../../tmp/servers/virsirnadb/1875930018
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi22301aaggatgaggaaggcaattta21
AY278491.2 SARS coronavirus HKU-39849, complete genome 13545.....................13565100
AY278554.2 SARS coronavirus CUHK-W1, complete genome 13530.....................13550100
AY278741.1 SARS coronavirus Urbani, complete genome 13545.....................13565100
AY278488.2 SARS coronavirus BJ01, complete genome 13526.....................13546100
AY283794.1 SARS coronavirus Sin2500, complete genome 13529.....................13549100
AY283795.1 SARS coronavirus Sin2677, complete genome 13529.....................13549100
AY283796.1 SARS coronavirus Sin2679, complete genome 13529.....................13549100
AY283797.1 SARS coronavirus Sin2748, complete genome 13529.....................13549100
AY291451.1 SARS coronavirus TW1, complete genome 13545.....................13565100
AY297028.1 SARS coronavirus ZJ01, complete genome 13536.....................13556100
AY278489.2 SARS coronavirus GD01, complete genome 13529.....................13549100
AY278487.3 SARS coronavirus BJ02, complete genome 13545.....................13565100
AY278490.3 SARS coronavirus BJ03, complete genome 13541.....................13561100
AY279354.2 SARS coronavirus BJ04, complete genome 13529.....................13549100
AY291315.1 SARS coronavirus Frankfurt 1, complete genome 13545.....................13565100
AY321118.1 SARS coronavirus TWC, complete genome 13545.....................13565100
AY338174.1 SARS coronavirus Taiwan TC1, complete genome 13476.....................13496100
AY338175.1 SARS coronavirus Taiwan TC2, complete genome 13476.....................13496100
AY345986.1 SARS coronavirus CUHK-AG01, complete genome 13530.....................13550100
AY345987.1 SARS coronavirus CUHK-AG02, complete genome 13530.....................13550100
AY345988.1 SARS coronavirus CUHK-AG03, complete genome 13530.....................13550100
AY323977.2 SARS coronavirus HSR 1, complete genome 13545.....................13565100
AY348314.1 SARS coronavirus Taiwan TC3, complete genome 13476.....................13496100
AY351680.1 SARS coronavirus ZMY 1, complete genome 13557.....................13577100
AP006557.1 SARS coronavirus TWH genomic RNA, complete genome 13545.....................13565100
AP006558.1 SARS coronavirus TWJ genomic RNA, complete genome 13545.....................13565100
AP006559.1 SARS coronavirus TWK genomic RNA, complete genome 13545.....................13565100
AP006560.1 SARS coronavirus TWS genomic RNA, complete genome 13545.....................13565100
AP006561.1 SARS coronavirus TWY genomic RNA, complete genome 13545.....................13565100
AY362698.1 SARS coronavirus TWC2, complete genome 13545.....................13565100
AY362699.1 SARS coronavirus TWC3, complete genome 13545.....................13565100
AY310120.1 SARS coronavirus FRA, complete genome 13545.....................13565100
AY304486.1 SARS coronavirus SZ3, complete genome 13530.....................13550100
AY304488.1 SARS coronavirus SZ16, complete genome 13530.....................13550100
AY304495.1 SARS coronavirus GZ50, complete genome 13530.....................13550100
AY283798.2 SARS coronavirus Sin2774, complete genome 13529.....................13549100
AY427439.1 SARS coronavirus AS, complete genome 13529.....................13549100
AY394977.1 SARS coronavirus GZ-A, partial genome 13494.....................13514100
AY394978.1 SARS coronavirus GZ-B, complete genome 13473.....................13493100
AY394979.1 SARS coronavirus GZ-C, complete genome 13493.....................13513100
AY394980.1 SARS coronavirus GZ-D, partial genome 13499.....................13519100
AY394981.1 SARS coronavirus HGZ8L1-A, partial genome 13494.....................13514100
AY394982.1 SARS coronavirus HGZ8L1-B, partial genome 13493.....................13513100
AY394983.1 SARS coronavirus HSZ2-A, complete genome 13493.....................13513100
AY394985.1 SARS coronavirus HSZ-Bb, complete genome 13295.....................13315100
AY394986.1 SARS coronavirus HSZ-Cb, complete genome 13494.....................13514100
AY394987.1 SARS coronavirus HZS2-Fb, complete genome 13503.....................13523100
AY394988.1 SARS coronavirus JMD, partial genome 13459.....................13479100
AY394989.1 SARS coronavirus HZS2-D, complete genome 13530.....................13550100
AY394990.1 SARS coronavirus HZS2-E, complete genome 13530.....................13550100
AY394991.1 SARS coronavirus HZS2-Fc, complete genome 13530.....................13550100
AY394992.1 SARS coronavirus HZS2-C, complete genome 13530.....................13550100
AY394993.1 SARS coronavirus HGZ8L2, complete genome 13530.....................13550100
AY394994.1 SARS coronavirus HSZ-Bc, complete genome 13530.....................13550100
AY394995.1 SARS coronavirus HSZ-Cc, complete genome 13530.....................13550100
AY394996.1 SARS coronavirus ZS-B, complete genome 13530.....................13550100
AY394997.1 SARS coronavirus ZS-A, complete genome 13530.....................13550100
AY394998.1 SARS coronavirus LC1, complete genome 13530.....................13550100
AY394999.1 SARS coronavirus LC2, complete genome 13530.....................13550100
AY395000.1 SARS coronavirus LC3, complete genome 13530.....................13550100
AY395001.1 SARS coronavirus LC4, complete genome 13530.....................13550100
AY395002.1 SARS coronavirus LC5, complete genome 13530.....................13550100
AY395003.1 SARS coronavirus ZS-C, complete genome 13494.....................13514100
AY395004.1 SARS coronavirus HZS2-Bb, partial genome 13498.....................13518100
AY313906.1 SARS coronavirus GD69, complete genome 13545.....................13565100
AY350750.1 SARS coronavirus PUMC01, complete genome 13532.....................13552100
AY357075.1 SARS coronavirus PUMC02, complete genome 13531.....................13551100
AY357076.1 SARS coronavirus PUMC03, complete genome 13531.....................13551100
AY282752.2 SARS coronavirus CUHK-Su10, complete genome 13530.....................13550100
AY461660.1 SARS coronavirus SoD, complete genome 13530.....................13550100
AY485277.1 SARS coronavirus Sino1-11, complete genome 13545.....................13565100
AY485278.1 SARS coronavirus Sino3-11, complete genome 13545.....................13565100
AY463059.1 SARS coronavirus ShanghaiQXC1, complete genome 13466.....................13486100
AY463060.1 SARS coronavirus ShanghaiQXC2, complete genome 12887.....................12907100
AY502923.1 SARS coronavirus TW10, complete genome 13545.....................13565100
AY502924.1 SARS coronavirus TW11, complete genome 13545.....................13565100
AY502925.1 SARS coronavirus TW2, complete genome 13545.....................13565100
AY502926.1 SARS coronavirus TW3, complete genome 13545.....................13565100
AY502927.1 SARS coronavirus TW4, complete genome 13545.....................13565100
AY502928.1 SARS coronavirus TW5, complete genome 13545.....................13565100
AY502929.1 SARS coronavirus TW6, complete genome 13545.....................13565100
AY502930.1 SARS coronavirus TW7, complete genome 13545.....................13565100
AY502931.1 SARS coronavirus TW8, complete genome 13545.....................13565100
AY502932.1 SARS coronavirus TW9, complete genome 13545.....................13565100
AY394850.2 SARS coronavirus WHU, complete genome 13545.....................13565100
AY508724.1 SARS coronavirus NS-1, complete genome 13529.....................13549100
AY390556.1 SARS coronavirus GZ02, complete genome 13545.....................13565100
AY515512.1 SARS coronavirus HC/SZ/61/03, complete genome 13522.....................13542100
AY545914.1 SARS coronavirus isolate HC/SZ/79/03, complete genome 13522.....................13542100
AY545915.1 SARS coronavirus isolate HC/SZ/DM1/03, complete genome 13513.....................13533100
AY545916.1 SARS coronavirus isolate HC/SZ/266/03, complete genome 13511.....................13531100
AY545917.1 SARS coronavirus isolate HC/GZ/81/03, complete genome 13509.....................13529100
AY545918.1 SARS coronavirus isolate HC/GZ/32/03, complete genome 13511.....................13531100
AY545919.1 SARS coronavirus isolate CFB/SZ/94/03, complete genome 13524.....................13544100
AY559081.1 SARS coronavirus Sin842, complete genome 13532.....................13552100
AY559082.1 SARS coronavirus Sin852, complete genome 13544.....................13564100
AY559083.1 SARS coronavirus Sin3408, complete genome 13579.....................13599100
AY559084.1 SARS coronavirus Sin3765V, complete genome 13529.....................13549100
AY559085.1 SARS coronavirus Sin848, complete genome 13529.....................13549100
AY559086.1 SARS coronavirus Sin849, complete genome 13529.....................13549100
AY559087.1 SARS coronavirus Sin3725V, complete genome 13529.....................13549100
AY559088.1 SARS coronavirus SinP1, complete genome 13530.....................13550100
AY559089.1 SARS coronavirus SinP2, complete genome 13532.....................13552100
AY559090.1 SARS coronavirus SinP3, complete genome 13538.....................13558100
AY559091.1 SARS coronavirus SinP4, complete genome 13529.....................13549100
AY559092.1 SARS coronavirus SinP5, complete genome 13529.....................13549100
AY559093.1 SARS coronavirus Sin845, complete genome 13529.....................13549100
AY559094.1 SARS coronavirus Sin846, complete genome 13531.....................13551100
AY559095.1 SARS coronavirus Sin847, complete genome 13535.....................13555100
AY559096.1 SARS coronavirus Sin850, complete genome 13537.....................13557100
AY559097.1 SARS coronavirus Sin3408L, complete genome 13530.....................13550100
AY568539.1 SARS coronavirus GZ0401, complete genome 13495.....................13515100
AY595412.1 SARS coronavirus LLJ-2004, complete genome 13523.....................13543100
AY654624.1 SARS coronavirus TJF, complete genome 13544.....................13564100
AY572034.1 SARS coronavirus civet007, complete genome 13519.....................13539100
AY572035.1 SARS coronavirus civet010, complete genome 13497.....................13517100
AY572038.1 SARS coronavirus civet020, complete genome 13474.....................13494100
AY714217.1 SARS Coronavirus CDC#200301157, complete genome 13545.....................13565100
AY613947.1 SARS coronavirus GZ0402, complete genome 13495.....................13515100
AY613948.1 SARS coronavirus PC4-13, complete genome 13495.....................13515100
AY613949.1 SARS coronavirus PC4-136, complete genome 13495.....................13515100
AY613950.1 SARS coronavirus PC4-227, complete genome 13495.....................13515100
AY686864.1 SARS coronavirus B039, complete genome 13504.....................13524100
CQ918584.1 Sequence 1 from Patent WO2004096842 13530.....................13550100
CQ918585.1 Sequence 2 from Patent WO2004096842 13530.....................13550100
CQ918598.1 Sequence 15 from Patent WO2004096842 13545.....................13565100
AY686863.1 SARS coronavirus A022, complete genome 13494.....................13514100
AY772062.1 SARS coronavirus WH20, complete genome 13555.....................13575100
CS079026.1 Sequence 14 from Patent WO2005035556 13545.....................13565100
CS079027.1 Sequence 15 from Patent WO2005035556 13545.....................13565100
CS079028.1 Sequence 16 from Patent WO2005035556 13545.....................13565100
CS079029.1 Sequence 17 from Patent WO2005035556 13530.....................13550100
AY864805.1 SARS coronavirus BJ162, complete genome 13545.....................13565100
AY864806.1 SARS coronavirus BJ202, complete genome 13545.....................13565100
DQ084199.1 bat SARS coronavirus HKU3-2, complete genome 13507.....................13527100
DQ084199.1 bat SARS coronavirus HKU3-2, complete genome 3057_............________306857
DQ084200.1 bat SARS coronavirus HKU3-3, complete genome 13507.....................13527100
DQ084200.1 bat SARS coronavirus HKU3-3, complete genome 3057_............________306857
DQ071615.1 Bat SARS coronavirus Rp3, complete genome 13539.....................13559100
DQ182595.1 SARS coronavirus ZJ0301 from China, complete genome 13529.....................13549100
DQ022305.2 Bat SARS coronavirus HKU3-1, complete genome 13524.....................13544100
DQ022305.2 Bat SARS coronavirus HKU3-1, complete genome 3074_............________308557
CS254197.1 Sequence 67 from Patent WO2004011647 13545.....................13565100
DQ412043.1 Bat SARS coronavirus Rm1, complete genome 13559.....................13579100
DQ412043.1 Bat SARS coronavirus Rm1, complete genome 3073_............________308457
AB257344.1 SARS coronavirus Frankfurt 1 genomic RNA, nearly complete genome, clo13504.....................13524100
DQ497008.1 SARS coronavirus strain MA-15, complete genome 13545.....................13565100
DQ640652.1 SARS coronavirus GDH-BJH01, complete genome 13551.....................13571100
DQ648856.1 Bat coronavirus (BtCoV/273/2005), complete genome 13529.....................13549100
DQ648856.1 Bat coronavirus (BtCoV/273/2005), complete genome 3076_............________308757
DQ648857.1 Bat coronavirus (BtCoV/279/2005), complete genome 13562.....................13582100
DQ648857.1 Bat coronavirus (BtCoV/279/2005), complete genome 3076_............________308757
DQ898174.1 SARS coronavirus strain CV7, complete genome 13545.....................13565100
CS569493.1 Sequence 1 from Patent WO2006039656 13545.....................13565100
EU371559.1 SARS coronavirus ZJ02, complete genome 13545.....................13565100
EU371560.1 SARS coronavirus BJ182a, complete genome 13545.....................13565100
EU371561.1 SARS coronavirus BJ182b, complete genome 13545.....................13565100
EU371562.1 SARS coronavirus BJ182-4, complete genome 13545.....................13565100
EU371563.1 SARS coronavirus BJ182-8, complete genome 13545.....................13565100
EU371564.1 SARS coronavirus BJ182-12, complete genome 13545.....................13565100
FJ882963.1 SARS coronavirus P2, complete genome 13526.....................13546100
FJ588686.1 Bat SARS CoV Rs672/2006, complete genome 12947.....................12967100
FJ959407.1 SARS coronavirus isolate A001, complete genome 13474.....................13494100
FJ882926.1 SARS coronavirus ExoN1, complete genome 13513.....................13533100
FJ882927.1 SARS coronavirus wtic-MB isolate P1pp1, complete genome 13525.....................13545100
FJ882928.1 SARS coronavirus ExoN1 isolate P1pp1, complete genome 13525.....................13545100
FJ882929.1 SARS coronavirus ExoN1 isolate P3pp1, complete genome 13524.....................13544100
FJ882930.1 SARS coronavirus ExoN1, complete genome 13525.....................13545100
FJ882931.1 SARS coronavirus ExoN1 isolate P3pp12, complete genome 13505.....................13525100
FJ882932.1 SARS coronavirus wtic-MB isolate P3pp14, complete genome 13505.....................13525100
FJ882933.1 SARS coronavirus wtic-MB isolate P3pp6, complete genome 13507.....................13527100
FJ882934.1 SARS coronavirus wtic-MB isolate P3pp29, complete genome 13505.....................13525100
FJ882935.1 SARS coronavirus wtic-MB isolate P3pp21, complete genome 13506.....................13526100
FJ882936.1 SARS coronavirus wtic-MB isolate P3pp2, complete genome 13505.....................13525100
FJ882937.1 SARS coronavirus wtic-MB isolate P3pp18, complete genome 13507.....................13527100
FJ882938.1 SARS coronavirus wtic-MB, complete genome 13525.....................13545100
FJ882939.1 SARS coronavirus wtic-MB isolate P3pp16, complete genome 13505.....................13525100
FJ882940.1 SARS coronavirus ExoN1 isolate P3pp37, complete genome 13505.....................13525100
FJ882941.1 SARS coronavirus ExoN1 isolate P3pp8, complete genome 13524.....................13544100
FJ882942.1 SARS coronavirus MA15 ExoN1 isolate P3pp5, complete genome 13538.....................13558100
FJ882943.1 SARS coronavirus MA15 ExoN1, complete genome 13538.....................13558100
FJ882944.1 SARS coronavirus ExoN1 isolate P3pp23, complete genome 13487.....................13507100
FJ882945.1 SARS coronavirus MA15 isolate P3pp6, complete genome 13538.....................13558100
FJ882946.1 SARS coronavirus wtic-MB isolate P3pp13, complete genome 13506.....................13526100
FJ882947.1 SARS coronavirus wtic-MB isolate P3pp7, complete genome 13505.....................13525100
FJ882948.1 SARS coronavirus MA15 isolate P3pp3, complete genome 13538.....................13558100
FJ882949.1 SARS coronavirus wtic-MB isolate P3pp23, complete genome 13506.....................13526100
FJ882950.1 SARS coronavirus ExoN1 isolate P3pp60, complete genome 13505.....................13525100
FJ882951.1 SARS coronavirus MA15 ExoN1 isolate P3pp3, complete genome 13538.....................13558100
FJ882952.1 SARS coronavirus MA15 isolate P3pp4, complete genome 13538.....................13558100
FJ882953.1 SARS coronavirus MA15 ExoN1 isolate P3pp4, complete genome 13507.....................13527100
FJ882954.1 SARS coronavirus ExoN1 isolate P3pp46, complete genome 13498.....................13518100
FJ882955.1 SARS coronavirus ExoN1 isolate P3pp19, complete genome 13505.....................13525100
FJ882956.1 SARS coronavirus ExoN1 isolate P3pp53, complete genome 13505.....................13525100
FJ882957.1 SARS coronavirus MA15, complete genome 13538.....................13558100
FJ882958.1 SARS coronavirus MA15 isolate P3pp7, complete genome 13538.....................13558100
FJ882959.1 SARS coronavirus MA15 ExoN1 isolate P3pp6, complete genome 13538.....................13558100
FJ882960.1 SARS coronavirus ExoN1 isolate P3pp34, complete genome 13505.....................13525100
FJ882961.1 SARS coronavirus MA15 isolate P3pp5, complete genome 13538.....................13558100
FJ882962.1 SARS coronavirus MA15 ExoN1 isolate P3pp10, complete genome 13538.....................13558100
GU553363.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00001, complete genom13505.....................13525100
GU553364.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00002, complete genom13505.....................13525100
GU553365.1 SARS coronavirus HKU-39849 isolate TCVSP-HARROD-00003, complete genom13505.....................13525100
GQ153539.1 Bat SARS coronavirus HKU3-4, complete genome 13524.....................13544100
GQ153539.1 Bat SARS coronavirus HKU3-4, complete genome 3074_............________308557
GQ153540.1 Bat SARS coronavirus HKU3-5, complete genome 13524.....................13544100
GQ153540.1 Bat SARS coronavirus HKU3-5, complete genome 3074_............________308557
GQ153541.1 Bat SARS coronavirus HKU3-6, complete genome 13524.....................13544100
GQ153541.1 Bat SARS coronavirus HKU3-6, complete genome 3074_............________308557
GQ153542.1 Bat SARS coronavirus HKU3-7, complete genome 13536.....................13556100
GQ153542.1 Bat SARS coronavirus HKU3-7, complete genome 3074_............aa.t..c.309376
GQ153543.1 Bat SARS coronavirus HKU3-8, complete genome 13536.....................13556100
GQ153543.1 Bat SARS coronavirus HKU3-8, complete genome 3074_............aa.t..c.309376
GQ153544.1 Bat SARS coronavirus HKU3-9, complete genome 13515.....................13535100
GQ153544.1 Bat SARS coronavirus HKU3-9, complete genome 3074_............________308557
GQ153545.1 Bat SARS coronavirus HKU3-10, complete genome 13515.....................13535100
GQ153545.1 Bat SARS coronavirus HKU3-10, complete genome 3074_............________308557
GQ153546.1 Bat SARS coronavirus HKU3-11, complete genome 13515.....................13535100
GQ153546.1 Bat SARS coronavirus HKU3-11, complete genome 3074_............________308557
GQ153547.1 Bat SARS coronavirus HKU3-12, complete genome 13524.....................13544100
GQ153547.1 Bat SARS coronavirus HKU3-12, complete genome 3074_............________308557
GQ153548.1 Bat SARS coronavirus HKU3-13, complete genome 13497.....................13517100
GQ153548.1 Bat SARS coronavirus HKU3-13, complete genome 3056_............________306757
HQ890526.1 SARS coronavirus MA15 ExoN1 isolate d2ym1, complete genome 13505.....................13525100
HQ890527.1 SARS coronavirus MA15 ExoN1 isolate d2ym2, complete genome 13505.....................13525100
HQ890528.1 SARS coronavirus MA15 ExoN1 isolate d2ym3, complete genome 13505.....................13525100
HQ890529.1 SARS coronavirus MA15 ExoN1 isolate d2ym4, complete genome 13505.....................13525100
HQ890530.1 SARS coronavirus MA15 ExoN1 isolate d2ym5, complete genome 13505.....................13525100
HQ890531.1 SARS coronavirus MA15 ExoN1 isolate d4ym1, complete genome 13505.....................13525100
HQ890532.1 SARS coronavirus MA15 ExoN1 isolate d4ym2, complete genome 13505.....................13525100
HQ890533.1 SARS coronavirus MA15 ExoN1 isolate d4ym3, complete genome 13505.....................13525100
HQ890534.1 SARS coronavirus MA15 ExoN1 isolate d2om1, complete genome 13505.....................13525100
HQ890535.1 SARS coronavirus MA15 ExoN1 isolate d2om2, complete genome 13505.....................13525100
HQ890536.1 SARS coronavirus MA15 ExoN1 isolate d2om3, complete genome 13505.....................13525100
HQ890537.1 SARS coronavirus MA15 ExoN1 isolate d2om4, complete genome 13505.....................13525100
HQ890538.1 SARS coronavirus MA15 ExoN1 isolate d2om5, complete genome 13505.....................13525100
HQ890539.1 SARS coronavirus MA15 ExoN1 isolate d3om1, complete genome 13505.....................13525100
HQ890540.1 SARS coronavirus MA15 ExoN1 isolate d3om2, complete genome 13505.....................13525100
HQ890541.1 SARS coronavirus MA15 isolate d2ym1, complete genome 13505.....................13525100
HQ890542.1 SARS coronavirus MA15 isolate d2om1, complete genome 13505.....................13525100
HQ890543.1 SARS coronavirus MA15 isolate d2om2, complete genome 13505.....................13525100
HQ890544.1 SARS coronavirus MA15 isolate d2om3, complete genome 13505.....................13525100
HQ890545.1 SARS coronavirus MA15 isolate d2om4, complete genome 13505.....................13525100
HQ890546.1 SARS coronavirus MA15 isolate d2om5, complete genome 13505.....................13525100
JF292902.1 SARS coronavirus MA15 ExoN1 isolate d4ym4, complete genome 13505.....................13525100
JF292903.1 SARS coronavirus MA15 ExoN1 isolate d4ym5, complete genome 13505.....................13525100
JF292904.1 SARS coronavirus MA15 ExoN1 isolate d3om3, complete genome 13505.....................13525100
JF292905.1 SARS coronavirus MA15 ExoN1 isolate d3om4, complete genome 13505.....................13525100
JF292906.1 SARS coronavirus MA15 ExoN1 isolate d3om5, complete genome 13505.....................13525100
JF292907.1 SARS coronavirus MA15 isolate d2ym2, complete genome 13505.....................13525100
JF292908.1 SARS coronavirus MA15 isolate d2ym3, complete genome 13505.....................13525100
JF292909.1 SARS coronavirus MA15 isolate d2ym4, complete genome 13505.....................13525100
JF292910.1 SARS coronavirus MA15 isolate d2ym5, complete genome 13505.....................13525100
JF292911.1 SARS coronavirus MA15 isolate d4ym1, complete genome 13505.....................13525100
JF292912.1 SARS coronavirus MA15 isolate d4ym2, complete genome 13505.....................13525100
JF292913.1 SARS coronavirus MA15 isolate d4ym3, complete genome 13505.....................13525100
JF292914.1 SARS coronavirus MA15 isolate d4ym4, complete genome 13505.....................13525100
JF292915.1 SARS coronavirus MA15 isolate d4ym5, complete genome 13505.....................13525100
JF292916.1 SARS coronavirus MA15 isolate d3om1, complete genome 13505.....................13525100
JF292917.1 SARS coronavirus MA15 isolate d3om2, complete genome 13505.....................13525100
JF292918.1 SARS coronavirus MA15 isolate d3om3, complete genome 13505.....................13525100
JF292919.1 SARS coronavirus MA15 isolate d3om4, complete genome 13505.....................13525100
JF292920.1 SARS coronavirus MA15 isolate d3om5, complete genome 13505.....................13525100
JF292921.1 SARS coronavirus wtic-MB isolate c1P1, complete genome 13505.....................13525100
JF292922.1 SARS coronavirus ExoN1 isolate c5P1, complete genome 13505.....................13525100
DQ412042.1 Bat SARS coronavirus Rf1, complete genome 13526........a............1354695
DQ412042.1 Bat SARS coronavirus Rf1, complete genome 3073_............________308457