../../tmp/servers/virsirnadb/2019322840
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18481aaggccatcgatgctggattt21
NC_009334.1 Human herpesvirus 4, complete genome 137074.....................137094100
NC_009334.1 Human herpesvirus 4, complete genome 125606_______..c.........c.12559357
NC_009334.1 Human herpesvirus 4, complete genome 158817____..g.a.........___15883057
NC_009334.1 Human herpesvirus 4, complete genome 74777..........t._________7476652
NC_009334.1 Human herpesvirus 4, complete genome 111467_________..........g.11145652
NC_009334.1 Human herpesvirus 4, complete genome 145736_________..a.........14574752
NC_009334.1 Human herpesvirus 4, complete genome 147012_________..g.........14702352
NC_009334.1 Human herpesvirus 4, complete genome 2136___________..........212747
NC_009334.1 Human herpesvirus 4, complete genome 59615..........___________5960647
NC_009334.1 Human herpesvirus 4, complete genome 71293_______..........____7128447
NC_009334.1 Human herpesvirus 4, complete genome 103592..........___________10360147
NC_009334.1 Human herpesvirus 4, complete genome 69774_____..at.........a._6976057
NC_009334.1 Human herpesvirus 4, complete genome 131698_____.c.g.........___13168652
NC_009334.1 Human herpesvirus 4, complete genome 155810.........a.__________15580047
NC_009334.1 Human herpesvirus 4, complete genome 57095_.........___________5708742
NC_009334.1 Human herpesvirus 4, complete genome 63723.........____________6373142
NC_009334.1 Human herpesvirus 4, complete genome 69320__.........__________6932842
NC_009334.1 Human herpesvirus 4, complete genome 69738_.........___________6973042
NC_009334.1 Human herpesvirus 4, complete genome 133396____________.........13338842
NC_009334.1 Human herpesvirus 4, complete genome 163799__.........__________16379142
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 124698_______..c.........c.12468557
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 74661..........t._________7465052
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 80368_________..a.........8035752
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 110556_________..........g.11054552
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 2136___________..........212747
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 59503..........___________5949447
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 71177_______..........____7116847
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 102680..........___________10268947
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 69657_____..at.........a._6964357
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 56914_.........___________5690642
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 63605.........____________6361342
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 69203__.........__________6921142
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 69621_.........___________6961342