../../tmp/servers/virsirnadb/937849253
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi20211aagccctataacatcaaattcaa23
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons2504.......................2526100
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons14677___..........aa..._____1469156
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons7128___________..........._711847
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons10596_______..ct..g.........1061156
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons13476_______....aca.........1349156
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons3718________.........._____372743
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons3717_____....gttt........._370156
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons10263__________.t.a.........1027547
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons64____________.........__5639
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons706_______........._______71439
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons6453____.........__________646139
M74568.1RSHSEQ Human respiratory syncytial virus nonstructural protein 1, nons12183__________.........____1219139
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl2504.......................2526100
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl14677___..........aa..._____1469156
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl7128___________..........._711847
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl10596_______..ct..g.........1061156
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl13476_______....aca.........1349156
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl3718________.........._____372743
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl3717_____....gttt........._370156
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl10263__________.t.a.........1027547
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl64____________.........__5639
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl706_______........._______71439
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl6453____.........__________646139
U63644.1HRU63644 Human respiratory syncytial virus, mutant cpts-248/404, compl12183__________.........____1219139
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 2505.......................2527100
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 3688_____.....ttt........._367260
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 14646___..........aa..._____1466056
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 7098___________..........._708847
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 10565_______..ct..g.........1058056
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 13445_______....aca.........1346056
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 3689________.........._____369843
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 10232__________.t.a.........1024447
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 64____________.........__5639
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 6423____.........__________643139
U39662.1HRU39662 Human respiratory syncytial virus S2, complete genome 12152__________.........____1216039
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge2504.......................2526100
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge14677___..........aa..._____1469156
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge7128___________..........._711847
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge10596_______..ct..g.........1061156
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge13476_______....aca.........1349156
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge3718________.........._____372743
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge3717_____....gttt........._370156
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge10263__________.t.a.........1027547
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge64____________.........__5639
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge706_______........._______71439
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge6453____.........__________646139
U50362.1HRU50362 Human respiratory syncytial virus, mutant cp-RSV, complete ge12183__________.........____1219139
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 2504.......................2526100
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 14677___..........aa..._____1469156
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 7128___________..........._711847
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 10596_______..ct..g.........1061156
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 13476_______....aca.........1349156
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 3718________.........._____372743
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 3717_____....gttt........._370156
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 10263__________.t.a.........1027547
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 64____________.........__5639
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 706_______........._______71439
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 6453____.........__________646139
U50363.1HRU50363 Human respiratory syncytial virus, mutant cpts-248, complete 12183__________.........____1219139
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete2505.......................2527100
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete14678___..........aa..._____1469256
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete7129___________..........._711947
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete10597_______..ct..g.........1061256
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete13477_______....aca.........1349256
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete3719________.........._____372843
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete3718_____....gttt........._370256
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete10264__________.t.a.........1027647
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete64____________.........__5639
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete706_______........._______71439
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete6454____.........__________646239
AF035006.1 Human respiratory syncytial virus, recombinant mutant rA2cp, complete12184__________.........____1219239
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 2504.......................2526100
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 14676___..........aa..._____1469056
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 7127___________..........._711747
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 10595_______..ct..g.........1061056
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 13475_______....aca.........1349056
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 3718________.........._____372743
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 3717_____....gttt........._370156
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 10262__________.t.a.........1027447
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 704_____.a........._______71443
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 64____________.........__5639
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 6452____.........__________646039
AY911262.1 Human respiratory syncytial virus strain ATCC VR-26, complete genome 12182__________.........____1219039
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 12802_______...t.........g..1281760
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 13486_______....a.a.........1350160
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 14687___..........aa..._____1470156
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 5549__________...........t.556152
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 3715_______...ttt........._370152
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 9592_______.........c._____960243
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 10611____________.g.........1062143
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 64____________.........__5639
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 6456____.........__________646439
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 6636_________........._____664439
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 10419______________.........1042739
AY353550.1 Human Respiratory syncytial virus 9320, complete genome 13515__________.........____1352339
NC_001781.1 Human respiratory syncytial virus, complete genome 13487_______....a.a.........1350260
NC_001781.1 Human respiratory syncytial virus, complete genome 14688___..........aa..._____1470256
NC_001781.1 Human respiratory syncytial virus, complete genome 5551__________...........c.556352
NC_001781.1 Human respiratory syncytial virus, complete genome 12916______.c.........t.ct..1293256
NC_001781.1 Human respiratory syncytial virus, complete genome 3717_______...ttt........._370352
NC_001781.1 Human respiratory syncytial virus, complete genome 14576_______.c.........aa.._1456252
NC_001781.1 Human respiratory syncytial virus, complete genome 9593_______.........c._____960343
NC_001781.1 Human respiratory syncytial virus, complete genome 10612____________.g.........1062243
NC_001781.1 Human respiratory syncytial virus, complete genome 64____________.........__5639
NC_001781.1 Human respiratory syncytial virus, complete genome 6458____.........__________646639
NC_001781.1 Human respiratory syncytial virus, complete genome 6638_________........._____664639
NC_001781.1 Human respiratory syncytial virus, complete genome 13516__________.........____1352439
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 13396___..........aa..._____1341056
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 4259__________...........c.427152
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 12195_______....aca.........1221056
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 11624______.c.........t.ct..1164056
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 3717_______...ttt........._370352
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 13284_______.c.........aa.._1327052
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 8301_______.........c._____831143
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 9320____________.g.........933043
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 64____________.........__5639
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 5346_________........._____535439
AF013255.1 Human respiratory syncytial virus mutant cp52, complete genome 12224__________.........____1223239