../../tmp/servers/virsirnadb/623139929
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18461aagcactttagtgacctggaa21
NC_009334.1 Human herpesvirus 4, complete genome 136954.....................136974100
NC_009334.1 Human herpesvirus 4, complete genome 75731____............a.___7571861
NC_009334.1 Human herpesvirus 4, complete genome 105158_____...gg.........__10514557
NC_009334.1 Human herpesvirus 4, complete genome 123792_____.g.........g..__12377957
NC_009334.1 Human herpesvirus 4, complete genome 50249.........c.._________5023852
NC_009334.1 Human herpesvirus 4, complete genome 168664..........a._________16865352
NC_009334.1 Human herpesvirus 4, complete genome 54102__________.........._5411147
NC_009334.1 Human herpesvirus 4, complete genome 121579___________..........12158847
NC_009334.1 Human herpesvirus 4, complete genome 3199__________.g.........320947
NC_009334.1 Human herpesvirus 4, complete genome 43892_..gc.a.c.ag.........4387366
NC_009334.1 Human herpesvirus 4, complete genome 42795_.........___________4280342
NC_009334.1 Human herpesvirus 4, complete genome 47957__________.........__4794942
NC_009334.1 Human herpesvirus 4, complete genome 56689___________........._5668142
NC_009334.1 Human herpesvirus 4, complete genome 96517____________.........9652542
NC_009334.1 Human herpesvirus 4, complete genome 108806___________........._10879842
NC_009334.1 Human herpesvirus 4, complete genome 110923____________.........11093142
NC_009334.1 Human herpesvirus 4, complete genome 114089.........____________11408142
NC_009334.1 Human herpesvirus 4, complete genome 136027__________.........__13603542
NC_009334.1 Human herpesvirus 4, complete genome 158384___________........._15837642
NC_009334.1 Human herpesvirus 4, complete genome 167123_________.........___16713142
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 75615____............a.___7560261
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 104246_____...gg.........__10423357
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 122884_____.g.........g..__12287157
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 50068.........c.._________5005752
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 53921__________.........._5393047
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 120671___________..........12068047
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 3199__________.g.........320947
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 43712_..gc.a.c.ag.........4369366
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 42612_.........___________4262042
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 47776__________.........__4776842
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 56508___________........._5650042
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 84236____.........________8424442
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 95605____________.........9561342
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 107895___________........._10788742
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 110012____________.........11002042
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 113178.........____________11317042