLC14 1656....................1675100
AB241112.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC15 1602....................1621100
AB241113.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC13 1602....................1621100
AB241114.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC01 1656....................1675100
DQ683578.1 Hepatitis B virus from South Korea, complete genome 1656....................1675100
DQ993181.1 Hepatitis B virus strain A0583, complete genome 1658....................1677100
DQ986375.1 Hepatitis B virus strain 616-93, complete genome 1658....................1677100
DQ986376.1 Hepatitis B virus strain F0297, complete genome 1628....................1647100
AB246335.1 Hepatitis B virus DNA, complete genome, clone: Aa_IND 1656....................1675100
AB246344.1 Hepatitis B virus DNA, complete genome, clone: C_JPN22 1656....................1675100
AB246345.1 Hepatitis B virus DNA, complete genome, clone: C_JPNAT 1656....................1675100
AB246346.1 Hepatitis B virus DNA, complete genome, clone: C_HK74 1656....................1675100
AB246347.1 Hepatitis B virus DNA, complete genome, clone: D_IND60 1656....................1675100
AB246348.1 Hepatitis B virus DNA, complete genome, clone: D_US68 1656....................1675100
AB288026.1 Hepatitis B virus DNA, complete genome, genotype: C, country: Japan, 1656....................1675100
AM421529.1 Hepatitis B virus partial core gene, isolate MMA-1 46....................65100
AM421530.1 Hepatitis B virus partial core gene, isolate MMA-2 46....................65100
AM421533.1 Hepatitis B virus partial core gene, isolate MMA-5 46....................65100
AM421534.1 Hepatitis B virus partial core gene, isolate MMA-6 46....................65100
AM421535.1 Hepatitis B virus partial core gene, isolate MMA-7 46....................65100
AM421536.1 Hepatitis B virus partial core gene, isolate MMA-8 46....................65100
AM421537.1 Hepatitis B virus partial core gene, isolate MMA-9 46....................65100
AM421538.1 Hepatitis B virus partial core gene, isolate MMA-10 46....................65100
AM421539.1 Hepatitis B virus partial core gene, isolate MMA-11 46....................65100
AM421540.1 Hepatitis B virus partial core gene, isolate MMA-12 46....................65100
AM421541.1 Hepatitis B virus partial core gene, isolate MMA-13 46....................65100
AM421542.1 Hepatitis B virus partial core gene, isolate MMA-14 46....................65100
AM421544.1 Hepatitis B virus partial core gene, isolate MMA-16 46....................65100
AM421545.1 Hepatitis B virus partial core gene, isolate MMA-17 46....................65100
AM421546.1 Hepatitis B virus partial core gene, isolate MMA-18 46....................65100
AM421547.1 Hepatitis B virus partial core gene, isolate MMA-19 46....................65100
AM421548.1 Hepatitis B virus partial core gene, isolate MMA-20 46....................65100
AB267090.1 Hepatitis B virus ayw/Japan/Ehime 22-HS/2005 DNA, complete genome 1656....................1675100
AB270547.1 Hepatitis B virus DNA, complete genome, isolate: MGL295F 1656....................1675100
AB270548.1 Hepatitis B virus DNA, complete genome, isolate: MGL207F 1656....................1675100
AB270549.1 Hepatitis B virus DNA, complete genome, isolate: MGL79F 1656....................1675100
AB270550.1 Hepatitis B virus DNA, complete genome, isolate: MGL247F 1656....................1675100
AB270534.1 Hepatitis B virus DNA, complete genome, isolate: MGL110F 1656....................1675100
AB270535.1 Hepatitis B virus DNA, complete genome, isolate: MGL50F 1656....................1675100
AB270538.1 Hepatitis B virus DNA, complete genome, isolate: MGL231F 1656....................1675100
AB270539.1 Hepatitis B virus DNA, complete genome, isolate: MGL200F 1656....................1675100
AB270540.1 Hepatitis B virus DNA, complete genome, isolate: MGL241F 1635....................1654100
AB270541.1 Hepatitis B virus DNA, complete genome, isolate: MGL47F 1656....................1675100
AB270542.1 Hepatitis B virus DNA, complete genome, isolate: MGL12F 1656....................1675100
AB270543.1 Hepatitis B virus DNA, complete genome, isolate: MGL209F 1656....................1675100
AB270544.1 Hepatitis B virus DNA, complete genome, isolate: MGL215F 1656....................1675100
EF103275.1 Hepatitis B virus isolate Ran11, complete genome 1656....................1675100
EF103276.1 Hepatitis B virus isolate Ran22, complete genome 1656....................1675100
EF103277.1 Hepatitis B virus isolate Ran33, complete genome 1656....................1675100
EF103279.1 Hepatitis B virus isolate Ran99, complete genome 1656....................1675100
EF103280.1 Hepatitis B virus isolate Ran100, complete genome 1656....................1675100
EF103281.1 Hepatitis B virus isolate Ran102, complete genome 1656....................1675100
EF103282.1 Hepatitis B virus isolate Ran103, complete genome 1656....................1675100
EF103283.1 Hepatitis B virus isolate Ran105, complete genome 1656....................1675100
EF103284.1 Hepatitis B virus isolate Ran113, complete genome 1656....................1675100
EF103285.1 Hepatitis B virus isolate Ran128, complete genome 1656....................1675100
AB274969.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB320 1656....................1675100
AB274970.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB291 1656....................1675100
AB274971.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB295 1656....................1675100
AB274972.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB250 1601....................1620100
AB274973.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB18 1650....................1669100
AB274974.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB60 1656....................1675100
AB274975.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB241 1656....................1675100
AB274976.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB382 1656....................1675100
AB274977.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB183 1656....................1675100
AB274978.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB261 1656....................1675100
AB274979.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB302 1656....................1675100
AB274980.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB90 1656....................1675100
AB274981.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB331 1656....................1675100
AB274982.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB130 1656....................1675100
AB274984.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB109 1656....................1675100
DQ890381.1 Hepatitis B virus strain S40U, complete genome 1656....................1675100
EF536065.1 Hepatitis B virus strain XZK pre-t, complete genome 1658....................1677100
EF536066.1 Mutant Hepatitis B virus strain XZK t-w128, complete genome 1658....................1677100
AB195930.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-1 1656....................1675100
AB195936.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-1 1656....................1675100
AB195937.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-2 1656....................1675100
AB195938.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-3 1656....................1675100
AB195942.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-1 1656....................1675100
AB195943.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-2 1656....................1675100
AB195944.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-3 1656....................1675100
AB195945.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-1 1656....................1675100
AB195946.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-2 1611....................1630100
AB195947.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-1 1656....................1675100
AB195948.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-2 1656....................1675100
AB195949.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-1 1656....................1675100
AB195950.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-2 1656....................1675100
AB195951.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-3 1656....................1675100
AB195952.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-1 1656....................1675100
AB195953.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-2 1656....................1675100
AB195954.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-3 1656....................1675100
AB195955.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-1 1656....................1675100
AB195956.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-2 1656....................1675100
AB195957.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-3 1656....................1675100
AM422939.1 Hepatitis B virus, genotype D, complete genome, isolate X28 1656....................1675100
DQ993688.1 Hepatitis B virus isolate 209-0519-Nature1.2-unSero, complete genome 1657....................1676100
DQ993689.1 Hepatitis B virus isolate 209-1119-Nature1.1-unSero, complete genome 1657....................1676100
DQ993690.1 Hepatitis B virus isolate 204-1113-Nature1.1-unSero, complete genome 1656....................1675100
DQ993691.1 Hepatitis B virus isolate 4007-0803-Nature2.2-unSero, complete genome1656....................1675100
DQ993692.1 Hepatitis B virus isolate 4007-0810-Nature2.1-unSero, complete genome1656....................1675100
DQ993693.1 Hepatitis B virus isolate 232-1125-Nature1.1-unSero, complete genome 1656....................1675100
EF688062.1 Hepatitis B virus isolate GZ28-1, complete genome 1656....................1675100
AB202071.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-1 1656....................1675100
AB202072.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-2 1632....................1651100
AB302095.1 Hepatitis B virus DNA, complete genome, clone: Bj_39 1656....................1675100
EF494376.1 Hepatitis B virus isolate TW706 genotype C, complete genome 1656....................1675100
EF494379.1 Hepatitis B virus isolate TW8585 genotype C, complete genome 1656....................1675100
AB298720.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1S 1656....................1675100
AB298721.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1C 1656....................1675100
AB300359.1 Hepatitis B virus DNA, complete genome, isolate: patient1 1656....................1675100
AB300360.1 Hepatitis B virus DNA, complete genome, isolate: patient2 1656....................1675100
AB300361.1 Hepatitis B virus DNA, complete genome, isolate: patient3 1656....................1675100
AB300362.1 Hepatitis B virus DNA, complete genome, isolate: patient4 1656....................1675100
AB300363.1 Hepatitis B virus DNA, complete genome, isolate: patient5 1656....................1675100
AB300368.1 Hepatitis B virus DNA, complete genome, isolate: patient10 1656....................1675100
AB300372.1 Hepatitis B virus DNA, complete genome, isolate: patient14 1656....................1675100
AB368296.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c1656....................1675100
EU239217.1 Hepatitis B virus isolate G2451, complete genome 1656....................1675100
EU239219.1 Hepatitis B virus isolate PW3, complete genome 1656....................1675100
EU239220.1 Hepatitis B virus isolate PW5, complete genome 1656....................1675100
EU239221.1 Hepatitis B virus isolate PW1, complete genome 1656....................1675100
EU239222.1 Hepatitis B virus isolate PW2, complete genome 1656....................1675100
EU239223.1 Hepatitis B virus isolate PW4, complete genome 1656....................1675100
EU239225.1 Hepatitis B virus isolate PW7, complete genome 1653....................1672100
EU239226.1 Hepatitis B virus isolate PW6, complete genome 1656....................1675100
EU155893.1 Hepatitis B virus isolate 4, complete genome 1656....................1675100
AB330366.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ2HB1656....................1675100
AB330367.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ14H1656....................1675100
AB330368.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ54H1656....................1675100
AB330369.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ5HB1656....................1675100
AB330370.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ6HB1656....................1675100
EU305541.1 Hepatitis B virus isolate G67-190, complete genome 1656....................1675100
EU305542.1 Hepatitis B virus isolate G67-1251, complete genome 1656....................1675100
AM494689.1 Hepatitis B virus complete genome, isolate CAR006 1644....................1663100
AM494690.1 Hepatitis B virus complete genome, isolate CAR008 1656....................1675100
AM494691.1 Hepatitis B virus complete genome, isolate CAR024 1656....................1675100
AM494692.1 Hepatitis B virus complete genome, isolate CAR026 1656....................1675100
AM494693.1 Hepatitis B virus complete genome, isolate CAR039 1656....................1675100
AM494694.1 Hepatitis B virus complete genome, isolate CAR047 1656....................1675100
AM494696.1 Hepatitis B virus complete genome, isolate CAR060 1656....................1675100
AM494697.1 Hepatitis B virus complete genome, isolate CAR063 1656....................1675100
AM494698.1 Hepatitis B virus complete genome, isolate CAR066 1635....................1654100
AM494699.1 Hepatitis B virus complete genome, isolate CAR082 1656....................1675100
AM494700.1 Hepatitis B virus complete genome, isolate CAR083 1656....................1675100
AM494702.1 Hepatitis B virus complete genome, isolate CAR106 1656....................1675100
AM494703.1 Hepatitis B virus complete genome, isolate CAR107 1656....................1675100
AM494704.1 Hepatitis B virus complete genome, isolate CAR112 1656....................1675100
AM494705.1 Hepatitis B virus complete genome, isolate CAR115 1656....................1675100
AM494706.1 Hepatitis B virus complete genome, isolate CAR131 1656....................1675100
AM494708.1 Hepatitis B virus complete genome, isolate CAR138 1656....................1675100
AM494709.1 Hepatitis B virus complete genome, isolate CAR143 1656....................1675100
AM494710.1 Hepatitis B virus complete genome, isolate CAR144 1656....................1675100
AM494711.1 Hepatitis B virus complete genome, isolate CAR146 1653....................1672100
AM494712.1 Hepatitis B virus complete genome, isolate CAR150 1653....................1672100
AM494713.1 Hepatitis B virus complete genome, isolate CAR154 1656....................1675100
AM494714.1 Hepatitis B virus complete genome, isolate CAR165 1656....................1675100
AM494715.1 Hepatitis B virus complete genome, isolate CAR171 1656....................1675100
AM494716.1 Hepatitis B virus complete genome, isolate CAR175 1656....................1675100
AM494717.1 Hepatitis B virus complete genome, isolate CAR187 1656....................1675100
EU306671.1 Hepatitis B virus clone 626-49, complete genome 1656....................1675100
EU306672.1 Hepatitis B virus clone 626-20, complete genome 1656....................1675100
EU306673.1 Hepatitis B virus clone 213-10, complete genome 1656....................1675100
EU306674.1 Hepatitis B virus clone 213-6, complete genome 1656....................1675100
EU306675.1 Hepatitis B virus clone 213-21, complete genome 1656....................1675100
EU306685.1 Hepatitis B virus clone 327-4, complete genome 1656....................1675100
EU306686.1 Hepatitis B virus clone 327-28, complete genome 1656....................1675100
EU306687.1 Hepatitis B virus clone 327-6, complete genome 1656....................1675100
EU306688.1 Hepatitis B virus clone 327-54, complete genome 1656....................1675100
EU306689.1 Hepatitis B virus clone 327-27, complete genome 1656....................1675100
EU306690.1 Hepatitis B virus clone 327-71, complete genome 1656....................1675100
EU306691.1 Hepatitis B virus clone 327-57, complete genome 1656....................1675100
EU306692.1 Hepatitis B virus clone 327-73, complete genome 1656....................1675100
EU306693.1 Hepatitis B virus clone 327-67, complete genome 1656....................1675100
EU306694.1 Hepatitis B virus clone 327-46, complete genome 1656....................1675100
EU306713.1 Hepatitis B virus clone 602-27, complete genome 1656....................1675100
EU306714.1 Hepatitis B virus clone 602-77, complete genome 1656....................1675100
EU306715.1 Hepatitis B virus clone 602(son)-17, complete genome 1656....................1675100
EU306716.1 Hepatitis B virus clone 602(son)-18, complete genome 1656....................1675100
EU306717.1 Hepatitis B virus clone 602(son)-22, complete genome 1656....................1675100
EU306718.1 Hepatitis B virus clone 602(son)-24, complete genome 1656....................1675100
EU306719.1 Hepatitis B virus clone 602(son)-23, complete genome 1656....................1675100
EU306720.1 Hepatitis B virus clone 602(son)-68, complete genome 1656....................1675100
EU306721.1 Hepatitis B virus clone 602(son)-1, complete genome 1656....................1675100
EU306722.1 Hepatitis B virus clone 6022-28-, complete genome 1656....................1675100
EU306723.1 Hepatitis B virus clone 6022-19, complete genome 1656....................1675100
EU306724.1 Hepatitis B virus clone 6022-2-, complete genome 1656....................1675100
EU306725.1 Hepatitis B virus clone 6022-17, complete genome 1656....................1675100
EU306726.1 Hepatitis B virus clone 6022-12-, complete genome 1656....................1675100
EU306727.1 Hepatitis B virus clone 6022-5-, complete genome 1656....................1675100
EU306728.1 Hepatitis B virus clone 6022-43, complete genome 1656....................1675100
EU306729.1 Hepatitis B virus clone 6022-33, complete genome 1656....................1675100
EU410080.1 Hepatitis B virus isolate ph76, complete genome 1656....................1675100
EU410081.1 Hepatitis B virus isolate ph80, complete genome 1656....................1675100
EU439005.1 Hepatitis B virus clone 6022-35 from China, complete genome 1656....................1675100
EU439006.1 Hepatitis B virus clone 602(S)-3 from China, complete genome 1656....................1675100
EU439007.1 Hepatitis B virus clone 602(S)-39 from China, complete genome 1657....................1676100
EU439008.1 Hepatitis B virus clone 6023-27 from China, complete genome 1671....................1690100
EU439010.1 Hepatitis B virus clone 6023-38 from China, complete genome 1656....................1675100
AB365451.1 Hepatitis B virus DNA, complete genome, isolate: BOL196 1656....................1675100
AB426467.1 Hepatitis B virus DNA, complete genome, clone: HBVFH0204 1656....................1675100
DQ991753.2 Hepatitis B virus isolate Irish-13, complete genome 1413....................1432100
EU547558.1 Hepatitis B virus isolate MC01, complete genome 1656....................1675100
EU547559.1 Hepatitis B virus isolate MC02, complete genome 1623....................1642100
EU547561.1 Hepatitis B virus isolate MC04, complete genome 1656....................1675100
EU547562.1 Hepatitis B virus isolate MC05, complete genome 1656....................1675100
EU439009.1 Hepatitis B virus clone 6023-33 from China, complete genome 1609....................1628100
AB299858.1 Hepatitis B virus subtype adr DNA, complete genome, clone: HBVFH0204 1656....................1675100
EU554537.1 Hepatitis B virus isolate S541-13, complete genome 1656....................1675100
EU554538.1 Hepatitis B virus isolate S541-15, complete genome 1656....................1675100
EU554539.1 Hepatitis B virus isolate S541-21, complete genome 1656....................1675100
EU554540.1 Hepatitis B virus isolate S304-10, complete genome 1656....................1675100
EU554541.1 Hepatitis B virus isolate S696-1, complete genome 1656....................1675100
EU554542.1 Hepatitis B virus isolate S696-4, complete genome 1656....................1675100
EU562215.1 Hepatitis B virus isolate 11, complete genome 1656....................1675100
EU562216.1 Hepatitis B virus isolate 13, complete genome 1656....................1675100
EU562217.1 Hepatitis B virus isolate 16, complete genome 1656....................1675100
EU562218.1 Hepatitis B virus isolate 7, complete genome 1656....................1675100
EU562219.1 Hepatitis B virus isolate 5, complete genome 1655....................1674100
EU560438.1 Hepatitis B virus isolate 2-B74, complete genome 1656....................1675100
EU560439.1 Hepatitis B virus isolate 7-B74, complete genome 1656....................1675100
EU560440.1 Hepatitis B virus isolate 1-S869, complete genome 1656....................1675100
EU560441.1 Hepatitis B virus isolate 4-S869, complete genome 1656....................1675100
EU570067.1 Hepatitis B virus isolate 18-S541, complete genome 1656....................1675100
EU570068.1 Hepatitis B virus isolate 26-S541, complete genome 1656....................1675100
EU570072.1 Hepatitis B virus isolate 1-B74, complete genome 1656....................1675100
EU570073.1 Hepatitis B virus isolate 8-S698, complete genome 1656....................1675100
EU570074.1 Hepatitis B virus isolate 11-S698, complete genome 1656....................1675100
EU579442.1 Hepatitis B virus isolate 6 genotype C, complete genome 1656....................1675100
EU589336.1 Hepatitis B virus isolate S1175-1, complete genome 1656....................1675100
EU589340.1 Hepatitis B virus isolate S852-7, complete genome 1611....................1630100
EU589341.1 Hepatitis B virus isolate S852-10, complete genome 1611....................1630100
EU589342.1 Hepatitis B virus isolate S852-13, complete genome 1611....................1630100
EU589343.1 Hepatitis B virus isolate S852-15, complete genome 1611....................1630100
EU414135.1 Hepatitis B virus strain 28025, complete genome 1656....................1675100
EU414136.1 Hepatitis B virus strain 28052, complete genome 1656....................1675100
EU414138.1 Hepatitis B virus strain 28129, complete genome 1656....................1675100
EU414139.1 Hepatitis B virus strain 28027, complete genome 1656....................1675100
EU414140.1 Hepatitis B virus strain 28050, complete genome 1656....................1675100
EU414141.1 Hepatitis B virus strain 28051, complete genome 1656....................1675100
EU414142.1 Hepatitis B virus strain 28004, complete genome 1656....................1675100
EU414143.1 Hepatitis B virus strain 28042, complete genome 1656....................1675100
EU670263.1 Hepatitis B virus isolate ph105, complete genome 1656....................1675100
EU717211.1 Hepatitis B virus isolate D23K-6, complete genome 1658....................1677100
EU796069.1 Hepatitis B virus strain 4364, complete genome 1656....................1675100
EU871975.1 Hepatitis B virus isolate 6-024A-8, complete genome 1656....................1675100
EU871977.1 Hepatitis B virus isolate 252-2, complete genome 1656....................1675100
EU871978.1 Hepatitis B virus isolate 252-95-2, complete genome 1656....................1675100
EU871979.1 Hepatitis B virus isolate 252-95-4, complete genome 1656....................1675100
EU872000.1 Hepatitis B virus isolate 530-92-2, complete genome 1656....................1675100
EU872001.1 Hepatitis B virus isolate 530-92-8, complete genome 1656....................1675100
EU872002.1 Hepatitis B virus isolate 530-97-1, complete genome 1656....................1675100
EU872003.1 Hepatitis B virus isolate 530-97-2, complete genome 1656....................1675100
EU872004.1 Hepatitis B virus isolate 530-97-3, complete genome 1656....................1675100
EU872005.1 Hepatitis B virus isolate 179-96-1, complete genome 1598....................1617100
EU872007.1 Hepatitis B virus isolate 252-92-6, complete genome 1656....................1675100
EU872008.1 Hepatitis B virus isolate 252A-8, complete genome 1656....................1675100
EU872010.1 Hepatitis B virus isolate 252-92-3, complete genome 1656....................1675100
EU594382.1 Hepatitis B virus strain 3798-91, complete genome 1656....................1675100
EU594396.1 Hepatitis B virus strain 4383-97, complete genome 1656....................1675100
EU594397.1 Hepatitis B virus strain 4398-97, complete genome 1656....................1675100
EU594398.1 Hepatitis B virus strain 4496-97, complete genome 1656....................1675100
EU594399.1 Hepatitis B virus strain 4484-97, complete genome 1656....................1675100
EU594400.1 Hepatitis B virus strain 2009-02, complete genome 1656....................1675100
EU594401.1 Hepatitis B virus strain 1989-97, complete genome 1656....................1675100
EU594402.1 Hepatitis B virus strain 1988-02, complete genome 1656....................1675100
EU594403.1 Hepatitis B virus strain 1904-99, complete genome 1656....................1675100
EU594404.1 Hepatitis B virus strain 1901-98, complete genome 1656....................1675100
EU594405.1 Hepatitis B virus strain 620-98, complete genome 1656....................1675100
EU594406.1 Hepatitis B virus strain 321-96, complete genome 1656....................1675100
EU594407.1 Hepatitis B virus strain 295-01, complete genome 1656....................1675100
EU594408.1 Hepatitis B virus strain 281-01, complete genome 1656....................1675100
EU594409.1 Hepatitis B virus strain 280-01, complete genome 1656....................1675100
EU594410.1 Hepatitis B virus strain 279-01, complete genome 1656....................1675100
EU594415.1 Hepatitis B virus strain 4374-97, complete genome 1656....................1675100
EU594416.1 Hepatitis B virus strain 4373-97, complete genome 1656....................1675100
EU594421.1 Hepatitis B virus strain 4658-97, complete genome 1656....................1675100
EU594422.1 Hepatitis B virus strain 4655-97, complete genome 1656....................1675100
EU594423.1 Hepatitis B virus strain 4652-97, complete genome 1656....................1675100
EU594424.1 Hepatitis B virus strain 4651-97, complete genome 1656....................1675100
EU594425.1 Hepatitis B virus strain 4635-97, complete genome 1656....................1675100
EU594426.1 Hepatitis B virus strain 4630-97, complete genome 1656....................1675100
EU594427.1 Hepatitis B virus strain 4628-97, complete genome 1656....................1675100
EU594428.1 Hepatitis B virus strain 4385-97, complete genome 1656....................1675100
EU594430.1 Hepatitis B virus strain 4565-97, complete genome 1656....................1675100
EU594431.1 Hepatitis B virus strain 4547-97, complete genome 1656....................1675100
EU594432.1 Hepatitis B virus strain 4545-97, complete genome 1656....................1675100
EU594433.1 Hepatitis B virus strain 4605-97, complete genome 1656....................1675100
EU594434.1 Hepatitis B virus strain 683-95, complete genome 1656....................1675100
EU594435.1 Hepatitis B virus strain 320-95, complete genome 1656....................1675100
EU594436.1 Hepatitis B virus strain 4550-97, complete genome 1656....................1675100
EU787434.1 Hepatitis B virus isolate 92, complete genome 1656....................1675100
EU787435.1 Hepatitis B virus isolate 114, complete genome 1656....................1675100
EU787436.1 Hepatitis B virus isolate 165, complete genome 1656....................1675100
EU787437.1 Hepatitis B virus isolate 17, complete genome 1656....................1675100
EU787438.1 Hepatitis B virus isolate 7, complete genome 1656....................1675100
EU787439.1 Hepatitis B virus isolate 89, complete genome 1656....................1675100
EU787440.1 Hepatitis B virus isolate W17, complete genome 1656....................1675100
EU787441.1 Hepatitis B virus isolate W32, complete genome 1656....................1675100
EU787442.1 Hepatitis B virus isolate W37, complete genome 1656....................1675100
EU787443.1 Hepatitis B virus isolate w40, complete genome 1656....................1675100
EU787444.1 Hepatitis B virus isolate W41, complete genome 1656....................1675100
EU787445.1 Hepatitis B virus isolate W51, complete genome 1656....................1675100
EU787446.1 Hepatitis B virus isolate W75, complete genome 1656....................1675100
EU787447.1 Hepatitis B virus isolate W46, complete genome 1656....................1675100
AB453989.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH11 1656....................1675100
EU921418.1 Hepatitis B virus isolate 22.165.07, complete genome 1653....................1672100
EU921419.1 Hepatitis B virus isolate 22.252.07, complete genome 1653....................1672100
EU919197.1 Hepatitis B virus isolate XJU, complete genome 1656....................1675100
EU939537.1 Hepatitis B virus isolate C8, complete genome 1602....................1621100
EU939538.1 Hepatitis B virus isolate C9, complete genome 1656....................1675100
EU939540.1 Hepatitis B virus isolate C24, complete genome 1656....................1675100
EU939541.1 Hepatitis B virus isolate C25, complete genome 1656....................1675100
EU939545.1 Hepatitis B virus isolate C41, complete genome 1656....................1675100
EU939547.1 Hepatitis B virus isolate C45, complete genome 1656....................1675100
EU939548.1 Hepatitis B virus isolate C46, complete genome 1656....................1675100
EU939549.1 Hepatitis B virus isolate C49, complete genome 1656....................1675100
EU939550.1 Hepatitis B virus isolate C55, complete genome 1656....................1675100
EU939551.1 Hepatitis B virus isolate C56, complete genome 1656....................1675100
EU939552.1 Hepatitis B virus isolate C57, complete genome 1656....................1675100
EU939553.1 Hepatitis B virus isolate C60, complete genome 1656....................1675100
EU939554.1 Hepatitis B virus isolate C61, complete genome 1656....................1675100
EU939555.1 Hepatitis B virus isolate C63, complete genome 1656....................1675100
EU939557.1 Hepatitis B virus isolate C65, complete genome 1644....................1663100
EU939560.1 Hepatitis B virus isolate C69, complete genome 1623....................1642100
EU939561.1 Hepatitis B virus isolate C70, complete genome 1656....................1675100
EU939562.1 Hepatitis B virus isolate C75, complete genome 1656....................1675100
EU939565.1 Hepatitis B virus isolate C86, complete genome 1656....................1675100
EU939566.1 Hepatitis B virus isolate C88, complete genome 1656....................1675100
EU939567.1 Hepatitis B virus isolate C91, complete genome 1656....................1675100
EU939568.1 Hepatitis B virus isolate C93, complete genome 1656....................1675100
EU939571.1 Hepatitis B virus isolate C104, complete genome 1656....................1675100
EU939572.1 Hepatitis B virus isolate C105, complete genome 1656....................1675100
EU939573.1 Hepatitis B virus isolate C106, complete genome 1656....................1675100
EU939577.1 Hepatitis B virus isolate C116, complete genome 1656....................1675100
EU939578.1 Hepatitis B virus isolate C119, complete genome 1656....................1675100
EU939579.1 Hepatitis B virus isolate C120, complete genome 1656....................1675100
EU939580.1 Hepatitis B virus isolate B1, complete genome 1656....................1675100
EU939581.1 Hepatitis B virus isolate B16, complete genome 1656....................1675100
EU939583.1 Hepatitis B virus isolate B31, complete genome 1614....................1633100
EU939584.1 Hepatitis B virus isolate B107, complete genome 1656....................1675100
EU939585.1 Hepatitis B virus isolate B126, complete genome 1656....................1675100
EU939586.1 Hepatitis B virus isolate B142, complete genome 1656....................1675100
EU939587.1 Hepatitis B virus isolate C2, complete genome 1656....................1675100
EU939588.1 Hepatitis B virus isolate C173, complete genome 1656....................1675100
EU939589.1 Hepatitis B virus isolate C175, complete genome 1656....................1675100
EU939593.1 Hepatitis B virus isolate C144, complete genome 1656....................1675100
EU939595.1 Hepatitis B virus isolate C147, complete genome 1656....................1675100
EU939597.1 Hepatitis B virus isolate C151, complete genome 1656....................1675100
EU939600.1 Hepatitis B virus isolate C176, complete genome 1656....................1675100
EU939601.1 Hepatitis B virus isolate C177, complete genome 1656....................1675100
EU939602.1 Hepatitis B virus isolate C179, complete genome 1656....................1675100
EU939603.1 Hepatitis B virus isolate C183, complete genome 1656....................1675100
EU939606.1 Hepatitis B virus isolate C206, complete genome 1656....................1675100
EU939607.1 Hepatitis B virus isolate C207, complete genome 1656....................1675100
EU939608.1 Hepatitis B virus isolate C208, complete genome 1631....................1650100
EU939609.1 Hepatitis B virus isolate C209, complete genome 1656....................1675100
EU939612.1 Hepatitis B virus isolate C213, complete genome 1656....................1675100
EU939613.1 Hepatitis B virus isolate C214, complete genome 1656....................1675100
EU939615.1 Hepatitis B virus isolate C226, complete genome 1656....................1675100
EU939616.1 Hepatitis B virus isolate C228, complete genome 1656....................1675100
EU939617.1 Hepatitis B virus isolate C229, complete genome 1656....................1675100
EU939618.1 Hepatitis B virus isolate C230, complete genome 1656....................1675100
EU939619.1 Hepatitis B virus isolate C233, complete genome 1656....................1675100
EU939620.1 Hepatitis B virus isolate B140, complete genome 1656....................1675100
EU939623.1 Hepatitis B virus isolate C126, complete genome 1656....................1675100
EU939625.1 Hepatitis B virus isolate C167, complete genome 1656....................1675100
EU939626.1 Hepatitis B virus isolate D158, complete genome 1656....................1675100
EU939627.1 Hepatitis B virus isolate C15, complete genome 1656....................1675100
EU939630.1 Hepatitis B virus isolate C122, complete genome 1656....................1675100
EU939632.1 Hepatitis B virus isolate C130, complete genome 1639....................1658100
EU939641.1 Hepatitis B virus isolate D18, complete genome 1602....................1621100
EU939642.1 Hepatitis B virus isolate D20, complete genome 1656....................1675100
EU939643.1 Hepatitis B virus isolate D32, complete genome 1656....................1675100
EU939644.1 Hepatitis B virus isolate D36, complete genome 1656....................1675100
EU939645.1 Hepatitis B virus isolate D38, complete genome 1656....................1675100
EU939646.1 Hepatitis B virus isolate D88, complete genome 1656....................1675100
EU939647.1 Hepatitis B virus isolate D90, complete genome 1656....................1675100
EU939648.1 Hepatitis B virus isolate D96, complete genome 1656....................1675100
EU939649.1 Hepatitis B virus isolate D98, complete genome 1656....................1675100
EU939650.1 Hepatitis B virus isolate D103, complete genome 1627....................1646100
EU939651.1 Hepatitis B virus isolate D104, complete genome 1656....................1675100
EU939652.1 Hepatitis B virus isolate D107, complete genome 1656....................1675100
EU939653.1 Hepatitis B virus isolate D109, complete genome 1656....................1675100
EU939654.1 Hepatitis B virus isolate D115, complete genome 1656....................1675100
EU939655.1 Hepatitis B virus isolate D116, complete genome 1656....................1675100
EU939656.1 Hepatitis B virus isolate D117, complete genome 1656....................1675100
EU939658.1 Hepatitis B virus isolate D142, complete genome 1656....................1675100
EU939668.1 Hepatitis B virus isolate C182, complete genome 1656....................1675100
EU939680.1 Hepatitis B virus isolate C186, complete genome 1656....................1675100
EU939681.1 Hepatitis B virus isolate D146, complete genome 1656....................1675100
AB367392.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 1, derived 1656....................1675100
AB367394.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 3/Adefovir-1656....................1675100
AB367395.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 4, derived 1656....................1675100
AB367396.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 5, derived 1656....................1675100
AB367397.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 6, derived 1656....................1675100
AB367398.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 7/Adefovir-1656....................1675100
AB367399.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 8/Adefovir-1656....................1675100
AB367400.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 9, derived 1656....................1675100
AB367401.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 10/Adefovir1656....................1675100
AB367402.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 11, derived1656....................1675100
AB367403.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 12/Adefovir1656....................1675100
AB367404.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 13/Adefovir1656....................1675100
AB367406.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 15/Adefovir1656....................1675100
AB367407.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 16/Adefovir1656....................1675100
AB367408.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 17/Adefovir1623....................1642100
AB367409.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 18, derived1611....................1630100
AB367410.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 19/Adefovir1656....................1675100
AB367411.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 20, derived1656....................1675100
AB367412.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 21, derived1656....................1675100
AB367413.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 22/Adefovir1623....................1642100
AB367414.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 23/Adefovir1656....................1675100
AB367415.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 24/Adefovir1671....................1690100
AB367416.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 25, derived1656....................1675100
AB367417.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 26, derived1656....................1675100
AB367418.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 27/Adefovir1656....................1675100
AB367419.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 28, derived1656....................1675100
AB367420.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 29, derived1656....................1675100
AB367421.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 30, derived1656....................1675100
AB367422.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 31/Adefovir1656....................1675100
AB367423.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 32/Adefovir1656....................1675100
AB367424.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 33, derived1656....................1675100
AB367425.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 34/Adefovir1620....................1639100
AB367426.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 35, derived1611....................1630100
AB367427.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 36/Adefovir1656....................1675100
AB367428.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 37/Adefovir1602....................1621100
AB367429.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 38, derived1617....................1636100
AB367430.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 39/Adefovir1644....................1663100
AB367432.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 41, derived1656....................1675100
AB367433.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 42/Adefovir1602....................1621100
AB367434.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 43/Adefovir1656....................1675100
AB367435.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 44/Adefovir1650....................1669100
FJ151413.1 Hepatitis B virus strain FD-36-5, complete genome 1168....................1187100
AB367800.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 24 1656....................1675100
AB367801.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 30 1611....................1630100
AB367803.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 13 1656....................1675100
AB367804.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 6 1656....................1675100
FJ032331.1 Hepatitis B virus isolate S193-1 from China, complete genome 1656....................1675100
FJ032334.1 Hepatitis B virus isolate S445-3 from China, complete genome 1656....................1675100
FJ032335.1 Hepatitis B virus isolate S459-2 from China, complete genome 1655....................1674100
FJ032345.1 Hepatitis B virus isolate S696-3 from China, complete genome 1656....................1675100
FJ032346.1 Hepatitis B virus isolate S732-3 from China, complete genome 1656....................1675100
FJ032351.1 Hepatitis B virus isolate S943-5 from China, complete genome 1656....................1675100
FJ032355.1 Hepatitis B virus isolate S1030-8 from China, complete genome 1656....................1675100
FJ032356.1 Hepatitis B virus isolate S1030-9 from China, complete genome 1656....................1675100
FJ032359.1 Hepatitis B virus isolate S1634-1 from China, complete genome 1656....................1675100
FJ032360.1 Hepatitis B virus isolate S1634-2 from China, complete genome 1656....................1675100
FJ032361.1 Hepatitis B virus isolate S1634-7 from China, complete genome 1656....................1675100
FJ023642.1 Hepatitis B virus isolate C2_C04-1257 S protein (S) and core protein 1656....................1675100
FJ023664.1 Hepatitis B virus isolate I2_M04-0026, complete genome 1656....................1675100
FJ023665.1 Hepatitis B virus isolate I2_M04-0033, complete genome 1656....................1675100
FJ023666.1 Hepatitis B virus isolate I2_M04-1907, complete genome 1656....................1675100
FJ023667.1 Hepatitis B virus isolate I2_M04-2742, complete genome 1656....................1675100
FJ023669.1 Hepatitis B virus isolate I2_M04-3665, complete genome 1656....................1675100
FJ023670.1 Hepatitis B virus isolate I2_M04-3724, complete genome 1656....................1675100
FJ023671.1 Hepatitis B virus isolate I2_M04-3733, complete genome 1656....................1675100
FJ023672.1 Hepatitis B virus isolate I2_M04-2305, complete genome 1656....................1675100
FJ023673.1 Hepatitis B virus isolate I2_M04-4997, complete genome 1656....................1675100
FJ023674.1 Hepatitis B virus isolate I2/C2_C04-0790 S protein (S) and core prote1656....................1675100
FJ023675.1 Hepatitis B virus isolate I1/I2_M04-3739 S protein (S) and core prote1656....................1675100
FJ023676.1 Hepatitis B virus isolate I1/I2_M04-2531 S protein (S) and core prote1656....................1675100
FJ023633.1 Hepatitis B virus isolate B4_C04-0583 S protein (S) and core protein 1656....................1675100
FJ023639.1 Hepatitis B virus isolate C2_C04-0968 S protein (S) and core protein 1656....................1675100
FJ023640.1 Hepatitis B virus isolate C2_C04-1206 S protein (S) and core protein 1629....................1648100
FJ023641.1 Hepatitis B virus isolate C2_C04-1237 S protein (S) and core protein 1656....................1675100
FJ023643.1 Hepatitis B virus isolate C2_C04-1306 S protein (S) and core protein 1656....................1675100
FJ023644.1 Hepatitis B virus isolate C2_C04-1318 S protein (S) and core protein 1656....................1675100
FJ023645.1 Hepatitis B virus isolate C2_M04-0071 S protein (S) and core protein 1656....................1675100
FJ023646.1 Hepatitis B virus isolate C2_M04-0201 S protein (S) and core protein 1656....................1675100
FJ023647.1 Hepatitis B virus isolate C2_M04-0214 S protein (S) and core protein 1656....................1675100
FJ023648.1 Hepatitis B virus isolate C2_M04-0273 S protein (S) and core protein 1656....................1675100
FJ023649.1 Hepatitis B virus isolate C2_M04-0289 S protein (S) and core protein 1656....................1675100
FJ023650.1 Hepatitis B virus isolate C2_M04-0341 S protein (S) and core protein 1656....................1675100
FJ023651.1 Hepatitis B virus isolate C2_M04-0391 S protein (S) and core protein 1635....................1654100
FJ023652.1 Hepatitis B virus isolate C2_M04-0648 S protein (S) and core protein 1599....................1618100
FJ023653.1 Hepatitis B virus isolate C2_M04-0909 S protein (S) and core protein 1656....................1675100
FJ023654.1 Hepatitis B virus isolate C2_C04-1412 S protein (S) and core protein 1656....................1675100
FJ023655.1 Hepatitis B virus isolate C2_M04-0754 S protein (S) and core protein 1626....................1645100
FJ023656.1 Hepatitis B virus isolate C2_M04-0938 S protein (S) and core protein 1656....................1675100
FJ023657.1 Hepatitis B virus isolate C2_M04-0987 S protein (S) and core protein 1656....................1675100
FJ023658.1 Hepatitis B virus isolate C2_M04-1116 S protein (S) and core protein 1656....................1675100
FJ386575.1 Hepatitis B virus isolate 1745, complete genome 1656....................1675100
FJ386576.1 Hepatitis B virus isolate 1746, complete genome 1656....................1675100
FJ386577.1 Hepatitis B virus isolate 1747, complete genome 1656....................1675100
FJ386578.1 Hepatitis B virus isolate 1748, complete genome 1656....................1675100
FJ386580.1 Hepatitis B virus isolate 1763, complete genome 1656....................1675100
FJ386581.1 Hepatitis B virus isolate 1764, complete genome 1656....................1675100
FJ386585.1 Hepatitis B virus isolate 1800, complete genome 1656....................1675100
FJ386586.1 Hepatitis B virus isolate 1811, complete genome 1656....................1675100
FJ386587.1 Hepatitis B virus isolate 1812, complete genome 1656....................1675100
FJ386588.1 Hepatitis B virus isolate 1828, complete genome 1656....................1675100
FJ386590.1 Hepatitis B virus isolate 1841, complete genome 1656....................1675100
FJ386591.1 Hepatitis B virus isolate 1869, complete genome 1656....................1675100
FJ386592.1 Hepatitis B virus isolate 1870, complete genome 1656....................1675100
FJ386593.1 Hepatitis B virus isolate 1877, complete genome 1638....................1657100
FJ386594.1 Hepatitis B virus isolate 1878, complete genome 1641....................1660100
FJ386602.1 Hepatitis B virus isolate 1914, complete genome 1656....................1675100
FJ386604.1 Hepatitis B virus isolate 1950, complete genome 1656....................1675100
FJ386605.1 Hepatitis B virus isolate 1965, complete genome 1656....................1675100
FJ386607.1 Hepatitis B virus isolate 1967, complete genome 1656....................1675100
FJ386609.1 Hepatitis B virus isolate 1999, complete genome 1656....................1675100
FJ386611.1 Hepatitis B virus isolate 2018, complete genome 1656....................1675100
FJ386612.1 Hepatitis B virus isolate 2019, complete genome 1656....................1675100
FJ386613.1 Hepatitis B virus isolate 2039, complete genome 1656....................1675100
FJ386616.1 Hepatitis B virus isolate 2064, complete genome 1656....................1675100
FJ386617.1 Hepatitis B virus isolate 2093, complete genome 1656....................1675100
FJ386621.1 Hepatitis B virus isolate 2123, complete genome 1656....................1675100
FJ386622.1 Hepatitis B virus isolate 2135, complete genome 1656....................1675100
FJ386624.1 Hepatitis B virus isolate 2187, complete genome 1656....................1675100
FJ386625.1 Hepatitis B virus isolate 2190, complete genome 1656....................1675100
FJ386626.1 Hepatitis B virus isolate 2205, complete genome 1656....................1675100
FJ386627.1 Hepatitis B virus isolate 2242, complete genome 1656....................1675100
FJ386628.1 Hepatitis B virus isolate 2255, complete genome 1656....................1675100
FJ386629.1 Hepatitis B virus isolate 2286, complete genome 1632....................1651100
FJ386630.1 Hepatitis B virus isolate 2336, complete genome 1656....................1675100
FJ386631.1 Hepatitis B virus isolate 2359, complete genome 1656....................1675100
FJ386632.1 Hepatitis B virus isolate 2370, complete genome 1656....................1675100
FJ386633.1 Hepatitis B virus isolate 2372, complete genome 1656....................1675100
FJ386635.1 Hepatitis B virus isolate 2399, complete genome 1656....................1675100
FJ386639.1 Hepatitis B virus isolate 1929, complete genome 1656....................1675100
FJ386641.1 Hepatitis B virus isolate 2236, complete genome 1620....................1639100
FJ386643.1 Hepatitis B virus isolate 2493, complete genome 1602....................1621100
FJ386644.1 Hepatitis B virus isolate S737, complete genome 1656....................1675100
FJ386646.1 Hepatitis B virus isolate 1716, complete genome 1656....................1675100
FJ386647.1 Hepatitis B virus isolate 2400, complete genome 1656....................1675100
FJ386649.1 Hepatitis B virus isolate 2422, complete genome 1656....................1675100
FJ386652.1 Hepatitis B virus isolate 2518, complete genome 1656....................1675100
FJ386659.1 Hepatitis B virus isolate S219, complete genome 1656....................1675100
FJ386661.1 Hepatitis B virus isolate S251, complete genome 1656....................1675100
FJ386664.1 Hepatitis B virus isolate S310, complete genome 1656....................1675100
FJ386665.1 Hepatitis B virus isolate S359, complete genome 1656....................1675100
FJ386667.1 Hepatitis B virus isolate S379, complete genome 1656....................1675100
FJ386670.1 Hepatitis B virus isolate S454, complete genome 1656....................1675100
FJ386671.1 Hepatitis B virus isolate S586, complete genome 1656....................1675100
FJ386672.1 Hepatitis B virus isolate S606, complete genome 1656....................1675100
FJ386673.1 Hepatitis B virus isolate S633, complete genome 1656....................1675100
FJ386678.1 Hepatitis B virus isolate S1147, complete genome 1656....................1675100
FJ386679.1 Hepatitis B virus isolate S1217, complete genome 1656....................1675100
FJ386685.1 Hepatitis B virus isolate S1568, complete genome 1656....................1675100
FJ386686.1 Hepatitis B virus isolate S1572, complete genome 1656....................1675100
EU835240.1 Hepatitis B virus isolate IND-DIB112, complete genome 1656....................1675100
EU835241.1 Hepatitis B virus isolate IND-DIB24, complete genome 1656....................1675100
EU835242.1 Hepatitis B virus isolate IND-DIB30, complete genome 1656....................1675100
FJ518811.1 Hepatitis B virus strain ZXJ, complete genome 1651....................1670100
FJ787436.1 Hepatitis B virus isolate S129-6, complete genome 1656....................1675100
FJ787437.1 Hepatitis B virus isolate S129-9, complete genome 1656....................1675100
FJ787438.1 Hepatitis B virus isolate S129-8, complete genome 1656....................1675100
FJ787439.1 Hepatitis B virus isolate S157-4, complete genome 1656....................1675100
FJ787440.1 Hepatitis B virus isolate S157-6, complete genome 1633....................1652100
FJ787442.1 Hepatitis B virus isolate S171-4, complete genome 1656....................1675100
FJ787443.1 Hepatitis B virus isolate S171-5, complete genome 1656....................1675100
FJ787445.1 Hepatitis B virus isolate S425-2, complete genome 1656....................1675100
FJ787446.1 Hepatitis B virus isolate S425-20, complete genome 1656....................1675100
FJ787449.1 Hepatitis B virus isolate S567-3, complete genome 1656....................1675100
FJ787453.1 Hepatitis B virus isolate S1049-3, complete genome 1656....................1675100
FJ787454.1 Hepatitis B virus isolate S1049-4, complete genome 1656....................1675100
FJ787457.1 Hepatitis B virus isolate S1248-4, complete genome 1656....................1675100
FJ787458.1 Hepatitis B virus isolate S1248-9, complete genome 1656....................1675100
FJ787459.1 Hepatitis B virus isolate S1348-1, complete genome 1656....................1675100
FJ787464.1 Hepatitis B virus isolate S1371-3, complete genome 1656....................1675100
FJ787465.1 Hepatitis B virus isolate S1371-5, complete genome 1656....................1675100
FJ787466.1 Hepatitis B virus isolate S1371-11, complete genome 1656....................1675100
FJ787467.1 Hepatitis B virus isolate S1371-16, complete genome 1656....................1675100
FJ787468.1 Hepatitis B virus isolate S1426-1, complete genome 1656....................1675100
FJ787469.1 Hepatitis B virus isolate S1426-3, complete genome 1656....................1675100
FJ787470.1 Hepatitis B virus isolate S1538-4, complete genome 1656....................1675100
FJ787471.1 Hepatitis B virus isolate S1538-6, complete genome 1656....................1675100
FJ787472.1 Hepatitis B virus isolate S1732-1, complete genome 1656....................1675100
FJ787473.1 Hepatitis B virus isolate S1732-2, complete genome 1656....................1675100
FJ787474.1 Hepatitis B virus isolate S1732-6, complete genome 1656....................1675100
FJ787478.1 Hepatitis B virus isolate S65-2, complete genome 1641....................1660100
FJ787479.1 Hepatitis B virus isolate S157-7, complete genome 1656....................1675100
FJ787480.1 Hepatitis B virus isolate S425-16, complete genome 1656....................1675100
FJ787481.1 Hepatitis B virus isolate S852-2, complete genome 1611....................1630100
FJ787482.1 Hepatitis B virus isolate S1158-7, complete genome 1626....................1645100
FJ787483.1 Hepatitis B virus isolate S1158-8, complete genome 1626....................1645100
FJ787484.1 Hepatitis B virus isolate S1348-3, complete genome 1656....................1675100
FJ787485.1 Hepatitis B virus isolate S1656-8, complete genome 1626....................1645100
FJ787486.1 Hepatitis B virus isolate S2235-2, complete genome 1656....................1675100
FJ787487.1 Hepatitis B virus isolate DMY-1, complete genome 1605....................1624100
FJ787488.1 Hepatitis B virus isolate DMY-5, complete genome 1602....................1621100
FJ787489.1 Hepatitis B virus isolate DMY-6, complete genome 1602....................1621100
FJ787490.1 Hepatitis B virus isolate LHZ-1, complete genome 1629....................1648100
AB493836.1 Hepatitis B virus DNA, complete genome, isolate: P57 1656....................1675100
AB493837.1 Hepatitis B virus DNA, complete genome, isolate: 03UC 1656....................1675100
AB493838.1 Hepatitis B virus DNA, complete genome, isolate: 06UC 1656....................1675100
AB493839.1 Hepatitis B virus DNA, complete genome, isolate: 08UC 1656....................1675100
AB493840.1 Hepatitis B virus DNA, complete genome, isolate: 16UC 1656....................1675100
AB493841.1 Hepatitis B virus DNA, complete genome, isolate: 29UC 1655....................1674100
AB493842.1 Hepatitis B virus DNA, complete genome, isolate: 31UC 1656....................1675100
AB493843.1 Hepatitis B virus DNA, complete genome, isolate: 32UC 1656....................1675100
AB493844.1 Hepatitis B virus DNA, complete genome, isolate: 43UC 1656....................1675100
AB493845.1 Hepatitis B virus DNA, complete genome, isolate: 07UC 1634....................1653100
AB493846.1 Hepatitis B virus DNA, complete genome, isolate: 17UC 1653....................1672100
AB493847.1 Hepatitis B virus DNA, complete genome, isolate: 05UC 1656....................1675100
AB493848.1 Hepatitis B virus DNA, complete genome, isolate: P7 1632....................1651100
GQ167301.1 Hepatitis B virus isolate ZADGM452, complete genome 1662....................1681100
GQ167302.1 Hepatitis B virus isolate ZADGM4521, complete genome 1662....................1681100
AB362932.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon1656....................1675100
GQ205441.1 Hepatitis B virus isolate Cc, complete genome 1656....................1675100
AP011097.1 Hepatitis B virus DNA, complete genome, strain: C0503296(PTK)F 1656....................1675100
AP011098.1 Hepatitis B virus DNA, complete genome, strain: C0714154(WBK)F 1656....................1675100
AP011099.1 Hepatitis B virus DNA, complete genome, strain: C0503222(MND)F 1656....................1675100
AP011100.1 Hepatitis B virus DNA, complete genome, strain: C0607174(THN)F 1656....................1675100
AP011101.1 Hepatitis B virus DNA, complete genome, strain: C0715697(TNT)F 1656....................1675100
AP011102.1 Hepatitis B virus DNA, complete genome, strain: C0610090(BIK)F 1656....................1675100
AP011103.1 Hepatitis B virus DNA, complete genome, strain: C0610316(JYP)F 1656....................1675100
AP011104.1 Hepatitis B virus DNA, complete genome, strain: C0309374(DPS)F 1656....................1675100
AP011105.1 Hepatitis B virus DNA, complete genome, strain: C0309392(DPS)F 1656....................1675100
AP011106.1 Hepatitis B virus DNA, complete genome, strain: C0503236(BJS)F 1656....................1675100
AP011107.1 Hepatitis B virus DNA, complete genome, strain: C0503463(MTR)F 1656....................1675100
GQ227692.1 Hepatitis B virus isolate Z3-1, complete genome 1656....................1675100
GQ227693.1 Hepatitis B virus isolate Z31-1, complete genome 1656....................1675100
GQ227694.1 Hepatitis B virus isolate Z31-2, complete genome 1656....................1675100
GQ227695.1 Hepatitis B virus isolate Z31-5, complete genome 1656....................1675100
GQ227697.1 Hepatitis B virus isolate Z3-2, complete genome 1656....................1675100
GQ259588.1 Hepatitis B virus isolate Z31-22, complete genome 1656....................1675100
GQ184325.1 Hepatitis B virus isolate ZADGM50, complete genome 1639....................1658100
GQ184326.1 Hepatitis B virus isolate ZADGM501, complete genome 1653....................1672100
FJ899761.1 Hepatitis B virus isolate C9-1, complete genome 1656....................1675100
FJ899762.1 Hepatitis B virus isolate C9-3, complete genome 1656....................1675100
FJ899763.1 Hepatitis B virus isolate C9-4, complete genome 1656....................1675100
FJ899764.1 Hepatitis B virus isolate C9-12, complete genome 1656....................1675100
FJ899765.1 Hepatitis B virus isolate C9-13, complete genome 1656....................1675100
FJ899766.1 Hepatitis B virus isolate C25-2, complete genome 1656....................1675100
FJ899772.1 Hepatitis B virus isolate C113-3, complete genome 1656....................1675100
FJ899774.1 Hepatitis B virus isolate C120-5, complete genome 1656....................1675100
FJ899775.1 Hepatitis B virus isolate C120-6, complete genome 1656....................1675100
FJ899776.1 Hepatitis B virus isolate C122-7, complete genome 1656....................1675100
FJ899778.1 Hepatitis B virus isolate C173-1, complete genome 1656....................1675100
FJ899780.1 Hepatitis B virus isolate C185-2, complete genome 1656....................1675100
FJ899780.1 Hepatitis B virus isolate C185-2, complete genome 1684....................1703100
FJ899781.1 Hepatitis B virus isolate C185-3, complete genome 1656....................1675100
FJ899781.1 Hepatitis B virus isolate C185-3, complete genome 1684....................1703100
FJ899782.1 Hepatitis B virus isolate C185-6, complete genome 1656....................1675100
FJ899782.1 Hepatitis B virus isolate C185-6, complete genome 1684....................1703100
FJ899783.1 Hepatitis B virus isolate C207-1, complete genome 1656....................1675100
FJ899789.1 Hepatitis B virus isolate C226-3, complete genome 1656....................1675100
FJ899792.1 Hepatitis B virus isolate D146-1, complete genome 1656....................1675100
FJ899793.1 Hepatitis B virus isolate C122-2, complete genome 1601....................1620100
FJ899794.1 Hepatitis B virus isolate C122-3, complete genome 1601....................1620100
FJ899795.1 Hepatitis B virus isolate C122-9, complete genome 1601....................1620100
GQ372968.1 Hepatitis B virus isolate 6380-3, complete genome 1656....................1675100
AB485808.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IT 1656....................1675100
AB485809.1 Hepatitis B virus DNA, complete genome, isolate: FEP1 1635....................1654100
AB485810.1 Hepatitis B virus DNA, complete genome, isolate: FEP2 1656....................1675100
GQ377514.1 Hepatitis B virus isolate J8, complete genome 1656....................1675100
GQ377516.1 Hepatitis B virus isolate J10, complete genome 1656....................1675100
GQ377517.1 Hepatitis B virus isolate J12, complete genome 1656....................1675100
GQ377518.1 Hepatitis B virus isolate J14, complete genome 1656....................1675100
GQ377520.1 Hepatitis B virus isolate J18, complete genome 1656....................1675100
GQ377522.1 Hepatitis B virus isolate J20, complete genome 1656....................1675100
GQ377523.1 Hepatitis B virus isolate J21, complete genome 1656....................1675100
GQ377524.1 Hepatitis B virus isolate J23, complete genome 1656....................1675100
GQ377526.1 Hepatitis B virus isolate J27, complete genome 1656....................1675100
GQ377527.1 Hepatitis B virus isolate J28, complete genome 1656....................1675100
GQ377528.1 Hepatitis B virus isolate J29, complete genome 1656....................1675100
GQ377529.1 Hepatitis B virus isolate J34, complete genome 1656....................1675100
GQ377530.1 Hepatitis B virus isolate J35, complete genome 1656....................1675100
GQ377531.1 Hepatitis B virus isolate J36, complete genome 1656....................1675100
GQ377532.1 Hepatitis B virus isolate J37, complete genome 1656....................1675100
GQ377533.1 Hepatitis B virus isolate J39, complete genome 1656....................1675100
GQ377534.1 Hepatitis B virus isolate J41, complete genome 1656....................1675100
GQ377538.1 Hepatitis B virus isolate J52, complete genome 1656....................1675100
GQ377539.1 Hepatitis B virus isolate J53, complete genome 1656....................1675100
GQ377540.1 Hepatitis B virus isolate J57, complete genome 1656....................1675100
GQ377541.1 Hepatitis B virus isolate J58, complete genome 1656....................1675100
GQ377543.1 Hepatitis B virus isolate J63, complete genome 1656....................1675100
GQ377544.1 Hepatitis B virus isolate J69, complete genome 1656....................1675100
GQ377545.1 Hepatitis B virus isolate J76, complete genome 1656....................1675100
GQ377548.1 Hepatitis B virus isolate J79, complete genome 1656....................1675100
GQ377549.1 Hepatitis B virus isolate J80, complete genome 1656....................1675100
GQ377552.1 Hepatitis B virus isolate J83, complete genome 1656....................1675100
GQ377554.1 Hepatitis B virus isolate J85, complete genome 1656....................1675100
GQ377555.1 Hepatitis B virus isolate J86, complete genome 1656....................1675100
GQ377556.1 Hepatitis B virus isolate J87, complete genome 1656....................1675100
GQ377557.1 Hepatitis B virus isolate J88, complete genome 1656....................1675100
GQ377559.1 Hepatitis B virus isolate J92, complete genome 1656....................1675100
GQ377562.1 Hepatitis B virus isolate J97, complete genome 1656....................1675100
GQ377563.1 Hepatitis B virus isolate J98, complete genome 1656....................1675100
GQ377564.1 Hepatitis B virus isolate J99, complete genome 1656....................1675100
GQ377565.1 Hepatitis B virus isolate J100, complete genome 1656....................1675100
GQ377567.1 Hepatitis B virus isolate J102, complete genome 1656....................1675100
GQ377570.1 Hepatitis B virus isolate J110, complete genome 1656....................1675100
GQ377571.1 Hepatitis B virus isolate J112, complete genome 1656....................1675100
GQ377572.1 Hepatitis B virus isolate J113, complete genome 1656....................1675100
GQ377573.1 Hepatitis B virus isolate J114, complete genome 1656....................1675100
GQ377576.1 Hepatitis B virus isolate J117, complete genome 1656....................1675100
GQ377577.1 Hepatitis B virus isolate J118, complete genome 1656....................1675100
GQ377578.1 Hepatitis B virus isolate J125, complete genome 1656....................1675100
GQ377579.1 Hepatitis B virus isolate J126, complete genome 1656....................1675100
GQ377580.1 Hepatitis B virus isolate J127, complete genome 1656....................1675100
GQ377581.1 Hepatitis B virus isolate J129, complete genome 1656....................1675100
GQ377583.1 Hepatitis B virus isolate J132, complete genome 1656....................1675100
GQ377585.1 Hepatitis B virus isolate J134, complete genome 1656....................1675100
GQ377586.1 Hepatitis B virus isolate J135, complete genome 1656....................1675100
GQ377589.1 Hepatitis B virus isolate J145, complete genome 1656....................1675100
GQ377590.1 Hepatitis B virus isolate J147, complete genome 1656....................1675100
GQ377592.1 Hepatitis B virus isolate J149, complete genome 1656....................1675100
GQ377593.1 Hepatitis B virus isolate J150, complete genome 1656....................1675100
GQ377594.1 Hepatitis B virus isolate J152, complete genome 1656....................1675100
GQ377596.1 Hepatitis B virus isolate J156, complete genome 1656....................1675100
GQ377598.1 Hepatitis B virus isolate J158, complete genome 1656....................1675100
GQ377599.1 Hepatitis B virus isolate J160, complete genome 1656....................1675100
GQ377600.1 Hepatitis B virus isolate J161, complete genome 1656....................1675100
GQ377601.1 Hepatitis B virus isolate J164, complete genome 1656....................1675100
GQ377602.1 Hepatitis B virus isolate J165, complete genome 1656....................1675100
GQ377603.1 Hepatitis B virus isolate J166, complete genome 1656....................1675100
GQ377604.1 Hepatitis B virus isolate J168, complete genome 1656....................1675100
GQ377605.1 Hepatitis B virus isolate J169, complete genome 1656....................1675100
GQ377607.1 Hepatitis B virus isolate J172, complete genome 1656....................1675100
GQ377608.1 Hepatitis B virus isolate J174, complete genome 1656....................1675100
GQ377609.1 Hepatitis B virus isolate J176, complete genome 1656....................1675100
GQ377611.1 Hepatitis B virus isolate J179, complete genome 1656....................1675100
GQ377613.1 Hepatitis B virus isolate J181, complete genome 1656....................1675100
GQ377614.1 Hepatitis B virus isolate J185, complete genome 1656....................1675100
GQ377615.1 Hepatitis B virus isolate J186, complete genome 1656....................1675100
GQ377616.1 Hepatitis B virus isolate J192, complete genome 1656....................1675100
GQ377617.1 Hepatitis B virus isolate J193, complete genome 1656....................1675100
GQ377623.1 Hepatitis B virus isolate J208, complete genome 1656....................1675100
GQ377624.1 Hepatitis B virus isolate J221, complete genome 1656....................1675100
GQ377626.1 Hepatitis B virus isolate J225, complete genome 1656....................1675100
GQ377627.1 Hepatitis B virus isolate J231, complete genome 1656....................1675100
GQ377628.1 Hepatitis B virus isolate J232, complete genome 1656....................1675100
GQ377631.1 Hepatitis B virus isolate J239, complete genome 1656....................1675100
GQ377632.1 Hepatitis B virus isolate J240, complete genome 1656....................1675100
GQ377637.1 Hepatitis B virus isolate J249, complete genome 1656....................1675100
GQ872210.1 Hepatitis B virus, complete genome 1656....................1675100
GQ872211.1 Hepatitis B virus, complete genome 1656....................1675100
GQ475305.1 Hepatitis B virus isolate KOR1CHB, complete genome 1656....................1675100
GQ475306.1 Hepatitis B virus isolate KOR2CHB, complete genome 1656....................1675100
GQ475307.1 Hepatitis B virus isolate KOR3CHB, complete genome 1656....................1675100
GQ475308.1 Hepatitis B virus isolate KOR4CHB, complete genome 1656....................1675100
GQ475309.1 Hepatitis B virus isolate KOR5CHB, complete genome 1656....................1675100
GQ475310.1 Hepatitis B virus isolate KOR6CHB, complete genome 1656....................1675100
GQ475311.1 Hepatitis B virus isolate KOR7CHB, complete genome 1656....................1675100
GQ475312.1 Hepatitis B virus isolate KOR8CHB, complete genome 1656....................1675100
GQ475313.1 Hepatitis B virus isolate KOR9CHB, complete genome 1656....................1675100
GQ475314.1 Hepatitis B virus isolate KOR10CHB, complete genome 1656....................1675100
GQ475315.1 Hepatitis B virus isolate KOR11CHB, complete genome 1656....................1675100
GQ475316.1 Hepatitis B virus isolate KOR12CHB, complete genome 1656....................1675100
GQ475317.1 Hepatitis B virus isolate KOR13CHB, complete genome 1656....................1675100
GQ475318.1 Hepatitis B virus isolate KOR14CHB, complete genome 1656....................1675100
GQ475319.1 Hepatitis B virus isolate KOR15CHB, complete genome 1656....................1675100
GQ475320.1 Hepatitis B virus isolate KOR16CHB, complete genome 1656....................1675100
GQ475321.1 Hepatitis B virus isolate KOR17CHB, complete genome 1656....................1675100
GQ475322.1 Hepatitis B virus isolate KOR18LC, complete genome 1656....................1675100
GQ475323.1 Hepatitis B virus isolate KOR19LC, complete genome 1668....................1687100
GQ475324.1 Hepatitis B virus isolate KOR20LC, complete genome 1656....................1675100
GQ475326.1 Hepatitis B virus isolate KOR22LC, complete genome 1608....................1627100
GQ475327.1 Hepatitis B virus isolate KOR23LC, complete genome 1656....................1675100
GQ475328.1 Hepatitis B virus isolate KOR24LC, complete genome 1656....................1675100
GQ475329.1 Hepatitis B virus isolate KOR25LC, complete genome 1656....................1675100
GQ475330.1 Hepatitis B virus isolate KOR26LC, complete genome 1656....................1675100
GQ475331.1 Hepatitis B virus isolate KOR27LC, complete genome 1656....................1675100
GQ475333.1 Hepatitis B virus isolate KOR29LC, complete genome 1602....................1621100
GQ475334.1 Hepatitis B virus isolate KOR30LC, complete genome 1656....................1675100
GQ475335.1 Hepatitis B virus isolate KOR31LC, complete genome 1629....................1648100
GQ475336.1 Hepatitis B virus isolate KOR32LC, complete genome 1656....................1675100
GQ475337.1 Hepatitis B virus isolate KOR33LC, complete genome 1656....................1675100
GQ475338.1 Hepatitis B virus isolate KOR34LC, complete genome 1656....................1675100
GQ475339.1 Hepatitis B virus isolate KOR35HCC, complete genome 1656....................1675100
GQ475341.1 Hepatitis B virus isolate KOR37HCC, complete genome 1656....................1675100
GQ475342.1 Hepatitis B virus isolate KOR38HCC, complete genome 1656....................1675100
GQ475343.1 Hepatitis B virus isolate KOR39HCC, complete genome 1623....................1642100
GQ475344.1 Hepatitis B virus isolate KOR40HCC, complete genome 1656....................1675100
GQ475345.1 Hepatitis B virus isolate KOR41HCC, complete genome 1656....................1675100
GQ475346.1 Hepatitis B virus isolate KOR42HCC, complete genome 1656....................1675100
GQ475347.1 Hepatitis B virus isolate KOR43HCC, complete genome 1656....................1675100
GQ475348.1 Hepatitis B virus isolate KOR44HCC, complete genome 1656....................1675100
GQ475349.1 Hepatitis B virus isolate KOR45HCC, complete genome 1656....................1675100
GQ475350.1 Hepatitis B virus isolate KOR46HCC, complete genome 1656....................1675100
GQ475351.1 Hepatitis B virus isolate KOR47HCC, complete genome 1656....................1675100
GQ475352.1 Hepatitis B virus isolate KOR48HCC, complete genome 1623....................1642100
GQ475353.1 Hepatitis B virus isolate KOR49HCC, complete genome 1656....................1675100
GQ475354.1 Hepatitis B virus isolate KOR50HCC, complete genome 1656....................1675100
GQ475355.1 Hepatitis B virus isolate KOR51HCC, complete genome 1656....................1675100
GQ475356.1 Hepatitis B virus isolate KOR52HCC, complete genome 1656....................1675100
GQ475357.1 Hepatitis B virus isolate KOR53HCC, complete genome 1656....................1675100
AB471851.1 Hepatitis B virus DNA, complete genome, isolate: F2NK-F 1656....................1675100
AB471852.1 Hepatitis B virus DNA, complete genome, isolate: F2S-C2 1656....................1675100
AB471853.1 Hepatitis B virus DNA, complete genome, isolate: F2S-C3 1656....................1675100
AB471856.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C1 1656....................1675100
AB471857.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C2 1656....................1675100
FN594748.1 Hepatitis B virus complete genome, isolate bne6 1656....................1675100
FN594749.1 Hepatitis B virus complete genome, isolate bne8 1656....................1675100
FN594750.1 Hepatitis B virus complete genome, isolate bne12 1656....................1675100
FN594752.1 Hepatitis B virus complete genome, isolate bne134 1656....................1675100
FN594753.1 Hepatitis B virus complete genome, isolate bne137 1641....................1660100
FN594754.1 Hepatitis B virus complete genome, isolate bne200 1656....................1675100
FN594755.1 Hepatitis B virus complete genome, isolate bne241 1656....................1675100
FN594756.1 Hepatitis B virus complete genome, isolate bne250 1656....................1675100
FN594757.1 Hepatitis B virus complete genome, isolate bne305 1641....................1660100
FN594758.1 Hepatitis B virus complete genome, isolate bne341 1656....................1675100
FN594759.1 Hepatitis B virus complete genome, isolate bne342 1656....................1675100
FN594760.1 Hepatitis B virus complete genome, isolate bne362 1656....................1675100
FN594761.1 Hepatitis B virus complete genome, isolate bne385 1656....................1675100
FN594762.1 Hepatitis B virus complete genome, isolate bne439 1656....................1675100
FN594763.1 Hepatitis B virus complete genome, isolate bne446 1656....................1675100
FN594764.1 Hepatitis B virus complete genome, isolate bne9439 1656....................1675100
FN594765.1 Hepatitis B virus complete genome, isolate bne9447 1656....................1675100
FN594766.1 Hepatitis B virus complete genome, isolate bne9449 1656....................1675100
FN594767.1 Hepatitis B virus complete genome, isolate bne127 1656....................1675100
FN594768.1 Hepatitis B virus complete genome, isolate bne272 1656....................1675100
FN594769.1 Hepatitis B virus complete genome, isolate bne281 1656....................1675100
FN594771.1 Hepatitis B virus complete genome, isolate bne442 1656....................1675100
GU357844.1 Hepatitis B virus isolate W29, complete genome 1656....................1675100
GU357846.1 Hepatitis B virus isolate Y10, complete genome 1656....................1675100
GU721029.1 Hepatitis B virus isolate CMCL107, complete genome 1656....................1675100
FN545821.1 Hepatitis B virus complete genome, strain 29122 1656....................1675100
FN545822.1 Hepatitis B virus complete genome, strain 29134 1656....................1675100
FN545823.1 Hepatitis B virus complete genome, strain 29135 1656....................1675100
FN545827.1 Hepatitis B virus complete genome, strain 34011 1644....................1663100
FN545841.1 Hepatitis B virus complete genome, strain 42349 1656....................1675100
FN545842.1 Hepatitis B virus complete genome, strain 42366 1656....................1675100
AB555496.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA31 1656....................1675100
AB555497.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA37 1656....................1675100
AB555500.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA64 1656....................1675100
AB555501.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA65 1656....................1675100
AB540584.1 HBV genotype C DNA, complete genome, strain: C0901190(NT16) 1656....................1675100
HM146131.1 Hepatitis B virus isolate TCGA5889, complete genome 1530....................1549100
FR714498.1 Hepatitis B virus complete genome, isolate QQB36, X/C recombinant 1656....................1675100
FR714498.1 Hepatitis B virus complete genome, isolate QQB36, X/C recombinant 1002___...........g..t._101770
AB560661.1 HBV genotype C DNA, complete genome, isolate: 58PU 1656....................1675100
AB560662.1 HBV genotype C DNA, complete genome, isolate: 60PU 1656....................1675100
GU177079.1 Hepatitis B virus isolate DN171, complete genome 1656....................1675100
AB554014.1 HBV genotype C DNA, complete genome, isolate: TRF08029 1656....................1675100
AB554015.1 HBV genotype C DNA, complete genome, isolate: TRF08111 1656....................1675100
AB554016.1 HBV genotype D DNA, complete genome, isolate: TRF08226 1653....................1672100
AB554018.1 HBV genotype C DNA, complete genome, isolate: NMB09075 1656....................1675100
AB554021.1 HBV genotype C DNA, complete genome, isolate: GRS08298 1656....................1675100
AB554022.1 HBV genotype C DNA, complete genome, isolate: GRS08325 1656....................1675100
AB554023.1 HBV genotype D DNA, complete genome, isolate: GRS08457 1653....................1672100
AB554024.1 HBV genotype D DNA, complete genome, isolate: GRS08538 1653....................1672100
AB554025.1 HBV genotype C DNA, complete genome, isolate: MRK89073 1656....................1675100
AB562462.1 Hepatitis B virus DNA, complete genome, isolate: HPA184_07 1656....................1675100
AB562462.1 Hepatitis B virus DNA, complete genome, isolate: HPA184_07 1002___...........g..t._101770
HQ236014.1 Hepatitis B virus isolate RS1, complete genome 1656....................1675100
HQ236015.1 Hepatitis B virus isolate RS2, complete genome 1656....................1675100
HQ236016.1 Hepatitis B virus isolate RS3, complete genome 1656....................1675100
AB583679.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8134 1656....................1675100
AB583680.1 Hepatitis B virus DNA, complete genome, isolate: Pkst7912 1656....................1675100
AB583681.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8216 1656....................1675100
JF491447.1 Hepatitis B virus isolate QH-13, complete genome 1656....................1675100
JF491448.1 Hepatitis B virus isolate QH-29, complete genome 1656....................1675100
JF491449.1 Hepatitis B virus isolate QH-32, complete genome 1656....................1675100
JF491450.1 Hepatitis B virus isolate QH-33, complete genome 1656....................1675100
JF491451.1 Hepatitis B virus isolate QH-35, complete genome 1656....................1675100
JF491452.1 Hepatitis B virus isolate QH-53, complete genome 1656....................1675100
JF491453.1 Hepatitis B virus isolate QH-90, complete genome 1656....................1675100
JF491454.1 Hepatitis B virus isolate QH-79, complete genome 1656....................1675100
JF491455.1 Hepatitis B virus isolate Tibet-31, complete genome 1656....................1675100
JF491456.1 Hepatitis B virus isolate Tibet-53, complete genome 1656....................1675100
X04615.1 Hepatitis B virus genome, subtype ayr 1656....................1675100
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 1656.................y..167595
AP007261.1 HBV genotype H DNA, complete genome, isolate: HB-JI260F 1656..................._167495
AB201287.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1656..................._167495
DQ536410.1 Hepatitis B virus isolate JeF339 clone JeF339U-3, complete genome 1657_...................167595
DQ536411.1 Hepatitis B virus isolate JeF339 clone JeF339U-1, complete genome 1657_...................167595
DQ536412.1 Hepatitis B virus isolate JeF339 clone JeF339U-2, complete genome 1657_...................167595
DQ536413.1 Hepatitis B virus isolate JeF339 clone JeF339D-1, complete genome 1171_...................118995
DQ536414.1 Hepatitis B virus isolate JeF339 clone JeF339D-2, complete genome 1171_...................118995
EU158262.1 Hepatitis B virus isolate G116, complete genome 1656.................y..167595
EU939610.1 Hepatitis B virus isolate C211, complete genome 1657_...................167595
FJ386648.1 Hepatitis B virus isolate 2419, complete genome 1656.................y..167595
GQ184322.1 Hepatitis B virus isolate ZADGM4522, complete genome 1663_...................168195
GQ377575.1 Hepatitis B virus isolate J116, complete genome 1656..................k.167595
AB516394.1 HBV genotype H DNA, complete genome, isolate: MEX912M 1653..................._167195
AB554019.1 HBV genotype C DNA, complete genome, isolate: NMB09122 1657_...................167595
AB554020.1 HBV genotype C DNA, complete genome, isolate: NMB09124 1657_...................167595
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 1656..................c.167595
X02763.1 Hepatitis b virus genome (serotype adw2) 3065..................c.308495
X65258.1 Hepatitis B virus (ayw,patient CI) genes PreS1, PreS2, PreC, C, X and1658..................c.167795
X65259.1 Hepatitis B virus (ayw,patient E) genes PreS1, PreS2, PreC, C, X and 1658..................c.167795
X68292.1 Hepatitis B Virus DNA 1658..................c.167795
D00329.1HPBADW1 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl1656.................t..167595
D00330.1HPBADW2 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl1656.................t..167595
D00331.1HPBADW3 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl1656.................t..167595
L08805.1HPBETNC Hepatitis B virus envelope, surface and nucleocapsid protein g1655.................t..167495
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 1658..................c.167795
M38454.1HPBADR1CG Hepatitis B virus , complete genome 256.....c..............27595
M54923.1HPBADWZ Hepatitis B virus (subtype adw), complete genome 1656.................t..167595
X75665.1 Human hepatitis virus (genotype C, HMA) preS1, preS2, S, C, X, antige1656.....a..............167595
X75663.1 Human hepatitis virus (genotype F, 9203) preS1, preS2, S, C, X, and P1656.................t..167595
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot1658..................c.167795
D23677.1HPBA1HKK2 Hepatitis B virus (A1-HBVKK2) complete genome sequence 1656.................t..167595
D23678.1HPBA2HYS2 Hepatitis B virus (A2-HBVYS2) complete genome sequence 1656.................t..167595
D23679.1HPBA3HMS2 Hepatitis B virus (A3-HBVMS2) complete genome sequence 1656.................t..167595
X85254.1 Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polym1658.................t..167795
X51970.1 Hepatitis B virus (HBV 991) complete genome 1656..................c.167595
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes1656..................c.167595
Z72479.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes1656..................c.167595
X97850.1 Hepatitis B virus (patient 4) complete genome 1658.................t..167795
X97851.1 Hepatitis B virus (patient 6) complete genome 1658.................t..167795
D50521.1 Hepatitis B virus clone HBV-ASA-FH1 genomic DNA, complete sequence 1656.................t..167595
D50522.1 Hepatitis B virus clone HBV-ASA-FH2 genomic DNA, complete sequence 1656.................t..167595
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 1608.........a..........162795
AB014366.1 Hepatitis B virus genomic DNA, complete sequence, isolate 07D07HCC 1668.................t..168795
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 1656..................c.167595
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 1656..................c.167595
AB014380.1 Hepatitis B virus genomic DNA, complete sequence, isolate 21Y03HCC 1656..................c.167595
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 1656..................c.167595
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 1656..................c.167595
AJ131567.1 Hepatitis B virus complete genome, isolate gor97 3025.................t..304495
AJ131569.1 Hepatitis B virus complete genome, isolate gib759 3025.................t..304495
AJ131572.1 Hepatitis B virus complete genome, isolate gib160 3025.................t..304495
AJ131573.1 Hepatitis B virus complete genome, isolate gib153 3025.................t..304495
AJ131570.1 Hepatitis B virus complete genome, isolate gib731 2789.................t..280895
AJ131574.1 Hepatitis B virus complete genome, isolate gib151 3025.................t..304495
AF100308.1 Hepatitis B virus strain 2-18, complete genome 1658.................t..167795
AF100309.1 Hepatitis B virus strain 56, complete genome 1658.................t..167795
AJ131133.1 Hepatitis B virus, complete genome, strain JL1 1655.................t..167495
AF143298.1 Hepatitis B virus clone 7720-G8, complete genome 3001..................c.302095
AF143299.1 Hepatitis B virus clone 7744-G9, complete genome 2884..................c.290395
AF143300.1 Hepatitis B virus clone 7832-G4, complete genome 2899..................c.291895
AF143301.1 Hepatitis B virus clone BW1903, complete genome 2897..................c.291695
AF143301.1 Hepatitis B virus clone BW1903, complete genome 2869............._______288165
AF143302.1 Hepatitis B virus clone HD1402, complete genome 2968..................c.298795
AF143304.1 Hepatitis B virus clone HD319, complete genome 2977..................c.299695
AF143305.1 Hepatitis B virus clone RM501, complete genome 2951..................c.297095
AF143305.1 Hepatitis B virus clone RM501, complete genome 2932............________294360
AF143306.1 Hepatitis B virus clone RM517, complete genome 2978..................c.299795
AF143307.1 Hepatitis B virus clone RM518, complete genome 2803..................c.282295
AF143308.1 Hepatitis B virus clone WB1254, complete genome 2897..................c.291695
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 283..................c.30295
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 283..................c.30295
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 283..................c.30295
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 283..................c.30295
AB031266.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-31656.................t..167595
AB031267.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-61656.................t..167595
AB033554.1 Hepatitis B virus DNA, complete genome, isolate:RTB299 1656.................t..167595
AB033555.1 Hepatitis B virus DNA, complete genome, isolate:PAD744 1656.................t..167595
AB033559.1 Hepatitis B virus DNA, complete genome, isolate:PYW310 1656...c................167595
AB010289.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-1 1656.................t..167595
AB010290.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-2 1656.................t..167595
AB010291.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-3 1656.................t..167595
AB010292.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-4 1656.................t..167595
AB032432.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch2561656.................t..167595
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch2581656.................t..167595
AF121243.1 Hepatitis B virus isolate HBV/14611, complete genome 1656.................t..167595
AF121244.1 Hepatitis B virus isolate HBV/15122, complete genome 1656.................t..167595
AF121245.1 Hepatitis B virus isolate HBV/16091, complete genome 1656.................t..167595
AF121246.1 Hepatitis B virus isolate HBV/IK29902, complete genome 1656.................t..167595
AF121247.1 Hepatitis B virus isolate HBV/719, complete genome 1656.................t..167595
AF121248.1 Hepatitis B virus isolate HBV/139-1, complete genome 1656.................t..167595
AF121249.1 Hepatitis B virus isolate HBV/4014, complete genome 1656.................t..167595
AF121250.1 Hepatitis B virus isolate HBV/6395, complete genome 1656.................t..167595
AF121251.1 Hepatitis B virus isolate HBV/9873, complete genome 1656.................t..167595
AF193863.1 Orangutan hepadnavirus strain Somad, complete genome 1656.................g..167595
AF193864.1 Orangutan hepadnavirus strain Papa, complete genome 1656.................g..167595
AF222322.1 Hepatitis B virus isolate CH109, complete genome 1658.................t..167795
AF222323.1 Hepatitis B virus isolate CH926, complete genome 1658.................t..167795
AF233236.1 Hepatitis B virus strain adw2 isolate HBV334, complete genome 2912.................t..293195
AF242585.1 Hepatitis B virus isolate CHIMP_2, complete genome 1656.................t..167595
AF242586.1 Hepatitis B virus isolate CHIMP_4, complete genome 1656.................t..167595
AF282917.1 Hepatitis B virus isolate HBV-B1, complete genome 1656.................t..167595
AF282918.1 Hepatitis B virus isolate HBV-B2, complete genome 1656.................t..167595
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 1658..................c.167795
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 1658..................a.167795
AF182804.1 Hepatitis B virus strain WLAP10, complete genome 1658..................c.167795
AF182805.1 Hepatitis B virus strain WLAID, complete genome 1625..................c.164495
AF241407.1 Hepatitis B virus isolate 11141, complete genome 1656...c................167595
AF241407.1 Hepatitis B virus isolate 11141, complete genome 1002___...........g..t._101770
AF241408.1 Hepatitis B virus isolate 14118, complete genome 1656...c................167595
AF241408.1 Hepatitis B virus isolate 14118, complete genome 1002___...........g..t._101770
AF241409.1 Hepatitis B virus isolate 6871, complete genome 1656...c................167595
AF241409.1 Hepatitis B virus isolate 6871, complete genome 1002___...........g..t._101770
AB036905.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-1656.................t..167595
AB036906.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-1647.................t..166695
AB036907.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-1647.................t..166695
AB036908.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1647.................t..166695
AB036909.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-1656.................t..167595
AB036910.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036911.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036912.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036913.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036914.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036915.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036916.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036917.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036918.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036919.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AB036920.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:1656.................t..167595
AF305327.1 Hepatitis B virus isolate CB0376, complete genome 1658.................t..167795
AB037927.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Makiko 1656.................t..167595
AB037928.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Yohko 1656.................t..167595
AB049610.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN29 1656...c................167595
AB048704.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1656..................c.167595
AY034878.1 Hepatitis B virus isolate HBVKL, complete genome 3052..................c.307195
AJ309369.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 101656..................c.167595
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 111656..................c.167595
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 111656..................c.167595
AF297621.1 Hepatitis B virus isolate 78, complete genome 1656..................c.167595
AF297622.1 Hepatitis B virus isolate 79, complete genome 1656..................c.167595
AF297623.1 Hepatitis B virus isolate 83, complete genome 1605..................c.162495
AF297624.1 Hepatitis B virus isolate 80, complete genome 1656..................c.167595
AF297625.1 Hepatitis B virus isolate 84, complete genome 1656..................c.167595
AF411409.1 Hepatitis B virus strain FMC#16, complete genome 1658..................g.167795
AF411410.1 Hepatitis B virus strain FMC#20, complete genome 1631..................c.165095
AB059659.1 Hepatitis B virus DNA, complete genome, clone:US10 1656.................t..167595
AB059660.1 Hepatitis B virus DNA, complete genome, clone:US1778 1656.................t..167595
AB059661.1 Hepatitis B virus DNA, complete genome, clone:US2065 1656.................t..167595
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 1656.............c......167595
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 1656..................c.167595
AB064315.1 Hepatitis B virus DNA, complete genome, clone:US1122 1647.................t..166695
AF458664.1 Hepatitis B virus isolate C84, complete genome 1658..................g.167795
AF461358.1 Hepatitis B virus isolate FH8, compete genome 1658..................g.167795
AF461359.1 Hepatitis B virus isolate c16, compete genome 1658..................g.167795
AF461360.1 Hepatitis B virus isolate FH14-2, compete genome 1658.................t..167795
AF461362.1 Hepatitis B virus isolate FH10, compete genome 1596.................t..161595
AF461362.1 Hepatitis B virus isolate FH10, compete genome 1707.................t..172695
AF462041.1 Hepatitis B virus clone pAM6, complete genome 1656..................c.167595
AJ344115.1 Hepatitis B virus complete genome, genotype A, isolate X27 1656..................c.167595
AJ344116.1 Hepatitis B virus complete genome, genotype D, isolate GX27 1656.................t..167595
AF479684.1 Hepatitis B virus isolate 3c, complete genome 1656.................t..167595
AY077735.1 Hepatitis B virus isolate G25, complete genome 1656.................t..167595
U87746.3 Hepatitis B virus isolate 7782, complete genome 1663.................g..168295
AB073821.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi20 1656.................t..167595
AB073822.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi32 1656.................t..167595
AB073823.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi35 1656.................t..167595
AB073824.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi4 1656.................t..167595
AB073826.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi89 1656.................t..167595
AB073827.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK11 1656.................t..167595
AB073828.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK37 1656.................t..167595
AB073829.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK38 1656.................t..167595
AB073830.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH57 1656.................t..167595
AB073831.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH61 1656.................t..167595
AB073832.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th65 1656.................t..167595
AB073833.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi59 1656.................t..167595
AB073834.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi16 1656.................t..167595
AB073835.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi29 1656.................t..167595
AB073837.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ku1 1656.................t..167595
AB073838.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ho7 1656.................t..167595
AB073842.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw11 1656.................t..167595
AB073844.1 Hepatitis B virus DNA, complete genome, isolate:HBV-T11 1656.................t..167595
AB073845.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ya16 1656.................t..167595
AB073846.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry565 1656.................t..167595
AB073847.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Fu53 1656.................t..167595
AB073851.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry1 1656.................t..167595
AB073853.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry24 1656.................g..167595
AB073854.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry30 1656.................t..167595
AB073855.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry34 1656.................t..167595
AB073856.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry46 1656.................t..167595
AB073857.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry48 1656.................t..167595
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 1656..................c.167595
U87747.3 Hepatitis B virus isolate Wong, complete genome 1652.................t..167195
AY090455.1 Hepatitis B virus strain 1889Nic, complete genome 1659.................t..167895
AY090456.1 Hepatitis B virus strain 1980Nic, complete genome 1647...c................166695
AY090457.1 Hepatitis B virus strain 2928Nic, complete genome 1659.................t..167895
AY090458.1 Hepatitis B virus strain 70H, complete genome 1659...c................167895
AY090459.1 Hepatitis B virus strain 7768H, complete genome 1659...c................167895
AY090461.1 Hepatitis B virus strain 1116Sal, complete genome 1659...c................167895
AY123424.1 Hepatitis B virus, complete genome 1658..................g.167795
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro1656..................c.167595
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro1656..................c.167595
AY128092.1 Hepatitis B virus clone pEco63, complete genome 1658..................c.167795
AF536524.1 Hepatitis B virus clone 2A, complete genome 1656..................c.167595
AF537371.1 Hepatitis B virus clone 3.4, complete genome 1656..................c.167595
AF537372.1 Hepatitis B virus clone 4B, complete genome 1656..................c.167595
AF498266.1 Hepatitis B virus isolate FG, complete genome 1656.................t..167595
AF418676.1 Hepatitis B virus patient 567 clone 1, complete genome 1640...t................165995
AF418677.1 Hepatitis B virus patient 567 clone 2, complete genome 1640...t................165995
AF418678.1 Hepatitis B virus patient 567 clone 3, complete genome 1601...t................162095
AF418682.1 Hepatitis B virus patient 4727 clone 1, complete genome 1658..................c.167795
AY152726.1 Hepatitis B virus isolate 8.22, complete genome 1656..................c.167595
AY161138.1 Hepatitis B virus clone S1.1 complete genome 1659..................c.167895
AY161139.1 Hepatitis B virus clone S1.2 complete genome 1656..................c.167595
AY161142.1 Hepatitis B virus clone S3.1, complete genome 1602...t................162195
AY161143.1 Hepatitis B virus clone S3.2, complete genome 1641...t................166095
AY161144.1 Hepatitis B virus clone S3.3, complete genome 1641...t................166095
AY161145.1 Hepatitis B virus clone S4.1 complete genome 1656..................c.167595
AY161146.1 Hepatitis B virus clone S4.2 complete genome 1656..................c.167595
AY217374.1 Hepatitis B virus isolate 595, complete genome 1642..........c.........166195
AY217355.1 Hepatitis B virus isolate A6-2, complete genome 1656.................t..167595
AY217356.1 Hepatitis B virus isolate A9-2, complete genome 1656.................t..167595
AY217357.1 Hepatitis B virus isolate B1r-4, complete genome 1656.................t..167595
AY217358.1 Hepatitis B virus isolate B8r-4, complete genome 1656.................t..167595
AY217359.1 Hepatitis B virus isolate Q6-5, complete genome 1656.................t..167595
AY217360.1 Hepatitis B virus isolate 6-4, complete genome 1656.................t..167595
AY217362.1 Hepatitis B virus isolate 582-4, complete genome 1656.................t..167595
AY217363.1 Hepatitis B virus isolate 582-1, complete genome 1658.................t..167795
AY217366.1 Hepatitis B virus isolate 17127, complete genome 1655.................t..167495
AY217367.1 Hepatitis B virus isolate 17993, complete genome 1654.................t..167395
AY217368.1 Hepatitis B virus isolate 21949, complete genome 1656.................t..167595
AY217369.1 Hepatitis B virus isolate H2, complete genome 1655.................t..167495
AY217370.1 Hepatitis B virus isolate 7-2, complete genome 1656.................t..167595
AY217370.1 Hepatitis B virus isolate 7-2, complete genome 1708.................t..172795
AY238972.1 Hepatitis B virus defective isolate FMU023, complete genome 809.................t..82895
AY206373.1 Hepatitis B virus strain FMU002 complete genome 1658.................t..167795
AY206375.1 Hepatitis B virus strain FMU004 complete genome 1658.................t..167795
AY206377.1 Hepatitis B virus strain FMU006 complete genome 1658.................t..167795
AY206377.1 Hepatitis B virus strain FMU006 complete genome 1690.................t..170995
AY206380.1 Hepatitis B virus strain FMU009 complete genome 1658.................t..167795
AY206381.1 Hepatitis B virus strain FMU010 complete genome 1658..................c.167795
AY206382.1 Hepatitis B virus strain FMU011 complete genome 1658..................c.167795
AY206383.1 Hepatitis B virus strain FMU012 complete genome 1658.................t..167795
AY206384.1 Hepatitis B virus strain FMU013 complete genome 1658..................g.167795
AY206385.1 Hepatitis B virus strain FMU014 complete genome 1625...c................164495
AY206386.1 Hepatitis B virus strain FMU015 complete genome 1658...c................167795
AY206387.1 Hepatitis B virus strain FMU016 complete genome 1596.................t..161595
AY206390.1 Hepatitis B virus strain FMU019 complete genome 1658.................t..167795
AY206391.1 Hepatitis B virus strain FMU020 complete genome 1658.................t..167795
AY220697.1 Hepatitis B virus strain GYF634, complete genome 1658.................t..167795
AY220698.1 Hepatitis B virus strain 536207, complete genome 1658.................t..167795
AY220703.1 Hepatitis B virus strain WZJ319, complete genome 1658.................t..167795
AY220704.1 Hepatitis B virus strain WZJ942, complete genome 1658.................t..167795
AY306136.1 Hepatitis B virus isolate H85, complete genome 1656..................c.167595
AY233274.1 Hepatitis B virus isolate 0962 complete genome 1656..................c.167595
AY233275.1 Hepatitis B virus isolate 163 complete genome 1656..................c.167595
AY233276.1 Hepatitis B virus isolate 1839 complete genome 1656..................c.167595
AY233277.1 Hepatitis B virus isolate 1848 complete genome 1656..................c.167595
AY233278.1 Hepatitis B virus isolate 1 complete genome 1656..................c.167595
AY233279.1 Hepatitis B virus isolate 28 complete genome 1656..................c.167595
AY233280.1 Hepatitis B virus isolate 2 complete genome 1656..................c.167595
AY233281.1 Hepatitis B virus isolate 303 complete genome 1656..................c.167595
AY233282.1 Hepatitis B virus isolate 306 complete genome 1656..................c.167595
AY233283.1 Hepatitis B virus isolate 4038 complete genome 1656..................c.167595
AY233284.1 Hepatitis B virus isolate 5283 complete genome 1656..................c.167595
AY233285.1 Hepatitis B virus isolate 795 complete genome 1656..................c.167595
AY233287.1 Hepatitis B virus isolate 8225 complete genome 1656..................c.167595
AY233288.1 Hepatitis B virus isolate 823 complete genome 1656..................c.167595
AY233289.1 Hepatitis B virus isolate 833 complete genome 1656..................c.167595
AY167089.1 Hepatitis B virus isolate Ia, complete genome 1656.................t..167595
AY167091.1 Hepatitis B virus isolate Ic, complete genome 1671...c................169095
AY167094.1 Hepatitis B virus isolate IIb, complete genome 1656.................t..167595
AY167097.1 Hepatitis B virus isolate IIIb, complete genome 1656.................t..167595
AY167101.1 Hepatitis B virus isolate Vb, complete genome 1656.................t..167595
AY167102.1 Hepatitis B virus isolate Vc, complete genome 1656.................t..167595
AY330911.1 Hepatitis B virus isolate Louisa complete genome 1656.................t..167595
AY330912.1 Hepatitis B virus isolate Osang complete genome 1656.................t..167595
AY330915.1 Hepatitis B virus isolate Happy complete genome 1656.................g..167595
AY330916.1 Hepatitis B virus isolate Tbblack complete genome 1656.................t..167595
AB115551.1 Hepatitis B virus DNA, complete genome, isolate:HBV-CB15 1656.................t..167595
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 1656..................c.167595
AY373430.1 Hepatitis B virus clone SWT.3 complete genome 1656..c.................167595
AB106884.1 Hepatitis B virus DNA, complete genome, strain:HBV-Ya14 1656.................t..167595
AB106885.1 Hepatitis B virus DNA, complete genome, strain:HBV-YA34 1656.................t..167595
AY311369.1 Hepatitis B virus isolate BD4139, complete genome 1656.................t..167595
AY311370.1 Hepatitis B virus isolate BD14999, complete genome 1656.................t..167595
AY293309.1 Hepatitis B virus strain Whutj-37, complete genome 283.................t..30295
AY236160.1 Hepatitis B virus isolate 1A, complete genome 3018.........a..........303795
AY236161.1 Hepatitis B virus isolate 12A, complete genome 3018..................c.303795
AY236164.1 Hepatitis B virus isolate 30, complete genome 3018.........a..........303795
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 1656..................c.167595
AB111115.1 Hepatitis B virus DNA, complete genome, clone: K5-0 1595.................t..161495
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 1595.................t..161495
AB111117.1 Hepatitis B virus DNA, complete genome, clone: K5-13 1608.................t..162795
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 1656..................c.167595
AB111123.1 Hepatitis B virus DNA, complete genome, clone: KM4-12 1656..................c.167595
AB115418.1 Hepatitis B virus DNA, complete genome, with deletion in Pre-S2 1611...c................163095
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 1647..................c.166695
AB112472.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH124 1656...........g........167595
AY518556.1 Hepatitis B virus isolate 57-1 subtype adw, complete genome 1656.................t..167595
AB117759.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB14 1656.................t..167595
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 1656..................c.167595
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 1656..................c.167595
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 1656..................c.167595
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 1656..................c.167595
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 1656..................c.167595
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 1656..................c.167595
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 1656..................c.167595
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 1656..................c.167595
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 1656..................c.167595
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 1656..................c.167595
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 1656..................c.167595
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 1656..................c.167595
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 1656..................c.167595
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 1656..................c.167595
AB116549.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM5 1656.................t..167595
AB116550.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM6 1656.................t..167595
AB116551.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ2 1656.................t..167595
AY596102.1 Hepatitis B virus isolate Ia-1, complete genome 1656.................t..167595
AY596103.1 Hepatitis B virus isolate Ia-2, complete genome 1656.................t..167595
AY596104.1 Hepatitis B virus isolate Ia-4, complete genome 1656.................t..167595
AY596106.1 Hepatitis B virus isolate Ia-6, complete genome 1656.................t..167595
AY596109.1 Hepatitis B virus isolate II-1, complete genome 1656.................t..167595
AY596110.1 Hepatitis B virus isolate II-2, complete genome 1656.................t..167595
AY596111.1 Hepatitis B virus isolate Ia-3, complete genome 1656.................t..167595
AY596112.1 Hepatitis B virus isolate Ia-7, complete genome 1656.................t..167595
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 1658..................c.167795
AY741794.1 Hepatitis B virus isolate IR-IPI-50, complete genome 1658.........a..........167795
AY741795.1 Hepatitis B virus isolate IR-IPI-Hi, complete genome 1658.........a..........167795
AY741796.1 Hepatitis B virus isolate IR-IPI-P3, complete genome 1658.........a..........167795
AY766463.1 Hepatitis B virus strain GDH1 from China, complete genome 1656.................t..167595
AY781177.1 Hepatitis B virus strain BG21, complete genome 1656.................t..167595
AY781178.1 Hepatitis B virus strain G12, complete genome 1656.................t..167595
AY781179.1 Hepatitis B virus strain GIII_14, complete genome 1656.................t..167595
AY781180.1 Hepatitis B virus strain GIII_15, complete genome 1656.................t..167595
AY781181.1 Hepatitis B virus strain GIII_16, complete genome 1656.................t..167595
AY781182.1 Hepatitis B virus strain GIII_17, complete genome 1656.................t..167595
AY781183.1 Hepatitis B virus strain GII_11, complete genome 1656.................t..167595
AY781184.1 Hepatitis B virus strain GII_8, complete genome 1656.................t..167595
AY781185.1 Hepatitis B virus strain GI_19, complete genome 1656.................t..167595
AY781186.1 Hepatitis B virus strain MGI, complete genome 1656.................t..167595
AY781187.1 Hepatitis B virus strain SG_III, complete genome 1656.................t..167595
AY641563.1 Hepatitis B virus isolate He52, complete genome 1656...c................167595
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 1656..................g.167595
AB198077.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.2 1656..a.................167595
AB198080.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.5 1656..a.................167595
AY738139.1 Hepatitis B virus clone A1, complete genome 1656..................c.167595
AY738140.1 Hepatitis B virus clone A2, complete genome 1656..................c.167595
AY738141.1 Hepatitis B virus clone A3, complete genome 1656..................c.167595
AY738143.1 Hepatitis B virus clone A11, complete genome 1656..................c.167595
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 1656..................c.167595
AB179747.1 Hepatitis B virus (genotype H) genomic DNA, complete genome, isolate:1656.................t..167595
AB205118.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ1-1-2 1656..................c.167595
AB205119.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-1 1656.................t..167595
AB205120.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-2 1656.................t..167595
AB205121.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF720-1 1656.................t..167595
AB205122.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH69-1 1656.................t..167595
AB205123.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CN578-1 1656..a.................167595
AP007263.1 HBV genotype A DNA, complete genome, isolate: HB-JI444AF 1656..................c.167595
AY903452.1 Hepatitis B virus serotype adw2, complete genome 1656..................c.167595
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 1656..................c.167595
AY934765.1 Hepatitis B virus isolate 24306, complete genome 1656..................c.167595
AY934766.1 Hepatitis B virus isolate 24233, complete genome 1656..................c.167595
AY934767.1 Hepatitis B virus isolate 27178, complete genome 1656..................c.167595
AY934768.1 Hepatitis B virus isolate 25830, complete genome 1656..................c.167595
AY934769.1 Hepatitis B virus isolate 23719, complete genome 1656..................c.167595
AY934770.1 Hepatitis B virus isolate 953642, complete genome 1656..................c.167595
AY934771.1 Hepatitis B virus isolate 27439, complete genome 1656..................c.167595
AY934772.1 Hepatitis B virus isolate 1908, complete genome 1656..................c.167595
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 1656..................c.167595
DQ020002.1 Hepatitis B virus isolate 380, complete genome 1656..................c.167595
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 1656..................c.167595
AB212625.1 Hepatitis B virus DNA, complete genome, isolateVT1026 1656.................t..167595
AB212626.1 Hepatitis B virus DNA, complete genome, isolateVT1022 1656.................t..167595
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 1656..................c.167595
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 1656..................c.167595
AB194952.1 Hepatitis B virus DNA, complete genome, isolate: CMR711 1656..................c.167595
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 1656..................c.167595
DQ089780.1 Hepatitis B virus isolate HK947, complete genome 1656..a.................167595
DQ089781.1 Hepatitis B virus isolate HK1476, complete genome 1656...c................167595
DQ089787.1 Hepatitis B virus isolate HK352, complete genome 1656.............t......167595
DQ089797.1 Hepatitis B virus isolate HK1169, complete genome 1656......g.............167595
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 1656..................c.167595
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 1656..................c.167595
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 1617..................c.163695
DQ089801.1 Hepatitis B virus isolate HK2100, complete genome 1656...c................167595
DQ089802.1 Hepatitis B virus isolate HK1371, complete genome 1656...c................167595
AY862862.1 Hepatitis B virus clone Q20, complete genome 1656...c................167595
AY862863.1 Hepatitis B virus clone Q23, complete genome 1656...c................167595
AY862867.1 Hepatitis B virus clone Q42, complete genome 1656..................c.167595
AY862868.1 Hepatitis B virus clone Q43, complete genome 1656..................c.167595
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 1656...c................167595
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 1002___...........g..t._101770
AB231909.1 Hepatitis B virus DNA, complete genome, isolate:VH10 1656...c................167595
AB231909.1 Hepatitis B virus DNA, complete genome, isolate:VH10 1002___...........g..t._101770
AB205010.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IM806-2 1656.................t..167595
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 3057..................c.307695
DQ298162.1 Hepatitis B virus isolate LT3.12AM clone 2, complete genome 3057..................c.307695
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 3057..................c.307695
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 3057..................c.307695
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 3057..................c.307695
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 1635...........c........165495
DQ377158.1 Hepatitis B virus isolate WJT31, complete genome 1656.................t..167595
AJ627222.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 31228 1656...c................167595
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 1656..................c.167595
AJ627228.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 34408 1644..................c.166395
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 1656..................c.167595
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 1656..................c.167595
AB219428.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4076, PNN3 1656.................t..167595
AB219430.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4148, PNN5 1656..................c.167595
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 1656..................c.167595
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 1656..................c.167595
DQ448619.1 Hepatitis B virus isolate GZ-DYH, complete genome 1656.................t..167595
DQ448620.1 Hepatitis B virus isolate GZ-DYF, complete genome 1656.................t..167595
DQ448622.1 Hepatitis B virus isolate GZ-JSM, complete genome 1656.................t..167595
DQ448623.1 Hepatitis B virus isolate GZ-LMX, complete genome 1656.................t..167595
DQ448624.1 Hepatitis B virus isolate GZ-QSA, complete genome 1656.................t..167595
DQ448625.1 Hepatitis B virus isolate GZ-TXB, complete genome 1656.................t..167595
DQ448626.1 Hepatitis B virus isolate GZ-XLB, complete genome 1656.................t..167595
DQ448627.1 Hepatitis B virus isolate GZ-ZFL, complete genome 1656.................t..167595
DQ448628.1 Hepatitis B virus isolate GZ-ZX, complete genome 1656.................t..167595
DQ463787.1 Hepatitis B virus isolate 928-9_1979, complete genome 1656.................t..167595
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 1656.................t..167595
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 1656.................t..167595
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 1656.................t..167595
DQ463791.1 Hepatitis B virus isolate 539-16_1979, complete genome 1656.................t..167595
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 1656.................t..167595
DQ463793.1 Hepatitis B virus isolate 462-4_1979, complete genome 1656.................t..167595
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 1656.................t..167595
DQ463795.1 Hepatitis B virus isolate 928-9_2004, complete genome 1656.................t..167595
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 1656.................t..167595
DQ463797.1 Hepatitis B virus isolate 650-15_2004, complete genome 1656.................t..167595
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 1656.................t..167595
DQ463799.1 Hepatitis B virus isolate 539-16_2004, complete genome 1656.................t..167595
DQ463800.1 Hepatitis B virus isolate 524-3_2004, complete genome 1656.................t..167595
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 1656.................t..167595
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 1656.................t..167595
AM180624.1 Hepatitis B virus complete genome, isolate CAE168 1656..................c.167595
DQ478887.1 Hepatitis B virus isolate CHN-QH8, complete genome 1656...c................167595
DQ478889.1 Hepatitis B virus isolate CHN-QH14, complete genome 1656.........a..........167595
DQ486021.1 Hepatitis B virus isolate LT13, complete genome 3018.........a..........303795
DQ486022.1 Hepatitis B virus isolate LT11, complete genome 3018.........a..........303795
AB241115.1 Hepatitis B virus DNA, complete genome, isolate:PhCH09 1656..................c.167595
AM282986.1 Hepatitis B virus (SUBTYPE ADW2), genotype A, complete genome 1656..................c.167595
AB246317.1 Hepatitis B virus DNA, complete genome, isolate: TA112 1620..................c.163995
DQ788835.1 Hepatitis B virus splice variant AP12, complete genome 1171..................c.119095
DQ788725.1 Hepatitis B virus clone S1, complete genome 1656..................c.167595
DQ788726.1 Hepatitis B virus clone S15, complete genome 1650..................c.166995
DQ788727.1 Hepatitis B virus clone S18, complete genome 1650..................c.166995
DQ788728.1 Hepatitis B virus clone S24, complete genome 1650..................c.166995
DQ788729.1 Hepatitis B virus clone L1, complete genome 1650..................c.166995
AM184125.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate O64 1656..................c.167595
AM184126.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate N35 1656..................c.167595
DQ904357.1 Hepatitis B virus strain A0004 from China, complete genome 1658.................t..167795
DQ922649.1 Hepatitis B virus strain B0024, complete genome 1658..................a.167795
DQ922650.1 Hepatitis B virus strain C0955, complete genome 1658..................g.167795
DQ922651.1 Hepatitis B virus strain F0691, complete genome 1658..................g.167795
DQ975271.1 Hepatitis B virus strain B0641, complete genome 1658.................t..167795
DQ975272.1 Hepatitis B virus strain C1248, complete genome 1658..................c.167795
DQ975273.1 Hepatitis B virus strain e1013, complete genome 1658..................c.167795
DQ975274.1 Hepatitis B virus strain F0885, complete genome 1658..................c.167795
AM117394.1 Hepatitis B virus, isolate CHIMP_DJA, complete genome 1655.................t..167495
AM117395.1 Hepatitis B virus, isolate CHIMP_MAK, complete genome 1655.................t..167495
AM117397.1 Hepatitis B virus, isolate CHIMP_ED, complete genome 1655.................t..167495
DQ980547.1 Hepatitis B virus strain E0113, complete genome 1658..................g.167795
DQ980548.1 Hepatitis B virus strain C1198, complete genome 1658.................t..167795
DQ980549.1 Hepatitis B virus strain B0949, complete genome 1625..................g.164495
DQ980550.1 Hepatitis B virus strain B0206, complete genome 1601..................c.162095
DQ980551.1 Hepatitis B virus strain A0712, complete genome 1625..................g.164495
DQ899142.1 Hepatitis B virus isolate Warao152, complete genome 1656.................t..167595
DQ899143.1 Hepatitis B virus isolate Warao189, complete genome 1656.................t..167595
DQ899144.1 Hepatitis B virus isolate Japreira75, complete genome 1656.................t..167595
DQ899145.1 Hepatitis B virus isolate Japreira76, complete genome 1656.................t..167595
DQ899146.1 Hepatitis B virus isolate Japreira80, complete genome 1656.................t..167595
DQ899147.1 Hepatitis B virus isolate Japreira116, complete genome 1656.................t..167595
DQ899148.1 Hepatitis B virus isolate Yanomami114, complete genome 1656.................t..167595
DQ899149.1 Hepatitis B virus isolate Piaroa3019, complete genome 1656.................t..167595
DQ899150.1 Hepatitis B virus isolate Colombia8, complete genome 1656.................t..167595
AB246336.1 Hepatitis B virus DNA, complete genome, clone: Aa_SAF 1656..................c.167595
AB246337.1 Hepatitis B virus DNA, complete genome, clone: Ae_US 1656..................c.167595
AB246338.1 Hepatitis B virus DNA, complete genome, clone: Ae_JPN 1656..................c.167595
AB246340.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN58 1656.................t..167595
AB246341.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN35 1656.................t..167595
AB246342.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN56 1656.................t..167595
AB246343.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN57 1656.................t..167595
DQ995801.1 Hepatitis B virus isolate H60-6, complete genome 1656.................t..167595
DQ995802.1 Hepatitis B virus isolate H293-16, complete genome 1656.................t..167595
DQ995804.1 Hepatitis B virus isolate C1691-11, complete genome 1656.................t..167595
DQ995805.1 Hepatitis B virus isolate H60-2.5KB, complete genome 1603.................t..162295
EF157291.1 Hepatitis B virus isolate B3586-YKH94, complete genome 1656.................t..167595
EF134945.1 Hepatitis B virus isolate G247-B3, complete genome 3051.................t..307095
EF134946.1 Hepatitis B virus isolate G247-B5, complete genome 3051.................t..307095
AM421531.1 Hepatitis B virus partial core gene, isolate MMA-3 46.........a..........6595
AM421532.1 Hepatitis B virus partial core gene, isolate MMA-4 46.........a..........6595
AM421543.1 Hepatitis B virus partial core gene, isolate MMA-15 46.........a..........6595
AB275308.1 Hepatitis B virus DNA, complete genome, genotype: H 1656.................t..167595
EF208113.1 Hepatitis B virus clone B-S3, complete genome 1656..................c.167595
EF208114.1 Hepatitis B virus clone B-S7, complete genome 1656..................c.167595
EF208115.1 Hepatitis B virus clone B-S8, complete genome 1656..................c.167595
AB270536.1 Hepatitis B virus DNA, complete genome, isolate: MGL226F 1655..................c.167495
AB270537.1 Hepatitis B virus DNA, complete genome, isolate: MGL22F 1656...........c........167595
AB270545.1 Hepatitis B virus DNA, complete genome, isolate: MGL108F 1656.................t..167595
AB270546.1 Hepatitis B virus DNA, complete genome, isolate: MGL88F 1656.................t..167595
EF103278.1 Hepatitis B virus isolate Ran60, complete genome 1656..................c.167595
AB266536.1 Hepatitis B virus DNA, complete genome, isolate: HB-JAIW05 1656.................t..167595
AB298362.1 HBV genotype H DNA, complete genome, isolate: HBV ST0404 1656.................t..167595
AB274983.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB85 1656.....a..............167595
AB274985.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB145 1650...c................166995
AM295795.1 Hepatitis B virus complete genome, clone LB1Clone5 1656..................c.167595
AM295796.1 Hepatitis B virus complete genome, clone LB1Clone10 1656..................c.167595
AM295797.1 Hepatitis B virus complete genome, clone LB2Clone6 1656..................c.167595
AM295798.1 Hepatitis B virus complete genome, clone LB3Clone1 1656..................c.167595
AM295799.1 Hepatitis B virus complete genome, clone LB3Clone5 1656..................c.167595
AM295800.2 Hepatitis B virus complete genome, clone LB3Clone11 1657..................c.167695
EF137802.1 Hepatitis B virus strain JH4-1896-G, complete genome 1656...c................167595
EF137803.1 Hepatitis B virus strain JH4-1896-A, complete genome 1656...c................167595
AB195931.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-2 1656..................c.167595
AB195932.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-3 1656..................c.167595
AB195933.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-1 1656.................t..167595
AB195934.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-2 1656.................t..167595
AB195935.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-3 1656.................t..167595
AB195939.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-1 1656..................c.167595
AB195940.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-2 1656..................c.167595
AB195941.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-3 1656..................c.167595
DQ993680.1 Hepatitis B virus isolate patient 268, complete genome 1656.................t..167595
DQ993681.1 Hepatitis B virus isolate patient 290, complete genome 1656.................t..167595
DQ993682.1 Hepatitis B virus isolate patient 479, complete genome 1656.................t..167595
DQ993683.1 Hepatitis B virus isolate patient 82, complete genome 1656.................t..167595
DQ993684.1 Hepatitis B virus isolate patient 336, complete genome 1656.................t..167595
DQ993685.1 Hepatitis B virus isolate patient 554, complete genome 1656.................t..167595
DQ993686.1 Hepatitis B virus isolate patient 342, complete genome 1656.................t..167595
DQ993687.1 Hepatitis B virus isolate patient 700, complete genome 1656.................t..167595
DQ993694.1 Hepatitis B virus isolate patient 234, complete genome 1656.................t..167595
DQ993695.1 Hepatitis B virus isolate patient 373, complete genome 1657.................t..167695
DQ993696.1 Hepatitis B virus isolate patient 452b1, complete genome 1656.................t..167595
DQ993698.1 Hepatitis B virus isolate 6144-0327-ETCvs3TC-Naive, complete genome 1656.................t..167595
DQ993699.1 Hepatitis B virus isolate 6144-0226-ETCvs3TC-Break, complete genome 1656.................t..167595
DQ993700.1 Hepatitis B virus isolate JMY-0725-ETC, complete genome 1656.................t..167595
DQ993701.1 Hepatitis B virus isolate JMY-0210-ETCvs3TC-Brack, complete genome 1656.................t..167595
DQ993702.1 Hepatitis B virus isolate JMY-0919-ETCvs3TC-Naive, complete genome 1656.................t..167595
DQ993708.1 Hepatitis B virus isolate 6136-1228-Naive, complete genome 1656.................t..167595
DQ993709.1 Hepatitis B virus isolate 6136-0127-ETCvs3TC-Break, complete genome 1656.................t..167595
DQ993710.1 Hepatitis B virus isolate 6144-0718-ETC, complete genome 1656.................t..167595
DQ993711.1 Hepatitis B virus isolate 221-1120-Nature1.1-unSero, complete genome 1656.................t..167595
EF473973.1 Hepatitis B virus isolate EIH45AChinese, complete genome 1656.................t..167595
EF473974.1 Hepatitis B virus isolate EIH21AChinese, complete genome 1656.................t..167595
EF473975.1 Hepatitis B virus isolate 2061Chinese, complete genome 1656.................t..167595
EF473977.1 Hepatitis B virus isolate KD048East, complete genome 1656.................t..167595
EU086721.1 Hepatitis B virus isolate HRO/w4601-2002, complete genome 1656..................c.167595
EF494377.1 Hepatitis B virus isolate TW1138 genotype C, complete genome 1623...c................164295
EF494378.1 Hepatitis B virus isolate TW1244 genotype C, complete genome 1656..................c.167595
EF494380.1 Hepatitis B virus isolate TW836 genotype B, complete genome 1656.................t..167595
EF494381.1 Hepatitis B virus isolate TW936 genotype B, complete genome 1656.................t..167595
EU139543.1 Hepatitis B virus strain NDJ, complete genome 1656.................t..167595
AB300364.1 Hepatitis B virus DNA, complete genome, isolate: patient6 1656.................t..167595
AB300365.1 Hepatitis B virus DNA, complete genome, isolate: patient7 1656..................g.167595
AB300367.1 Hepatitis B virus DNA, complete genome, isolate: patient9 1656..................c.167595
AB300370.1 Hepatitis B virus DNA, complete genome, isolate: patient12 1599.................t..161895
AB300371.1 Hepatitis B virus DNA, complete genome, isolate: patient13 1668.................t..168795
AB300373.1 Hepatitis B virus DNA, complete genome, isolate: patient15 1632..................c.165195
EF473971.1 Hepatitis B virus isolate 2059Java, complete genome 1656.................t..167595
EF473972.1 Hepatitis B virus isolate 1839Java, complete genome 1656.................t..167595
EF473976.1 Hepatitis B virus isolate Alr049East, complete genome 1656.................t..167595
AB368295.1 Hepatitis B virus DNA, complete genome, Genotype B, Subgenotype B4, c1656.................t..167595
AB368297.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c1656...c................167595
EU239218.1 Hepatitis B virus isolate BD2, complete genome 1656.....a..............167595
EU239224.1 Hepatitis B virus isolate BD1, complete genome 1656..................g.167595
AB287314.1 Hepatitis B virus DNA, complete genome, isolate: Alaska433 1656.................t..167595
AB287315.1 Hepatitis B virus DNA, complete genome, isolate: Alaska419 1656.................t..167595
AB287316.1 Hepatitis B virus DNA, complete genome, isolate: Alaska427 1656.................t..167595
AB287317.1 Hepatitis B virus DNA, complete genome, isolate: Alaska416 1656.................t..167595
AB287318.1 Hepatitis B virus DNA, complete genome, isolate: Alaska2 1656.................t..167595
AB287319.1 Hepatitis B virus DNA, complete genome, isolate: AlaskaG23 1656.................t..167595
AB287320.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-1 1656.................t..167595
AB287321.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-2 1656.................t..167595
AB287322.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-3 1656.................t..167595
AB287324.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-5 1656.................t..167595
AB287325.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-6 1656.................t..167595
AB287326.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A44 1656.................t..167595
AB287327.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A53 1656.................t..167595
AB287329.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba A55 1656.................t..167595
D00220.2HPBVCG Hepatitis B virus DNA, complete genome, strain: LSH 1656.................t..167595
AB330371.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ23H1656..................c.167595
AB330372.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ22H1656..................c.167595
EU185780.1 Hepatitis B virus isolate H-IDU7 (Rec.Arg-1) D3/A2 recombinant, compl1656........c...........167595
EU185786.1 Hepatitis B virus isolate S-IDU11, complete genome 1656..................c.167595
EU185787.1 Hepatitis B virus isolate S-IDU4, complete genome 1656..................c.167595
EU185788.1 Hepatitis B virus isolate S-IDU19, complete genome 1656..................c.167595
EU185789.1 Hepatitis B virus isolate S-IDU8, complete genome 1656..................c.167595
EU158263.1 Hepatitis B virus isolate G108, complete genome 1656.................t..167595
EU305540.1 Hepatitis B virus isolate G67-123, complete genome 1656..........c.........167595
EU305543.1 Hepatitis B virus isolate L15-57, complete genome 1657.................t..167695
EU305544.1 Hepatitis B virus isolate L15-129, complete genome 1657.................t..167695
EU305545.1 Hepatitis B virus isolate L15-196, complete genome 1656.................t..167595
EU305547.1 Hepatitis B virus isolate M118-481, complete genome 1656.................t..167595
EU305548.1 Hepatitis B virus isolate M118-673, complete genome 1656.................t..167595
AM494695.1 Hepatitis B virus complete genome, isolate CAR053 1656...c................167595
AM494701.1 Hepatitis B virus complete genome, isolate CAR097 1656.................t..167595
AM494707.1 Hepatitis B virus complete genome, isolate CAR137 1656.................t..167595
AM494718.1 Hepatitis B virus complete genome, isolate CAR204 1656..................c.167595
EU306670.1 Hepatitis B virus clone 110-33, complete genome 1630.................t..164995
EU306677.1 Hepatitis B virus clone 220-14, complete genome 1656.................t..167595
EU306678.1 Hepatitis B virus clone 220-36, complete genome 1656.................t..167595
EU306679.1 Hepatitis B virus clone 220-26, complete genome 1656.................t..167595
EU306680.1 Hepatitis B virus clone 220-27, complete genome 1656.................t..167595
EU306681.1 Hepatitis B virus clone 220-44, complete genome 1656.................t..167595
EU306682.1 Hepatitis B virus clone 220-8, complete genome 1656.................t..167595
EU306683.1 Hepatitis B virus clone 220-30, complete genome 1656.................t..167595
EU306684.1 Hepatitis B virus clone 220-43, complete genome 1656.................t..167595
EU306684.1 Hepatitis B virus clone 220-43, complete genome 1687.................t..170695
EU306695.1 Hepatitis B virus clone 712-64, complete genome 1656.................t..167595
EU306696.1 Hepatitis B virus clone 712-47, complete genome 1656.................t..167595
EU306697.1 Hepatitis B virus clone 712-99, complete genome 1656.................t..167595
EU306698.1 Hepatitis B virus clone 712-105, complete genome 1656.................t..167595
EU306699.1 Hepatitis B virus clone 807-13, complete genome 1656.................t..167595
EU306700.1 Hepatitis B virus clone 221-2, complete genome 1656.................t..167595
EU306701.1 Hepatitis B virus clone 221-10, complete genome 1656.................t..167595
EU306702.1 Hepatitis B virus clone 221-11, complete genome 1656.................t..167595
EU306703.1 Hepatitis B virus clone 221-13, complete genome 1656.................t..167595
EU306704.1 Hepatitis B virus clone 221-29, complete genome 1656.................t..167595
EU306705.1 Hepatitis B virus clone 221-31, complete genome 1656.................t..167595
EU306706.1 Hepatitis B virus clone 221-33, complete genome 1656.................t..167595
EU306707.1 Hepatitis B virus clone 221-36, complete genome 1656.................t..167595
EU306708.1 Hepatitis B virus clone 221-37, complete genome 1656.................t..167595
EU306709.1 Hepatitis B virus clone 221-42, complete genome 1656.................t..167595
EU306710.1 Hepatitis B virus clone 221-14, complete genome 1656.................t..167595
EU306711.1 Hepatitis B virus clone 221-50, complete genome 1656.................t..167595
EU306712.1 Hepatitis B virus clone 221-15, complete genome 1656.................t..167595
EU350409.1 Hepatitis B virus isolate BTO5856, complete genome 1656.................t..167595
AB353764.1 Hepatitis B virus DNA, complete genome, isolate: HBDI03 1656.................t..167595
EU439015.1 Hepatitis B virus clone zgh-26 from China, complete genome 1656..................g.167595
EU439016.1 Hepatitis B virus clone zgh-9 from China, complete genome 1656..................g.167595
EU439019.1 Hepatitis B virus clone dzc-6 from China, complete genome 1656.................t..167595
EU439020.1 Hepatitis B virus clone dzc-12 from China, complete genome 1656.................t..167595
EU439021.1 Hepatitis B virus clone dzc-14 from China, complete genome 1656.................t..167595
EU439022.1 Hepatitis B virus clone dzc-19 from China, complete genome 1656.................t..167595
EU439023.1 Hepatitis B virus clone dzc-22 from China, complete genome 1656.................t..167595
EU439024.1 Hepatitis B virus clone 220-42 from China, complete genome 1656.................t..167595
EU439024.1 Hepatitis B virus clone 220-42 from China, complete genome 1687.................t..170695
AB365445.1 Hepatitis B virus DNA, complete genome, isolate: BOL1 1656.................t..167595
AB365452.1 Hepatitis B virus DNA, complete genome, isolate: BOL577 1656..................c.167595
AM410963.1 Hepatitis B virus complete genome, clone LB3Clone24 1656..................c.167595
EU547560.1 Hepatitis B virus isolate MC03, complete genome 1656.........a..........167595
EU570069.1 Hepatitis B virus isolate 1-B24, complete genome 1656.................t..167595
EU570070.1 Hepatitis B virus isolate 2-B24, complete genome 1656.................t..167595
EU570071.1 Hepatitis B virus isolate 4-B24, complete genome 1656.................t..167595
EU570075.1 Hepatitis B virus isolate 11-S142, complete genome 1656.................t..167595
EU579441.1 Hepatitis B virus isolate 12 genotype B, complete genome 1656.................t..167595
EU595030.1 Hepatitis B virus isolate 6, complete genome 1656.................t..167595
EU595031.1 Hepatitis B virus isolate 7, complete genome 1656.................t..167595
EU589335.1 Hepatitis B virus isolate S142-5, complete genome 1656.................t..167595
EU589337.1 Hepatitis B virus isolate S710-2, complete genome 1650..................c.166995
EU589345.1 Hepatitis B virus isolate S624-2, complete genome 1641..................c.166095
AB302942.1 Hepatitis B virus DNA, complte genome, isolate: GRE3837NN 1656.................t..167595
AB302943.1 Hepatitis B virus DNA, complte genome, isolate: GRE3639NN 1656.................t..167595
AB302944.1 Hepatitis B virus DNA, complte genome, isolate: GRE3641NN 1656.................t..167595
AB302945.1 Hepatitis B virus DNA, complte genome, isolate: GRE3643NN 1656.................t..167595
EU487256.1 Hepatitis B virus isolate patient12, complete genome 1656.................t..167595
EU487257.1 Hepatitis B virus isolate patient14, complete genome 1656.................t..167595
EU414133.1 Hepatitis B virus strain 28058, complete genome 1656..................c.167595
EU414137.1 Hepatitis B virus strain 28059, complete genome 1656.....a..............167595
EU747320.1 Hepatitis B virus isolate V51, complete genome 1656..................c.167595
EU717212.1 Hepatitis B virus isolate D26K-7, complete genome 1658..................c.167795
AB375159.1 Hepatitis B virus DNA, complete genome, strain: MEX8-H 1656.................t..167595
AB375160.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-H 1656.................t..167595
AB375162.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-H 1656.................t..167595
AB375164.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-H 1656.................t..167595
EU796068.1 Hepatitis B virus strain 3831, complete genome 1656.................t..167595
EU796070.1 Hepatitis B virus strain 4460, complete genome 1656...g................167595
EU796072.1 Hepatitis B virus strain 5131, complete genome 1656...g................167595
EU871969.1 Hepatitis B virus isolate 6-024-1, complete genome 1656..................a.167595
EU871970.1 Hepatitis B virus isolate 6-024-3, complete genome 1656..................c.167595
EU871971.1 Hepatitis B virus isolate 6-024-5, complete genome 1656..................c.167595
EU871972.1 Hepatitis B virus isolate 6-024-8, complete genome 1656..................c.167595
EU871973.1 Hepatitis B virus isolate 6-024-99-5, complete genome 1656..................c.167595
EU871974.1 Hepatitis B virus isolate 6-024A-1, complete genome 1656..................c.167595
EU871976.1 Hepatitis B virus isolate 179-04-3, complete genome 1656..................c.167595
EU871980.1 Hepatitis B virus isolate 318-01-5, complete genome 1656..................g.167595
EU871981.1 Hepatitis B virus isolate 318-95-3, complete genome 1656..................a.167595
EU871982.1 Hepatitis B virus isolate 318-96-2, complete genome 1656..................g.167595
EU871983.1 Hepatitis B virus isolate 318-97-2, complete genome 1656..................a.167595
EU871984.1 Hepatitis B virus isolate 490-00-1, complete genome 1656..................a.167595
EU871985.1 Hepatitis B virus isolate 490-00-3, complete genome 1656..................a.167595
EU871986.1 Hepatitis B virus isolate 490-1, complete genome 1656..................a.167595
EU871987.1 Hepatitis B virus isolate 490-01-1, complete genome 1656..................c.167595
EU871988.1 Hepatitis B virus isolate 490-01-3, complete genome 1656..................c.167595
EU871989.1 Hepatitis B virus isolate 490-03-3, complete genome 1656..................a.167595
EU871990.1 Hepatitis B virus isolate 490-04-1, complete genome 1656..................c.167595
EU871991.1 Hepatitis B virus isolate 490-04-3, complete genome 1656..................a.167595
EU871992.1 Hepatitis B virus isolate 490-99-1, complete genome 1656..................a.167595
EU871993.1 Hepatitis B virus isolate 490-99-2, complete genome 1656..................a.167595
EU871994.1 Hepatitis B virus isolate 490A-3, complete genome 1656..................c.167595
EU871995.1 Hepatitis B virus isolate 490A-4, complete genome 1656..................a.167595
EU871996.1 Hepatitis B virus isolate 490A-6, complete genome 1656..................a.167595
EU871998.1 Hepatitis B virus isolate 530-00-5, complete genome 1656..................g.167595
EU871999.1 Hepatitis B virus isolate 530-00-7, complete genome 1656..................a.167595
EU872006.1 Hepatitis B virus isolate 318-92-1, complete genome 1656..................g.167595
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 1641..................g.166095
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 1670..................g.168995
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 1641..................g.166095
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 1670..................g.168995
EU872012.1 Hepatitis B virus isolate 318-99-5, complete genome 1656..................g.167595
EU872013.1 Hepatitis B virus isolate 318-99-6, complete genome 1641..................g.166095
EU872014.1 Hepatitis B virus isolate 490-96-3, complete genome 1601..................a.162095
EU872015.1 Hepatitis B virus isolate 490-96-1, complete genome 1601..................a.162095
EU872016.1 Hepatitis B virus isolate 490A-1, complete genome 1656..................a.167595
EU872017.1 Hepatitis B virus isolate 530-00-6, complete genome 1656..................g.167595
EU594383.1 Hepatitis B virus strain 2000-00, complete genome 1656..................c.167595
EU594384.1 Hepatitis B virus strain 1906-99, complete genome 1656..................c.167595
EU594385.1 Hepatitis B virus strain 1898-98, complete genome 1656..................c.167595
EU594386.1 Hepatitis B virus strain 644-00, complete genome 1656..................c.167595
EU594387.1 Hepatitis B virus strain 3784-91, complete genome 1656..................c.167595
EU594388.1 Hepatitis B virus strain 3782-91, complete genome 1656..................c.167595
EU594389.1 Hepatitis B virus strain 4435-97, complete genome 1656..................c.167595
EU594390.1 Hepatitis B virus strain 4625-97, complete genome 1656..................c.167595
EU594391.1 Hepatitis B virus strain 4620-97, complete genome 1656..................c.167595
EU594392.1 Hepatitis B virus strain 4600-97, complete genome 1656..................c.167595
EU594393.1 Hepatitis B virus strain 4590-97, complete genome 1656..................c.167595
EU594394.1 Hepatitis B virus strain 4512-97, complete genome 1656..................c.167595
EU594395.1 Hepatitis B virus strain 4509-97, complete genome 1656..................c.167595
AB453979.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH1 1656..................c.167595
AB453980.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH2 1656..................c.167595
AB453981.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH3 1656..................c.167595
AB453982.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH4 1656..................c.167595
AB453984.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH6 1656..................c.167595
AB453985.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH7 1656..................c.167595
AB453986.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH8 1656..................c.167595
AB453988.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH10 1656..................c.167595
AB453983.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH5 1656..................c.167595
EU939536.1 Hepatitis B virus isolate C3, complete genome 1656..................c.167595
EU939539.1 Hepatitis B virus isolate C22, complete genome 1656..................c.167595
EU939542.1 Hepatitis B virus isolate C26, complete genome 1656..................c.167595
EU939543.1 Hepatitis B virus isolate C38, complete genome 1656..................g.167595
EU939544.1 Hepatitis B virus isolate C39, complete genome 1656..................g.167595
EU939546.1 Hepatitis B virus isolate C44, complete genome 1656..................g.167595
EU939556.1 Hepatitis B virus isolate C64, complete genome 1647.........a..........166695
EU939559.1 Hepatitis B virus isolate C67, complete genome 1656.................t..167595
EU939563.1 Hepatitis B virus isolate C76, complete genome 1656..................g.167595
EU939564.1 Hepatitis B virus isolate C77, complete genome 1656..................c.167595
EU939569.1 Hepatitis B virus isolate C102, complete genome 1656..................c.167595
EU939570.1 Hepatitis B virus isolate C103, complete genome 1656..................g.167595
EU939574.1 Hepatitis B virus isolate C109, complete genome 1628..................g.164795
EU939575.1 Hepatitis B virus isolate C113, complete genome 1652..................g.167195
EU939576.1 Hepatitis B virus isolate C115, complete genome 1626..................g.164595
EU939582.1 Hepatitis B virus isolate B25, complete genome 1656..................c.167595
EU939590.1 Hepatitis B virus isolate C127, complete genome 1656..................g.167595
EU939591.1 Hepatitis B virus isolate C131, complete genome 1656..................g.167595
EU939592.1 Hepatitis B virus isolate C141, complete genome 1656..................c.167595
EU939594.1 Hepatitis B virus isolate C146, complete genome 1656..................c.167595
EU939596.1 Hepatitis B virus isolate C149, complete genome 1656..................g.167595
EU939599.1 Hepatitis B virus isolate C172, complete genome 1653..................c.167295
EU939604.1 Hepatitis B virus isolate C192, complete genome 1656..................g.167595
EU939605.1 Hepatitis B virus isolate C200, complete genome 1656..................c.167595
EU939611.1 Hepatitis B virus isolate C212, complete genome 1656..................g.167595
EU939614.1 Hepatitis B virus isolate C217, complete genome 1656..................c.167595
EU939621.1 Hepatitis B virus isolate C94, complete genome 1656..................g.167595
EU939622.1 Hepatitis B virus isolate C124, complete genome 1656..................c.167595
EU939624.1 Hepatitis B virus isolate C138, complete genome 1620...c................163995
EU939628.1 Hepatitis B virus isolate C72, complete genome 1649.................t..166895
EU939629.1 Hepatitis B virus isolate C95, complete genome 1656.................g..167595
EU939631.1 Hepatitis B virus isolate C123, complete genome 1656.................t..167595
EU939633.1 Hepatitis B virus isolate C181, complete genome 1656.................t..167595
EU939634.1 Hepatitis B virus isolate C19, complete genome 1656.................t..167595
EU939636.1 Hepatitis B virus isolate C11, complete genome 1656.................g..167595
EU939637.1 Hepatitis B virus isolate C13, complete genome 1656.................t..167595
EU939638.1 Hepatitis B virus isolate C17, complete genome 1656.................t..167595
EU939639.1 Hepatitis B virus isolate C28, complete genome 1656.................t..167595
EU939640.1 Hepatitis B virus isolate C239, complete genome 1656..................c.167595
EU939657.1 Hepatitis B virus isolate D139, complete genome 1656..................c.167595
EU939660.1 Hepatitis B virus isolate C34, complete genome 1629.................t..164895
EU939661.1 Hepatitis B virus isolate C40, complete genome 1656.................t..167595
EU939662.1 Hepatitis B virus isolate C62, complete genome 1656.................t..167595
EU939663.1 Hepatitis B virus isolate C74, complete genome 1656.................t..167595
EU939664.1 Hepatitis B virus isolate C85, complete genome 1656.................g..167595
EU939665.1 Hepatitis B virus isolate C129, complete genome 1656.................t..167595
EU939666.1 Hepatitis B virus isolate C150, complete genome 1656.................t..167595
EU939667.1 Hepatitis B virus isolate C171, complete genome 1656.................t..167595
EU939669.1 Hepatitis B virus isolate C185, complete genome 1656.................t..167595
EU939670.1 Hepatitis B virus isolate C189, complete genome 1656.................t..167595
EU939671.1 Hepatitis B virus isolate C201, complete genome 1656.................t..167595
EU939672.1 Hepatitis B virus isolate C215, complete genome 1656.................t..167595
EU939673.1 Hepatitis B virus isolate C219, complete genome 1656.................g..167595
EU939674.1 Hepatitis B virus isolate C232, complete genome 1656.................t..167595
EU939675.1 Hepatitis B virus isolate C235, complete genome 1656.................t..167595
EU939676.1 Hepatitis B virus isolate D54, complete genome 1656.................t..167595
EU939677.1 Hepatitis B virus isolate D95, complete genome 1656.................t..167595
EU939678.1 Hepatitis B virus isolate D106, complete genome 1656.................t..167595
EU939679.1 Hepatitis B virus isolate D134, complete genome 1656.................t..167595
EU366129.2 Hepatitis B virus isolate BA92, complete genome 1656..................c.167595
AB367393.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 2/Adefovir-1656..................a.167595
AB367405.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 14/Adefovir1608..................c.162795
AB367431.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 40, derived1656...c................167595
FJ151414.1 Hepatitis B virus strain FD18-3, complete genome 1171..................c.119095
AB367802.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 16 1617.................t..163695
FM209512.1 Hepatitis B virus complete genome, isolate G15 1656.................t..167595
FM209513.1 Hepatitis B virus complete genome, isolate G18 1656.................g..167595
FM209516.1 Hepatitis B virus complete genome, isolate G56 1656.................t..167595
FJ032336.1 Hepatitis B virus isolate S462-4 from China, complete genome 1656..................c.167595
FJ032337.1 Hepatitis B virus isolate S462-5 from China, complete genome 1656..................c.167595
FJ032338.1 Hepatitis B virus isolate S462-7 from China, complete genome 1656..................c.167595
FJ032339.1 Hepatitis B virus isolate S462-9 from China, complete genome 1656..................c.167595
FJ032340.1 Hepatitis B virus isolate S529-1 from China, complete genome 1656..................g.167595
FJ032341.1 Hepatitis B virus isolate S529-6 from China, complete genome 1656..................g.167595
FJ032343.1 Hepatitis B virus isolate S659-4 from China, complete genome 1650..................c.166995
FJ032349.1 Hepatitis B virus isolate S734-1 from China, complete genome 1656.................t..167595
FJ032350.1 Hepatitis B virus isolate S943-1 from China, complete genome 1656..................c.167595
FJ032352.1 Hepatitis B virus isolate S1026-3 from China, complete genome 1656.................g..167595
FJ032353.1 Hepatitis B virus isolate S1026-4 from China, complete genome 1656.................g..167595
FJ032354.1 Hepatitis B virus isolate S1026-7 from China, complete genome 1656.................g..167595
FJ032357.1 Hepatitis B virus isolate S1607-8 from China, complete genome 1656.................t..167595
FJ032358.1 Hepatitis B virus isolate S1607-10 from China, complete genome 1656.................t..167595
FJ023659.1 Hepatitis B virus isolate I1_M04-0469, complete genome 1656...c................167595
FJ023660.1 Hepatitis B virus isolate I1_M04-3692, complete genome 1656...c................167595
FJ023660.1 Hepatitis B virus isolate I1_M04-3692, complete genome 1002___...........g..t._101770
FJ023661.1 Hepatitis B virus isolate I1_M05-0592, complete genome 1656...c................167595
FJ023661.1 Hepatitis B virus isolate I1_M05-0592, complete genome 1002___...........g..t._101770
FJ023663.1 Hepatitis B virus isolate I1_M04-3979, complete genome 1656...c................167595
FJ023663.1 Hepatitis B virus isolate I1_M04-3979, complete genome 1002___...........g..t._101770
FJ023631.1 Hepatitis B virus isolate B2_C04-1213 S protein (S) and core protein 1656.................t..167595
FJ023632.1 Hepatitis B virus isolate B4_C04-0254 S protein (S) and core protein 1656.................t..167595
FJ023634.1 Hepatitis B virus isolate B4_C04-1358 S protein (S) and core protein 1656.................t..167595
FJ023635.1 Hepatitis B virus isolate B4_M04-0467 S protein (S) and core protein 1656.................g..167595
FJ023636.1 Hepatitis B virus isolate B4_M04-0876 S protein (S) and core protein 1656.................t..167595
FJ386574.1 Hepatitis B virus isolate 1743, complete genome 1656.................t..167595
FJ386579.1 Hepatitis B virus isolate 1762, complete genome 1656...........c........167595
FJ386582.1 Hepatitis B virus isolate 1765, complete genome 1656.................g..167595
FJ386583.1 Hepatitis B virus isolate 1780, complete genome 1656.................t..167595
FJ386584.1 Hepatitis B virus isolate 1798, complete genome 1656.................t..167595
FJ386589.1 Hepatitis B virus isolate 1830, complete genome 1656.................t..167595
FJ386595.1 Hepatitis B virus isolate 1879, complete genome 1656.................t..167595
FJ386596.1 Hepatitis B virus isolate 1887, complete genome 1656..................c.167595
FJ386597.1 Hepatitis B virus isolate 1888, complete genome 1656..................g.167595
FJ386599.1 Hepatitis B virus isolate 1892, complete genome 1656..................g.167595
FJ386600.1 Hepatitis B virus isolate 1893, complete genome 1656.................t..167595
FJ386603.1 Hepatitis B virus isolate 1949, complete genome 1656..................c.167595
FJ386606.1 Hepatitis B virus isolate 1966, complete genome 1656..................c.167595
FJ386608.1 Hepatitis B virus isolate 1998, complete genome 1656.................t..167595
FJ386610.1 Hepatitis B virus isolate 2000, complete genome 1656.................t..167595
FJ386614.1 Hepatitis B virus isolate 2040, complete genome 1656..................c.167595
FJ386615.1 Hepatitis B virus isolate 2061, complete genome 1656.................t..167595
FJ386618.1 Hepatitis B virus isolate 2111, complete genome 1656.....a..............167595
FJ386619.1 Hepatitis B virus isolate 2119, complete genome 1656.....a..............167595
FJ386620.1 Hepatitis B virus isolate 2121, complete genome 1656..................c.167595
FJ386623.1 Hepatitis B virus isolate 2165, complete genome 1656..................c.167595
FJ386634.1 Hepatitis B virus isolate 2392, complete genome 1656.................t..167595
FJ386636.1 Hepatitis B virus isolate 1813, complete genome 1656.................t..167595
FJ386637.1 Hepatitis B virus isolate 2151, complete genome 1656..................g.167595
FJ386638.1 Hepatitis B virus isolate 2015, complete genome 1656...c................167595
FJ386642.1 Hepatitis B virus isolate 1829, complete genome 1656.................t..167595
FJ386645.1 Hepatitis B virus isolate S897, complete genome 1629..................c.164895
FJ386650.1 Hepatitis B virus isolate 2468, complete genome 1656..a.................167595
FJ386651.1 Hepatitis B virus isolate 2476, complete genome 1656..................g.167595
FJ386653.1 Hepatitis B virus isolate S3, complete genome 1656..................g.167595
FJ386654.1 Hepatitis B virus isolate S51, complete genome 1656.................g..167595
FJ386655.1 Hepatitis B virus isolate S121, complete genome 1656.................t..167595
FJ386656.1 Hepatitis B virus isolate S142, complete genome 1656.................t..167595
FJ386657.1 Hepatitis B virus isolate S165, complete genome 1656..................c.167595
FJ386658.1 Hepatitis B virus isolate S185, complete genome 1656.................t..167595
FJ386660.1 Hepatitis B virus isolate S221, complete genome 1656.................t..167595
FJ386662.1 Hepatitis B virus isolate S269, complete genome 1656...........c........167595
FJ386663.1 Hepatitis B virus isolate S307, complete genome 1656..................c.167595
FJ386666.1 Hepatitis B virus isolate S367, complete genome 1656.................g..167595
FJ386668.1 Hepatitis B virus isolate S395, complete genome 1656.................t..167595
FJ386669.1 Hepatitis B virus isolate S411, complete genome 1656.................t..167595
FJ386675.1 Hepatitis B virus isolate S734, complete genome 1656.................t..167595
FJ386676.1 Hepatitis B virus isolate S1055, complete genome 1656.................t..167595
FJ386680.1 Hepatitis B virus isolate S1244, complete genome 1656.................t..167595
FJ386681.1 Hepatitis B virus isolate S1336, complete genome 1656.................t..167595
FJ386682.1 Hepatitis B virus isolate S1416, complete genome 1656.................t..167595
FJ386683.1 Hepatitis B virus isolate S1450, complete genome 1656.................t..167595
FJ386684.1 Hepatitis B virus isolate S1554, complete genome 1656.................t..167595
FJ386687.1 Hepatitis B virus isolate S1600, complete genome 1656..................c.167595
FJ386688.1 Hepatitis B virus isolate S1632, complete genome 1656.................t..167595
FJ386689.1 Hepatitis B virus isolate S1649, complete genome 1656..................c.167595
FJ518810.1 Hepatitis B virus strain 6898, complete genome 1656...........c........167595
FJ518812.1 Hepatitis B virus strain 6923, complete genome 1656.................t..167595
FJ518813.1 Hepatitis B virus strain 6945, complete genome 1656..................g.167595
FM199974.1 Hepatitis B virus complete genome, strain 45021 1656..................c.167595
FM199976.1 Hepatitis B virus complete genome, strain 45082 1656..................c.167595
FM199977.1 Hepatitis B virus complete genome, strain 45088 1656..................c.167595
FM199979.1 Hepatitis B virus complete genome, strain 49224 1656..................c.167595
FM199980.1 Hepatitis B virus complete genome, strain 49244 1656..................c.167595
FM199981.1 Hepatitis B virus complete genome, strain 49263 1656..................c.167595
FJ361772.1 Hepatitis B virus 146/Thailand, complete genome 1638.........a..........165795
FJ787441.1 Hepatitis B virus isolate S157-9, complete genome 1656...g................167595
FJ787444.1 Hepatitis B virus isolate S208-1, complete genome 1656.................t..167595
FJ787447.1 Hepatitis B virus isolate S461-2, complete genome 1656..................g.167595
FJ787448.1 Hepatitis B virus isolate S461-3, complete genome 1656..................g.167595
FJ787450.1 Hepatitis B virus isolate S627-2, complete genome 1656...c................167595
FJ787451.1 Hepatitis B virus isolate S627-3, complete genome 1656...c................167595
FJ787452.1 Hepatitis B virus isolate S955-2, complete genome 1656..................g.167595
FJ787461.1 Hepatitis B virus isolate S1357-2, complete genome 1656..................c.167595
FJ787462.1 Hepatitis B virus isolate S1357-3, complete genome 1656..................c.167595
FJ787463.1 Hepatitis B virus isolate S1357-6, complete genome 1656..................c.167595
FJ787475.1 Hepatitis B virus isolate CX-2, complete genome 1656.................t..167595
FJ787476.1 Hepatitis B virus isolate CX-3, complete genome 1656.................t..167595
AB493827.1 Hepatitis B virus DNA, complete genome, isolate: 25UC 1656.................t..167595
AB493829.1 Hepatitis B virus DNA, complete genome, isolate: P14 1656.................t..167595
AB493830.1 Hepatitis B virus DNA, complete genome, isolate: P41 1659.................t..167895
AB493831.1 Hepatitis B virus DNA, complete genome, isolate: P48 1519.................t..153895
AB493832.1 Hepatitis B virus DNA, complete genome, isolate: P19 1656.................t..167595
AB493833.1 Hepatitis B virus DNA, complete genome, isolate: P9 1656.................t..167595
AB493834.1 Hepatitis B virus DNA, complete genome, isolate: P18 1656.................t..167595
AB493835.1 Hepatitis B virus DNA, complete genome, isolate: P30 1656.................t..167595
FJ349296.1 Hepatitis B virus strain 29-OYE-10, complete genome 1656..................c.167595
AB362931.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon1656..................c.167595
AB362933.1 Hepatitis B virus C gene for core protein, complete cds, clone: B1_JP1656.................t..167595
GQ205440.1 Hepatitis B virus isolate Bc, complete genome 1656.................t..167595
AP011084.1 Hepatitis B virus DNA, complete genome, strain: B0503341(PTK)F 1656.................t..167595
AP011085.1 Hepatitis B virus DNA, complete genome, strain: B0612746(JKT)F 1656.................t..167595
AP011086.1 Hepatitis B virus DNA, complete genome, strain: B0503233(BJS)F 1656.................t..167595
AP011087.1 Hepatitis B virus DNA, complete genome, strain: B0607171(KDR)F 1656.................t..167595
AP011088.1 Hepatitis B virus DNA, complete genome, strain: B0503213(MKS)F 1656.................t..167595
AP011089.1 Hepatitis B virus DNA, complete genome, strain: B0607154(KDR)F 1656.................t..167595
AP011090.1 Hepatitis B virus DNA, complete genome, strain: B0714189(WBK)F 1656.................t..167595
AP011091.1 Hepatitis B virus DNA, complete genome, strain: B0714202(BMA)F 1656.................t..167595
AP011092.1 Hepatitis B virus DNA, complete genome, strain: B0715677(MMR)F 1656.................t..167595
AP011093.1 Hepatitis B virus DNA, complete genome, strain: B0308839(DPS)F 1656.................t..167595
AP011094.1 Hepatitis B virus DNA, complete genome, strain: B0503102(DIL)F 1656.................t..167595
AP011096.1 Hepatitis B virus DNA, complete genome, strain: B0714157(WBK)F 1656.................t..167595
AP011108.1 Hepatitis B virus DNA, complete genome, strain: C0503133(DIL)F 1656.................t..167595
GQ227696.1 Hepatitis B virus isolate Z31-6, complete genome 1656..............g.....167595
GQ184323.1 Hepatitis B virus isolate ZADGM1121, complete genome 1656..................c.167595
GQ184324.1 Hepatitis B virus isolate ZADGM1122, complete genome 1656..................c.167595
FJ899767.1 Hepatitis B virus isolate C26-2, complete genome 1656..................c.167595
FJ899768.1 Hepatitis B virus isolate C56-7, complete genome 1656..................c.167595
FJ899769.1 Hepatitis B virus isolate C76-3, complete genome 1656..................g.167595
FJ899770.1 Hepatitis B virus isolate C76-4, complete genome 1656..................g.167595
FJ899771.1 Hepatitis B virus isolate C76-5, complete genome 1656..................g.167595
FJ899773.1 Hepatitis B virus isolate C113-6, complete genome 1656..................g.167595
FJ899777.1 Hepatitis B virus isolate C127-10, complete genome 1656..................g.167595
FJ899779.1 Hepatitis B virus isolate C185-1, complete genome 1656.................t..167595
FJ899784.1 Hepatitis B virus isolate C215-3, complete genome 1656.................t..167595
FJ899785.1 Hepatitis B virus isolate C215-5, complete genome 1656.................t..167595
FJ899786.1 Hepatitis B virus isolate C215-7, complete genome 1656.................t..167595
FJ899787.1 Hepatitis B virus isolate C215-9, complete genome 1656.................t..167595
FJ899788.1 Hepatitis B virus isolate C226-1, complete genome 1656.....a..............167595
FJ899790.1 Hepatitis B virus isolate C232-2, complete genome 1656.................t..167595
FJ899791.1 Hepatitis B virus isolate C232-6, complete genome 1656.................t..167595
FJ899796.1 Hepatitis B virus isolate C76-1, complete genome 1656..................g.167595
GQ414522.1 Hepatitis B virus strain GTA_CT, complete genome 283..................c.30295
GQ377515.1 Hepatitis B virus isolate J9, complete genome 1656..................g.167595
GQ377519.1 Hepatitis B virus isolate J16, complete genome 1656.................t..167595
GQ377521.1 Hepatitis B virus isolate J19, complete genome 1656..................g.167595
GQ377525.1 Hepatitis B virus isolate J24, complete genome 1656.................t..167595
GQ377535.1 Hepatitis B virus isolate J45, complete genome 1656..................c.167595
GQ377536.1 Hepatitis B virus isolate J47, complete genome 1656...c................167595
GQ377537.1 Hepatitis B virus isolate J48, complete genome 1656.................t..167595
GQ377542.1 Hepatitis B virus isolate J61, complete genome 1656.................t..167595
GQ377546.1 Hepatitis B virus isolate J77, complete genome 1656..................g.167595
GQ377547.1 Hepatitis B virus isolate J78, complete genome 1656.................t..167595
GQ377551.1 Hepatitis B virus isolate J82, complete genome 1656...........c........167595
GQ377553.1 Hepatitis B virus isolate J84, complete genome 1656..................c.167595
GQ377558.1 Hepatitis B virus isolate J89, complete genome 1656.................t..167595
GQ377560.1 Hepatitis B virus isolate J93, complete genome 1656...c................167595
GQ377566.1 Hepatitis B virus isolate J101, complete genome 1656.................t..167595
GQ377568.1 Hepatitis B virus isolate J103, complete genome 1656.................t..167595
GQ377569.1 Hepatitis B virus isolate J105, complete genome 1656.................t..167595
GQ377574.1 Hepatitis B virus isolate J115, complete genome 1656..................a.167595
GQ377584.1 Hepatitis B virus isolate J133, complete genome 1656...........c........167595
GQ377587.1 Hepatitis B virus isolate J138, complete genome 1656.................t..167595
GQ377588.1 Hepatitis B virus isolate J141, complete genome 1656.................t..167595
GQ377595.1 Hepatitis B virus isolate J155, complete genome 1656.................t..167595
GQ377597.1 Hepatitis B virus isolate J157, complete genome 1656..................g.167595
GQ377606.1 Hepatitis B virus isolate J171, complete genome 1656.................t..167595
GQ377610.1 Hepatitis B virus isolate J177, complete genome 1656.................t..167595
GQ377612.1 Hepatitis B virus isolate J180, complete genome 1656.................t..167595
GQ377618.1 Hepatitis B virus isolate J194, complete genome 1656..................g.167595
GQ377619.1 Hepatitis B virus isolate J195, complete genome 1656..................g.167595
GQ377620.1 Hepatitis B virus isolate J197, complete genome 1656.........a..........167595
GQ377621.1 Hepatitis B virus isolate J206, complete genome 1656..................a.167595
GQ377622.1 Hepatitis B virus isolate J207, complete genome 1656.................t..167595
GQ377625.1 Hepatitis B virus isolate J222, complete genome 1656.................t..167595
GQ377629.1 Hepatitis B virus isolate J234, complete genome 1656.................t..167595
GQ377630.1 Hepatitis B virus isolate J236, complete genome 1656.................t..167595
GQ377633.1 Hepatitis B virus isolate J241, complete genome 1656...........c........167595
GQ377634.1 Hepatitis B virus isolate J242, complete genome 1656..................g.167595
GQ377635.1 Hepatitis B virus isolate J245, complete genome 1656.................t..167595
GQ377636.1 Hepatitis B virus isolate J248, complete genome 1656..c.................167595
GQ377638.1 Hepatitis B virus isolate J250, complete genome 1656.................t..167595
GQ377639.1 Hepatitis B virus isolate J251, complete genome 1656.................t..167595
GQ377640.1 Hepatitis B virus isolate J253, complete genome 1656..................g.167595
GQ377641.1 Hepatitis B virus isolate J254, complete genome 1656.................t..167595
GQ377642.1 Hepatitis B virus isolate J256, complete genome 1656..................g.167595
GQ377643.1 Hepatitis B virus isolate J258, complete genome 1656.................t..167595
GQ475325.1 Hepatitis B virus isolate KOR21LC, complete genome 1650..................c.166995
GQ475332.1 Hepatitis B virus isolate KOR28LC, complete genome 1656.................a..167595
GQ475340.1 Hepatitis B virus isolate KOR36HCC, complete genome 1656.................t..167595
FJ798095.1 Hepatitis B virus isolate ggcam19, complete genome 1656.................t..167595
FJ798096.1 Hepatitis B virus isolate ggcam7, complete genome 1656.................t..167595
FJ798097.1 Hepatitis B virus isolate ggcam22, complete genome 1656.................t..167595
FJ798098.1 Hepatitis B virus isolate cpzcam17, complete genome 1656.................t..167595
AB471848.1 Hepatitis B virus DNA, complete genome, isolate: F1S-F 1656..................g.167595
AB471849.1 Hepatitis B virus DNA, complete genome, isolate: F1S-C2 1656..................g.167595
AB471850.1 Hepatitis B virus DNA, complete genome, isolate: F1S-C1 1656..................g.167595
AB471854.1 Hepatitis B virus DNA, complete genome, isolate: F5M-F 1656.................t..167595
AB471855.1 Hepatitis B virus DNA, complete genome, isolate: F5M-C 1656.................t..167595
AF043560.2 Hepatitis B virus isolate BA2, complete genome 1656..................c.167595
AF043580.2 Hepatitis B virus isolate BA3, complete genome 1656..................c.167595
FN594751.1 Hepatitis B virus complete genome, isolate bne52H 1656.........a..........167595
FN594770.1 Hepatitis B virus complete genome, isolate bne367 1656...c................167595
GU357842.1 Hepatitis B virus isolate C4371, complete genome 1656.................t..167595
GU357843.1 Hepatitis B virus isolate Y580, complete genome 1656..t.................167595
GU357845.1 Hepatitis B virus isolate Y1021, complete genome 1656.........a..........167595
GU385774.1 Hepatitis B virus isolate C2-Shanghai, complete genome 1656..................g.167595
GU451682.1 Hepatitis B virus isolate pLL-EGFP, complete genome 1656.................t..167595
AB549213.1 Hepatitis B virus DNA, complete genome, clone: G-C-F 1656..................c.167595
FN545824.1 Hepatitis B virus complete genome, strain 29136 1602...c................162195
FN545825.1 Hepatitis B virus complete genome, strain 29137 1656..................c.167595
FN545826.1 Hepatitis B virus complete genome, strain 34010 1656..................c.167595
FN545828.1 Hepatitis B virus complete genome, strain 34015 1656..................c.167595
FN545829.1 Hepatitis B virus complete genome, strain 34028 1656..................c.167595
FN545830.1 Hepatitis B virus complete genome, strain 34033 1656..................c.167595
FN545831.1 Hepatitis B virus complete genome, strain 42002 1656..................c.167595
FN545832.1 Hepatitis B virus complete genome, strain 42048 1656..................c.167595
FN545833.1 Hepatitis B virus complete genome, strain 42063 1656..................c.167595
FN545834.1 Hepatitis B virus complete genome, strain 42064 1656..................c.167595
FN545835.1 Hepatitis B virus complete genome, strain 42096 1656..................c.167595
FN545836.1 Hepatitis B virus complete genome, strain 42128 1656..................c.167595
FN545837.1 Hepatitis B virus complete genome, strain 42145 1647..................c.166695
FN545838.1 Hepatitis B virus complete genome, strain 42202 1656..................c.167595
FN545839.1 Hepatitis B virus complete genome, strain 42266 1602..................c.162195
FN545840.1 Hepatitis B virus complete genome, strain 42339 1644..................c.166395
AB555498.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA41 1656.................t..167595
AB555499.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA62 1668.................t..168795
AB540582.1 HBV genotype B DNA, complete genome, strain: B0901189(NT15) 1656.................t..167595
AB540583.1 HBV genotype C DNA, complete genome, strain: C0901177(NT3) 1656..t.................167595
AB540585.1 HBV genotype C DNA, complete genome, strain: C0901192(NT18) 1656.................t..167595
HM066946.2 Hepatitis B virus isolate MX-HBV-0114, complete genome 1656.................t..167595
HM117850.2 Hepatitis B virus isolate MX-HBV-0153, complete genome 1656.................t..167595
HM117851.2 Hepatitis B virus isolate MX-HBV-0201, complete genome 1656.................t..167595
HM153811.1 Hepatitis B virus, complete genome 1656.................t..167595
AB516393.1 HBV genotype H DNA, complete genome, isolate: 904MEXM 1656.................t..167595
AB516395.1 HBV genotype H DNA, complete genome, isolate: MEX914M 1656.................t..167595
AB480036.2 Hepatitis B virus DNA, complete genome, strain: 06-17 1656..................c.167595
AB480038.2 Hepatitis B virus DNA, complete genome, strain: 06-23 1656..................c.167595
AB480040.2 Hepatitis B virus DNA, complete genome, strain: 06-44 1656..................c.167595
AB480041.2 Hepatitis B virus DNA, complete genome, strain: 06-51 1656..................c.167595
FR714490.1 Hepatitis B virus complete genome, isolate DL706, X/C recombinant 1656...c................167595
FR714490.1 Hepatitis B virus complete genome, isolate DL706, X/C recombinant 1002___...........g..t._101770
FR714491.1 Hepatitis B virus complete genome, isolate GM012, X/C recombinant 1656...c................167595
FR714491.1 Hepatitis B virus complete genome, isolate GM012, X/C recombinant 1002___...........g..t._101770
FR714492.1 Hepatitis B virus complete genome, isolate GY235, X/C recombinant 1656...c................167595
FR714492.1 Hepatitis B virus complete genome, isolate GY235, X/C recombinant 1002___...........g..t._101770
FR714493.1 Hepatitis B virus complete genome, isolate NA167, X/C recombinant 1656...c................167595
FR714495.1 Hepatitis B virus complete genome, isolate QB062, X/C recombinant 1656...c................167595
FR714495.1 Hepatitis B virus complete genome, isolate QB062, X/C recombinant 1002___...........g..t._101770
FR714496.1 Hepatitis B virus complete genome, isolate QL523, X/C recombinant 1656...c................167595
FR714497.1 Hepatitis B virus complete genome, isolate QP046, X/C recombinant 1656...c................167595
FR714499.1 Hepatitis B virus complete genome, isolate TF051, X/C recombinant 1656...c................167595
FR714500.1 Hepatitis B virus complete genome, isolate TX164, X/C recombinant 1656...c................167595
FR714500.1 Hepatitis B virus complete genome, isolate TX164, X/C recombinant 1002___...........g..t._101770
FR714501.1 Hepatitis B virus complete genome, isolate TX327, X/C recombinant 1656...c................167595
FR714501.1 Hepatitis B virus complete genome, isolate TX327, X/C recombinant 1002___...........g..t._101770
FR714502.1 Hepatitis B virus complete genome, isolate TZ087, X/C recombinant 1656...c................167595
FR714502.1 Hepatitis B virus complete genome, isolate TZ087, X/C recombinant 1002___...........g..t._101770
FR714503.1 Hepatitis B virus complete genome, isolate TZ306, X/C recombinant 1656...c................167595
FR714503.1 Hepatitis B virus complete genome, isolate TZ306, X/C recombinant 1002___...........g..t._101770
FR714506.1 Hepatitis B virus complete genome, isolate YL204, X/C recombinant 1656...c................167595
FR714506.1 Hepatitis B virus complete genome, isolate YL204, X/C recombinant 1002___...........g..t._101770
AB554017.1 HBV genotype B DNA, complete genome, isolate: NMB09010 1656.................t..167595
HQ684848.1 Hepatitis B virus isolate HBVJSTZ1, complete genome 1656.................t..167595
HQ684849.1 Hepatitis B virus isolate HBVJSTZ2, complete genome 1656.................t..167595
AB562463.1 Hepatitis B virus DNA, complete genome, isolate: HPC017_07 1656...c................167595
AB562463.1 Hepatitis B virus DNA, complete genome, isolate: HPC017_07 1002___...........g..t._101770
JF412801.1 Hepatitis B virus isolate HBVJSTZ3, complete genome 1656.................t..167595
HQ231877.1 Hepatitis B virus isolate B3-1, complete genome 1656...c................167595
HQ231877.1 Hepatitis B virus isolate B3-1, complete genome 1002___...........g..t._101770
HQ231878.1 Hepatitis B virus isolate B3-2, complete genome 1656...c................167595
HQ231878.1 Hepatitis B virus isolate B3-2, complete genome 1002___...........g..t._101770
HQ231879.1 Hepatitis B virus isolate B3-4, complete genome 1656...c................167595
HQ231879.1 Hepatitis B virus isolate B3-4, complete genome 1002___...........g..t._101770
HQ231880.1 Hepatitis B virus isolate B3-5, complete genome 1656...c................167595
HQ231880.1 Hepatitis B virus isolate B3-5, complete genome 1002___...........g..t._101770
HQ231881.1 Hepatitis B virus isolate B3-6, complete genome 1656...c................167595
HQ231881.1 Hepatitis B virus isolate B3-6, complete genome 1002___...........g..t._101770
HQ231882.1 Hepatitis B virus isolate B3-7, complete genome 1656...c................167595
HQ231882.1 Hepatitis B virus isolate B3-7, complete genome 1002___...........g..t._101770
HQ231883.1 Hepatitis B virus isolate B3-8, complete genome 1656...c................167595
HQ231883.1 Hepatitis B virus isolate B3-8, complete genome 1002___...........g..t._101770
HQ231884.1 Hepatitis B virus isolate B3-9, complete genome 1656...c................167595
HQ231884.1 Hepatitis B virus isolate B3-9, complete genome 1002___...........g..t._101770
JF440017.1 Hepatitis B virus isolate FOL496, complete genome 3028...c................304795
AB602818.1 HBV genotype B DNA, complete genome, isolate: AH-2 1656.................t..167595
EU939598.1 Hepatitis B virus isolate C164, complete genome 1656..................__167390
AB056513.1 Hepatitis B virus DNA, complete genome, clone:USG17 1656.................g._167490
AB056514.1 Hepatitis B virus DNA, complete genome, clone:USG15 1647.................g._166590
AB056515.1 Hepatitis B virus DNA, complete genome, clone:USG16 1656.................g._167490
AB056516.1 Hepatitis B virus DNA, complete genome, clone:USG18 1934.................g._195290
AY033072.1 Hepatitis B virus serotype ayw1, complete genome 3052_................t..307090
AY033073.1 Hepatitis B virus serotype ayw1, complete genome 3052_................t..307090
AB064310.1 Hepatitis B virus DNA, complete genome, clone:USG769 1656.................g._167490
AB064311.1 Hepatitis B virus DNA, complete genome, clone:USG825 1656.................g._167490
AB064312.1 Hepatitis B virus DNA, complete genome, clone:USG916 1656.................g._167490
AB064313.1 Hepatitis B virus DNA, complete genome, clone:USG2638 1656.................g._167490
AF405706.1 Hepatitis B virus isolate 235/01, complete genome 1656.................g._167490
AB073843.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw27 1656.................t._167490
AB073849.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na101 1656.................t._167490
AY330917.1 Hepatitis B virus isolate Crazywoman complete genome 1657_................t..167590
AY179735.1 Hepatitis B virus genotype F isolate BA10, complete genome 1656...m.............t..167590
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 1656.................g._167490
AY800391.1 Hepatitis B virus isolate ZY041026, complete genome 1656.................t._167490
AY800392.1 Hepatitis B virus isolate ZY041027, complete genome 1656.................t._167490
AP007264.1 HBV genotype G DNA, complete genome, isolate: HB-JI444GF 1656.................g._167490
DQ078791.1 Hepatitis B virus from Thailand, complete genome 1657.................g._167590
DQ207798.1 Hepatitis B virus strain N2829, complete genome 1653.................g._167190
AB219426.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4014, PNN1 1656.................t._167490
AB219427.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4075, PNN2 1656.................t._167490
AB219429.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4101, PNN4 1656.................t._167490
DQ448621.1 Hepatitis B virus isolate GZ-HQY, complete genome 1656.................t._167490
AB241116.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC03 1621.................t._163990
AB241117.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC05 1656.................t._167490
DQ993697.1 Hepatitis B virus isolate patient 940b1, complete genome 1656....r............t..167590
DQ993703.1 Hepatitis B virus isolate 236-0526-Nature1.2-Sero, complete genome 1657_................t..167590
DQ993704.1 Hepatitis B virus isolate 239-1127-Nature3.1-unSero, complete genome 1657_................t..167590
DQ993705.1 Hepatitis B virus isolate 239-0625-Nature3.4-unSero, complete genome 1657_................t..167590
DQ993706.1 Hepatitis B virus isolate 239-0402-Nature3.3-unSero, complete genome 1657_................t..167590
DQ993707.1 Hepatitis B virus isolate 239-O218-Nature3.2-unSero, complete genome 1657_................t..167590
EF634480.1 Hepatitis B virus clone G6, complete genome 1656.................g._167490
EF634481.1 Hepatitis B virus clone G1, complete genome 1656.................g._167490
EF464097.1 Hepatitis B virus isolate 06hac, complete genome 1656.................g._167490
EF464098.1 Hepatitis B virus isolate 09hgg, complete genome 1656.................g._167490
EF464099.1 Hepatitis B virus isolate 05hgg, complete genome 1656.................g._167490
AB375165.1 Hepatitis B virus DNA, complete genome, strain: MEXICO8-G 1656.................g._167490
AB375166.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-G 1656.................g._167490
AB375167.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32-G 1656.................g._167490
AB375168.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-G 1656.................g._167490
AB375169.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-G 1656.................g._167490
AB375170.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-G 1656.................g._167490
FM209514.1 Hepatitis B virus complete genome, isolate G50 1656.................t._167490
FJ032342.1 Hepatitis B virus isolate S659-2 from China, complete genome 1657_................t..167590
FJ032344.1 Hepatitis B virus isolate S659-5 from China, complete genome 1657_................t..167590
FJ386674.1 Hepatitis B virus isolate S659, complete genome 1657_................t..167590
AB493828.1 Hepatitis B virus DNA, complete genome, isolate: 33UC 1657.................t._167590
GQ377561.1 Hepatitis B virus isolate J96, complete genome 1656.................g._167490
U46935.1HBU46935 Hepatitis B virus complete genome 1656.................___167285
AJ131568.1 Hepatitis B virus complete genome, isolate gib824 3025.................___304185
AJ131575.1 Hepatitis B virus complete genome, isolate chimp82 3025.................___304185
AY077736.1 Hepatitis B virus isolate G26, complete genome 1656.................___167285
AB073848.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HUS 1656.................___167285
AY330913.1 Hepatitis B virus isolate Tamang complete genome 1656.................___167285
AY330914.1 Hepatitis B virus isolate Wendy complete genome 1656.................___167285
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 1656.................___167285
AB300366.1 Hepatitis B virus DNA, complete genome, isolate: patient8 1656.................___167285
AB300369.1 Hepatitis B virus DNA, complete genome, isolate: patient11 1656.................___167285
FM209515.1 Hepatitis B virus complete genome, isolate G51 1656.................___167285
FJ386598.1 Hepatitis B virus isolate 1889, complete genome 1656.................___167285
FJ787477.1 Hepatitis B virus isolate LWM-1, complete genome 1656.................___167285
AB480039.2 Hepatitis B virus DNA, complete genome, strain: 06-27 1656.................___167285
X69798.1 Hepatitis B virus, subtype adw4 genes 1656...c.............t..167590
S50225.1 {HBV variant} [hepatitis B virus HBV, surface antigen-negative patien1658.....a............c.167790
X75658.1 Human hepatitis virus (genotype F, Fou) preS1, preS2, S, C, X, antige1656.........a.......t..167590
X80925.1 Hepatitis B virus (patient 6) complete genome 1658......g...........c.167790
X98073.1 Hepatitis B virus complete genome with insertion in core promoter (no1656.....a...........t..167590
X98072.1 Hepatitis B virus complete genome with insertion in core promoter 1656.....a...........t..167590
X98077.1 Hepatitis B virus complete genome, wild type 1656.....a...........t..167590
X98074.1 Hepatitis B virus complete genome with insertion in core promoter, 761580.....a...........t..159990
X98075.1 Hepatitis B virus complete genome with insertion in core promoter, 191656.....a...........t..167590
X98075.1 Hepatitis B virus complete genome with insertion in core promoter, 191854.....a...........t..187390
X98076.1 Hepatitis B virus complete genome with insertion in core promoter, 331318.....a...........t..133790
AB014387.1 Hepatitis B virus genomic DNA, complete sequence, isolate 28Y10HCC 1611..a..............t..163090
AF143303.1 Hepatitis B virus clone HD1406, complete genome 2968................c.c.298790
AB046525.1 Hepatitis B virus genomic DNA, complete sequence, isolate:PttHBV-ChBa1623...c.............t..164290
AF223962.1 Hepatitis B virus strain C-1858 isolate sa4, complete genome 1656.........a.......t..167590
AF223963.1 Hepatitis B virus strain C-1858 isolate sa11, complete genome 1656...c.............t..167590
AF223964.1 Hepatitis B virus strain C-1858 isolate sa14, complete genome 1656...c.............t..167590
AB064316.1 Hepatitis B virus DNA, complete genome, clone:US2573 1656...c.............t..167590
AF461361.1 Hepatitis B virus isolate FH3Q, compete genome 1652.....a............g.167190
AB073825.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi51 1656..c..............t..167590
AB073836.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw25 1656..a..............t..167590
AB073839.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw174 1656.....a...........t..167590
AY090454.1 Hepatitis B virus strain 1853Nic, complete genome 1659..a..............t..167890
AY090460.1 Hepatitis B virus strain LAS2523, complete genome 1659..............t..t..167890
AF418683.1 Hepatitis B virus patient 4727 clone 2, complete genome 1658................c.c.167790
AB086397.1 Hepatitis B virus X, C genes for X protein, core protein, complete c1656...c.............t..167590
AY217361.1 Hepatitis B virus isolate 582-2, complete genome 1656..............g..t..167590
AY217364.1 Hepatitis B virus isolate 586, complete genome 1590.........a.......t..160990
AY206374.1 Hepatitis B virus strain FMU003 complete genome 1658...c..............c.167790
AY233286.1 Hepatitis B virus isolate 818 complete genome 1656...c..............c.167590
AY233290.1 Hepatitis B virus isolate 85 complete genome 1656.........t........c.167590
AY167093.1 Hepatitis B virus isolate IIa, complete genome 1656..a..............t..167590
AY167098.1 Hepatitis B virus isolate IVa, complete genome 1656.....a...........t..167590
AY167100.1 Hepatitis B virus isolate Va, complete genome 1656.....a...........t..167590
AY179734.1 Hepatitis B virus genotype F isolate BA9, complete genome 1656.........a.......t..167590
AB115417.1 Hepatitis B virus DNA, complete genome, isolate:HBV-O47 1656...c..............c.167590
AB116552.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ4 1656...c.............t..167590
AB116654.1 Hepatitis B virus DNA, complete genome, clone:JPNTAKA 1656...c.............t..167590
AY596105.1 Hepatitis B virus isolate Ia-5, complete genome 1656.....a...........t..167590
AY738142.1 Hepatitis B virus clone A4, complete genome 1656..........c.......c.167590
AB205129.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758-2 1656...c.............t..167590
AY934764.1 Hepatitis B virus isolate 9210699, complete genome 1656...c..............c.167590
AY934774.1 Hepatitis B virus isolate 9615549, complete genome 1656...c..............c.167590
AB205192.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758 1656...c.............t..167590
DQ361535.1 Hepatitis B virus isolate CRP-228, complete genome 1626.........a.......t..164590
AJ627225.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 19749 1656.....a...........t..167590
AJ627226.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20952 1647.........a........c.166690
AM180623.1 Hepatitis B virus complete genome, isolate MAL36 1656...c..............c.167590
AM117396.1 Hepatitis B virus, isolate CHIMP_BAT, complete genome 1655...c.............t..167490
AB246339.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN51 1656..a..............t..167590
DQ995803.1 Hepatitis B virus isolate C265-15, complete genome 1656.....a...........t..167590
AB287323.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-4 1656..a..............t..167590
AB287328.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba 51 1656..a..............t..167590
EU410079.1 Hepatitis B virus isolate ph109, complete genome 1656..ac................167590
EU410082.1 Hepatitis B virus isolate ph81, complete genome 1656...c..............c.167590
EU547563.1 Hepatitis B virus isolate MC06, complete genome 1656.....a...........t..167590
EU554535.1 Hepatitis B virus isolate S472-20, complete genome 1656........c.........g.167590
EU554536.1 Hepatitis B virus isolate S472-24, complete genome 1656........c.........g.167590
EU579443.1 Hepatitis B virus isolate 2 genotype C, complete genome 1656..a...............c.167590
EU670261.1 Hepatitis B virus isolate 499, complete genome 1576...c.............t..159590
EU670262.1 Hepatitis B virus isolate 549, complete genome 1656...c.............t..167590
AB375161.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32 1656.....a...........t..167590
AB375163.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-H 1656.....a...........t..167590
EU330989.1 Hepatitis B virus isolate M84-74, complete genome 1656.........a.......t..167590
EU330990.1 Hepatitis B virus isolate M84-146, complete genome 1656.........a.......t..167590
EU330993.1 Hepatitis B virus isolate M85-8, complete genome 1655.........a.......t..167490
EU330994.1 Hepatitis B virus isolate M85-10, complete genome 1656.........a.......t..167590
EU330995.1 Hepatitis B virus isolate M85-80, complete genome 1656.........a.......t..167590
EU330996.1 Hepatitis B virus isolate M85-81, complete genome 1656.........a.......t..167590
EU330997.1 Hepatitis B virus isolate M85-216, complete genome 1656.........a.......t..167590
EU796066.1 Hepatitis B virus strain 0477, complete genome 1656...c.............t..167590
EU796067.1 Hepatitis B virus strain 2164, complete genome 1656...c.............t..167590
EU796071.1 Hepatitis B virus strain 5051, complete genome 1656...c.............t..167590
EU871997.1 Hepatitis B virus isolate 530-00-3, complete genome 1656..........c.......g.167590
AB453987.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH9 1656...c..............c.167590
EU939558.1 Hepatitis B virus isolate C66, complete genome 1626.........a........c.164590
EU939659.1 Hepatitis B virus isolate D165, complete genome 1656...c..............g.167590
FJ023637.1 Hepatitis B virus isolate B5_M04-0013 S protein (S) and core protein 1656.........a.......t..167590
FJ023638.1 Hepatitis B virus isolate B5_M04-0465 S protein (S) and core protein 1656.........a.......t..167590
FJ386601.1 Hepatitis B virus isolate 1912, complete genome 1656........c.........c.167590
FJ386640.1 Hepatitis B virus isolate 2168, complete genome 1623..tc................164290
FJ386677.1 Hepatitis B virus isolate S1104, complete genome 1614..t...............c.163390
FJ787455.1 Hepatitis B virus isolate S1092-3, complete genome 1656..a...............c.167590
FJ787456.1 Hepatitis B virus isolate S1092-4, complete genome 1656..a...............c.167590
AP011095.1 Hepatitis B virus DNA, complete genome, strain: B0503138(KPG)F 1656..a..............t..167590
AB486012.1 Hepatitis B virus DNA, complete genome, clone: JRB34 1656...c.............t..167590
GQ377550.1 Hepatitis B virus isolate J81, complete genome 1656.....a...........t..167590
GQ377582.1 Hepatitis B virus isolate J131, complete genome 1656..a..............t..167590
GQ377591.1 Hepatitis B virus isolate J148, complete genome 1656..ac................167590
GQ377644.1 Hepatitis B virus isolate J294, complete genome 1656...........c.....g..167590
FJ657529.1 Hepatitis B virus isolate BA109, complete genome 1656...c.............t..167590
EU366118.2 Hepatitis B virus isolate BA67, complete genome 1656...c.............t..167590
EU366133.2 Hepatitis B virus isolate BA96, complete genome 1656...c.............t..167590
FR714494.1 Hepatitis B virus complete genome, isolate NS052, X/C recombinant 1656...c..............c.167590
FR714494.1 Hepatitis B virus complete genome, isolate NS052, X/C recombinant 1002___...........g..t._101770
FR714504.1 Hepatitis B virus complete genome, isolate WL339, X/C recombinant 1656...c..............c.167590
FR714504.1 Hepatitis B virus complete genome, isolate WL339, X/C recombinant 1002___...........g..t._101770
HM622135.1 Hepatitis B virus isolate HCUCH5, complete genome 1656...c.............t..167590
HM627320.1 Hepatitis B virus isolate HCUCH21, complete genome 1656...c.............t..167590
HQ378247.1 Hepatitis B virus isolate IRL-2009, complete genome 1656...c.............t..167590
HQ231885.1 Hepatitis B virus isolate B3-10, complete genome 1656...c......c.........167590
HQ231885.1 Hepatitis B virus isolate B3-10, complete genome 1002___...........g..t._101770
AF046996.1 Woolly monkey hepatitis B Virus, complete genome 1658........c.........__167585
AB073850.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na102 1657_................t._167485
AF160501.1 Hepatitis B virus strain IG29227, complete genome 1656...t.............g._167485
AX155589.1 Sequence 1 from Patent WO0140279 1656...t.............g._167485
GU565217.1 Hepatitis B virus strain CLB-DonX, complete genome 1656.........a.......g._167485
FJ657525.1 Hepatitis B virus isolate BA107, complete genome 1656...c.............___167280
AJ131571.1 Hepatitis B virus complete genome, isolate gib645 3025..ac.............t..304485
EU330992.1 Hepatitis B virus isolate M85-6, complete genome 1656.........ac......t..167585
EU330998.1 Hepatitis B virus isolate M85-1043, complete genome 1656.........ac......t..167585
EU330999.1 Hepatitis B virus isolate M85-1044, complete genome 1656.........ac......t..167585
EU331000.1 Hepatitis B virus isolate M85-1045, complete genome 1656.........ac......t..167585
EU331001.1 Hepatitis B virus isolate M85-1046, complete genome 1656.........ac......t..167585
FJ798099.1 Hepatitis B virus isolate cpzcam6, complete genome 1656..ac.............t..167585
AY226578.1 Woolly monkey hepatitis B virus clone WMHBV-2, complete genome 1658....a...c.........__167580
FJ787460.1 Hepatitis B virus isolate S1348-4, complete genome 1656..............______166970
FM199978.1 Hepatitis B virus complete genome, strain 49136 1656............________166760