../../tmp/servers/virsirnadb/213208074
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi11241aaggtcttacataagaggact21
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 1644.....................1664100
X01587.1 Hepatitis B virus subtype adr4 (HBV) 1516.....................1536100
X14193.1 Hepatitis B virus DNA for adr mutant 1641.....................1661100
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 1644.....................1664100
X02763.1 Hepatitis b virus genome (serotype adw2) 3053.....................3073100
X65257.1 Hepatitis B virus (ayw,patient C) PreS1, PreS2, PreC, C, X and polyme1646.....................1666100
X65258.1 Hepatitis B virus (ayw,patient CI) genes PreS1, PreS2, PreC, C, X and1646.....................1666100
X68292.1 Hepatitis B Virus DNA 1646.....................1666100
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 1644.....................1664100
V01460.1 Hepatitis B virus (strain ayw) genome 1541.....................1521100
X02496.1 Human hepatitis B virus strain ayw variant 1646.....................1666100
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 1518.....................1538100
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 1644.....................1664100
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 1646.....................1666100
X59795.1 Hepatitis B virus (ayw subtype mutant) complete genome 1625.....................1645100
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 1641.....................1661100
M32138.1HPBHBVAA Hepatitis B virus variant HBV-alpha1, complete genome 1646.....................1666100
X75657.1 Human hepatitis virus (genotype E, Bas) preS1, preS2, S, C, X, antige1644.....................1664100
X75664.1 Human hepatitis virus (genotype E, Kou) preS1, preS2, S, C, X, antige1644.....................1664100
Z35716.1 Human hepatitis B virus (ayw4) genes for surface protein S, core prot1646.....................1666100
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot1646.....................1666100
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 1646.....................1666100
D23682.1HPBB5HKO1 Hepatitis B virus (B5-HBVKO1) complete genome sequence 1644.....................1664100
D23683.1HPBC5HKO2 Hepatitis B virus (C5-HBVKO2) complete genome sequence 1644.....................1664100
X85254.1 Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polym1646.....................1666100
D50489.1HPBA11A Hepatitis B virus DNA, complete genome, isolate:A11 1646.....................1666100
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete1646.....................1666100
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete1646.....................1666100
X80924.1 Hepatitis B virus (patient 4) complete genome 1646.....................1666100
X80926.1 Hepatitis B virus (patient 5) complete genome 1646.....................1666100
X51970.1 Hepatitis B virus (HBV 991) complete genome 1644.....................1664100
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes1644.....................1664100
Z72479.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes1644.....................1664100
X97848.1 Hepatitis B virus (patient 2) complete genome 1646.....................1666100
X97849.1 Hepatitis B virus (patient 3) complete genome 1646.....................1666100
Y07587.1 Hepatitis B virus, complete genome 1646.....................1666100
U95551.1 Hepatitis B virus subtype ayw, complete genome 1646.....................1666100
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 1596.....................1616100
AB014363.1 Hepatitis B virus genomic DNA, complete sequence, isolate 04D04HCC 1644.....................1664100
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 1644.....................1664100
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 1644.....................1664100
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 1596.....................1616100
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 1644.....................1664100
AB014372.1 Hepatitis B virus genomic DNA, complete sequence, isolate 13D13HCC 1644.....................1664100
AB014375.1 Hepatitis B virus genomic DNA, complete sequence, isolate 16T01HCC 1599.....................1619100
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 1644.....................1664100
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 1644.....................1664100
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 1605.....................1625100
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 1644.....................1664100
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 1644.....................1664100
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 1644.....................1664100
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 1644.....................1664100
AB014397.1 Hepatitis B virus genomic DNA, complete sequence, isolate 38Y20HCC 1614.....................1634100
AB014398.1 Hepatitis B virus genomic DNA, complete sequence, isolate 39Y21HCC 1596.....................1616100
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 1644.....................1664100
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 1646.....................1666100
AF068756.1 Hepatitis B virus, complete genome 1647.....................1667100
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 1641.....................1661100
AF143298.1 Hepatitis B virus clone 7720-G8, complete genome 2989.....................3009100
AF143299.1 Hepatitis B virus clone 7744-G9, complete genome 2872.....................2892100
AF143300.1 Hepatitis B virus clone 7832-G4, complete genome 2887.....................2907100
AF143301.1 Hepatitis B virus clone BW1903, complete genome 2857.....................2877100
AF143301.1 Hepatitis B virus clone BW1903, complete genome 2885..t..................290595
AF143302.1 Hepatitis B virus clone HD1402, complete genome 2956.....................2976100
AF143303.1 Hepatitis B virus clone HD1406, complete genome 2956.....................2976100
AF143304.1 Hepatitis B virus clone HD319, complete genome 2965.....................2985100
AF143306.1 Hepatitis B virus clone RM517, complete genome 2966.....................2986100
AF143307.1 Hepatitis B virus clone RM518, complete genome 2791.....................2811100
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 271.....................291100
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 271.....................291100
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 271.....................291100
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 271.....................291100
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 271.....................291100
AF151735.1 Hepatitis B virus, complete genome 1644.....................1664100
AB031262.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietA-31644.....................1664100
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-21644.....................1664100
AB031267.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-61644.....................1664100
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 1646.....................1666100
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 1646.....................1666100
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 1642.....................1662100
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 1642.....................1662100
AB026815.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 2:full 1642.....................1662100
AB033550.1 Hepatitis B virus DNA, complete genome 1644.....................1664100
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 1644.....................1664100
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 1644.....................1664100
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 1644.....................1664100
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 1644.....................1664100
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 1644.....................1664100
AB010292.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-4 1644.....................1664100
AB032431.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV/E-Ch1951644.....................1664100
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch2581644.....................1664100
AF121239.1 Hepatitis B virus isolate HBV/1303, complete genome 1644.....................1664100
AF121240.1 Hepatitis B virus isolate HBV/11066, complete genome 1644.....................1664100
AF121241.1 Hepatitis B virus isolate HBV/1758, complete genome 1644.....................1664100
AF280817.1 Hepatitis B virus DNA, complete sequence, isolate: HBV-D1 1644.....................1664100
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 1646.....................1666100
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 1646.....................1666100
AF182805.1 Hepatitis B virus strain WLAID, complete genome 1613.....................1633100
AF241410.1 Hepatitis B virus isolate 3270, complete genome 1644.....................1664100
AF241411.1 Hepatitis B virus isolate 8290, complete genome 1644.....................1664100
AB050018.1 Hepatitis B virus DNA, complete genome 1644.....................1664100
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 1644.....................1664100
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 1644.....................1664100
AJ132335.1 Hepatitis B Virus complete genome, isolate PES1 1644.....................1664100
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 1644.....................1664100
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 1644.....................1664100
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 1644.....................1664100
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 1644.....................1664100
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 1644.....................1664100
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 1644.....................1664100
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 1644.....................1664100
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 1644.....................1664100
AF223961.1 Hepatitis B virus strain C-1858 isolate ea8, complete genome 1644.....................1664100
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 1644.....................1664100
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1644.....................1664100
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1644.....................1664100
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 1644.....................1664100
AF363961.1 Hepatitis B virus strain G683-1, complete genome 3039.....................3059100
AF363962.1 Hepatitis B virus strain G683-2, complete genome 3006.....................3026100
AF363963.1 Hepatitis B virus strain G683-3, complete genome 3038.....................3058100
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 3039.....................3059100
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 2949.....................2969100
AY040627.1 Hepatitis B virus genotype C, complete genome 1644.....................1664100
AJ309369.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 101644.....................1664100
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 111644.....................1664100
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 111644.....................1664100
AF297619.1 Hepatitis B virus adw2, complete genome 1644.....................1664100
AF297620.1 Hepatitis B virus adw1, complete genome 1644.....................1664100
AF297621.1 Hepatitis B virus isolate 78, complete genome 1644.....................1664100
AF297622.1 Hepatitis B virus isolate 79, complete genome 1644.....................1664100
AF297623.1 Hepatitis B virus isolate 83, complete genome 1593.....................1613100
AF297624.1 Hepatitis B virus isolate 80, complete genome 1644.....................1664100
AF297625.1 Hepatitis B virus isolate 84, complete genome 1644.....................1664100
AF411409.1 Hepatitis B virus strain FMC#16, complete genome 1646.....................1666100
AF411412.1 Hepatitis B virus strain FMC#15, complete genome 1646.....................1666100
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 1644.....................1664100
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 1644.....................1664100
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 1644.....................1664100
AF458664.1 Hepatitis B virus isolate C84, complete genome 1646.....................1666100
AF458665.1 Hepatitis B virus isolate C733, complete genome 1646.....................1666100
AF461357.1 Hepatitis B virus isolate FH5, compete genome 1646.....................1666100
AF461358.1 Hepatitis B virus isolate FH8, compete genome 1646.....................1666100
AF461359.1 Hepatitis B virus isolate c16, compete genome 1646.....................1666100
AF461363.1 Hepatitis B virus isolate C8, compete genome 1646.....................1666100
AF461043.1 Hepatitis B virus, complete genome 1644.....................1664100
AF462041.1 Hepatitis B virus clone pAM6, complete genome 1644.....................1664100
AJ344116.1 Hepatitis B virus complete genome, genotype D, isolate GX27 1644.....................1664100
AJ344117.1 Hepatitis B virus complete genome, genotype D 1644.....................1664100
AF473543.1 Hepatitis B virus isolate 2e, complete genome 1644.....................1664100
U87742.3 Hepatitis B virus isolate 7983, complete genome 1649.....................1669100
AB073835.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi29 1644.....................1664100
AB073842.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw11 1644.....................1664100
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 1644.....................1664100
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 1644.....................1664100
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 1644.....................1664100
AY090452.1 Hepatitis B virus strain Z29, complete genome 1647.....................1667100
AY090453.1 Hepatitis B virus strain 14-94, complete genome 1647.....................1667100
AY123424.1 Hepatitis B virus, complete genome 1646.....................1666100
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro1644.....................1664100
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro1644.....................1664100
AY128092.1 Hepatitis B virus clone pEco63, complete genome 1646.....................1666100
AF286594.1 Hepatitis B virus subtype adr, complete genome 1644.....................1664100
AF536524.1 Hepatitis B virus clone 2A, complete genome 1644.....................1664100
AF533983.1 Hepatitis B virus genotype C, complete genome 1644.....................1664100
AF537371.1 Hepatitis B virus clone 3.4, complete genome 1644.....................1664100
AF537372.1 Hepatitis B virus clone 4B, complete genome 1644.....................1664100
AF418679.1 Hepatitis B virus patient 821 clone 1, complete genome 1646.....................1666100
AF418680.1 Hepatitis B virus patient 821 clone 2, complete genome 1646.....................1666100
AF418681.1 Hepatitis B virus patient 821 clone 3, complete genome 1646.....................1666100
AF418682.1 Hepatitis B virus patient 4727 clone 1, complete genome 1646.....................1666100
AF418683.1 Hepatitis B virus patient 4727 clone 2, complete genome 1646.....................1666100
AY152726.1 Hepatitis B virus isolate 8.22, complete genome 1644.....................1664100
AY161138.1 Hepatitis B virus clone S1.1 complete genome 1647.....................1667100
AY161139.1 Hepatitis B virus clone S1.2 complete genome 1644.....................1664100
AY161145.1 Hepatitis B virus clone S4.1 complete genome 1644.....................1664100
AY161146.1 Hepatitis B virus clone S4.2 complete genome 1644.....................1664100
AY161150.1 Hepatitis B virus clone S6.1 complete genome 1644.....................1664100
AY161151.1 Hepatitis B virus clone S6.2, complete genome 1644.....................1664100
AY161152.1 Hepatitis B virus clone S6.3, complete genome 1644.....................1664100
AY161153.1 Hepatitis B virus clone S6.4 complete genome 1644.....................1664100
AY161154.1 Hepatitis B virus clone S6.5, complete genome 1644.....................1664100
AY161155.1 Hepatitis B virus clone S6.6, complete genome 1644.....................1664100
AY161156.1 Hepatitis B virus clone S6.7, complete genome 1644.....................1664100
AY161159.1 Hepatitis B virus clone S8.1 complete genome 1644.....................1664100
AY161160.1 Hepatitis B virus clone S8.2 complete genome 1644.....................1664100
AY161161.1 Hepatitis B virus clone S9.1 complete genome 1644.....................1664100
AY161162.1 Hepatitis B virus clone S9.2 complete genome 1644.....................1664100
AY161163.1 Hepatitis B virus clone S9.3 complete genome 1644.....................1664100
AY148342.1 Hepatitis B virus, complete genome 3008.....................3028100
AB078032.1 Hepatitis B virus complete genome, isolate:AH1-SY 1644.....................1664100
AB090268.1 Hepatitis B virus DNA, complete genome, strain:CH1-OHs 1644.....................1664100
AB090269.1 Hepatitis B virus DNA, complete genome, strain:CH2-OHf 1644.....................1664100
AB090270.1 Hepatitis B virus DNA, complete genome, strain:b-dono12 1644.....................1664100
AB091255.1 Hepatitis B virus DNA, complete genome, isplate:ABI-129 1644.....................1664100
AB091256.1 Hepatitis B virus DNA, complete genome, isplate:ABI-212 1644.....................1664100
AY217371.1 Hepatitis B virus isolate 1-7, complete genome 1644.....................1664100
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 1626.....................1646100
AY217373.1 Hepatitis B virus isolate 594, complete genome 1648.....................1668100
AY217374.1 Hepatitis B virus isolate 595, complete genome 1630.....................1650100
AY217375.1 Hepatitis B virus isolate 599, complete genome 1644.....................1664100
AY217375.1 Hepatitis B virus isolate 599, complete genome 1676___..................169385
AY217376.1 Hepatitis B virus isolate Q1-1, complete genome 1644.....................1664100
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 1645.....................1665100
AB106564.1 Hepatitis B virus DNA, complete genome, isolate:HBV-GA325 1644.....................1664100
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 1644.....................1664100
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 1644.....................1664100
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 1644.....................1664100
AY206376.1 Hepatitis B virus strain FMU005 complete genome 1646.....................1666100
AY206378.1 Hepatitis B virus strain FMU007 complete genome 1610.....................1630100
AY206379.1 Hepatitis B virus strain FMU008 complete genome 1646.....................1666100
AY206381.1 Hepatitis B virus strain FMU010 complete genome 1646.....................1666100
AY206382.1 Hepatitis B virus strain FMU011 complete genome 1646.....................1666100
AY206384.1 Hepatitis B virus strain FMU013 complete genome 1646.....................1666100
AY206388.1 Hepatitis B virus strain FMU017 complete genome 1646.....................1666100
AY206389.1 Hepatitis B virus strain FMU018 complete genome 1646.....................1666100
AY206392.1 Hepatitis B virus strain FMU021 complete genome 1646.....................1666100
AY206393.1 Hepatitis B virus strain FMU022 complete genome 1646.....................1666100
AB078031.2 Hepatitis B virus complete genome, isolate:FH1-YS 1644.....................1664100
AB078033.2 Hepatitis B virus complete genome, isolate:IS1-OY 1644.....................1664100
AY220699.1 Hepatitis B virus strain MH15, complete genome 1646.....................1666100
AY220700.1 Hepatitis B virus strain MH534978, complete genome 1646.....................1666100
AY220701.1 Hepatitis B virus strain WJQ310, complete genome 1646.....................1666100
AY306136.1 Hepatitis B virus isolate H85, complete genome 1644.....................1664100
AB104709.1 Hepatitis B virus DNA, complete sequence, isolate: EG64 1646.....................1666100
AB104710.1 Hepatitis B virus DNA, complete sequence, isolate: EG105 1646.....................1666100
AB104711.1 Hepatitis B virus DNA, complete sequence, isolate: EG104 1646.....................1666100
AB104712.1 Hepatitis B virus DNA, complete sequence, isolate: EG75 1646.....................1666100
AY233274.1 Hepatitis B virus isolate 0962 complete genome 1644.....................1664100
AY233275.1 Hepatitis B virus isolate 163 complete genome 1644.....................1664100
AY233276.1 Hepatitis B virus isolate 1839 complete genome 1644.....................1664100
AY233277.1 Hepatitis B virus isolate 1848 complete genome 1644.....................1664100
AY233278.1 Hepatitis B virus isolate 1 complete genome 1644.....................1664100
AY233279.1 Hepatitis B virus isolate 28 complete genome 1644.....................1664100
AY233280.1 Hepatitis B virus isolate 2 complete genome 1644.....................1664100
AY233281.1 Hepatitis B virus isolate 303 complete genome 1644.....................1664100
AY233282.1 Hepatitis B virus isolate 306 complete genome 1644.....................1664100
AY233283.1 Hepatitis B virus isolate 4038 complete genome 1644.....................1664100
AY233284.1 Hepatitis B virus isolate 5283 complete genome 1644.....................1664100
AY233285.1 Hepatitis B virus isolate 795 complete genome 1644.....................1664100
AY233287.1 Hepatitis B virus isolate 8225 complete genome 1644.....................1664100
AY233288.1 Hepatitis B virus isolate 823 complete genome 1644.....................1664100
AY233289.1 Hepatitis B virus isolate 833 complete genome 1644.....................1664100
AY233290.1 Hepatitis B virus isolate 85 complete genome 1644.....................1664100
AY233291.1 Hepatitis B virus isolate 179 complete genome 1644.....................1664100
AY233292.1 Hepatitis B virus isolate 184 complete genome 1644.....................1664100
AY233293.1 Hepatitis B virus isolate 12 complete genome 1644.....................1664100
AY233294.1 Hepatitis B virus isolate 305 complete genome 1644.....................1664100
AY233295.1 Hepatitis B virus isolate 8 complete genome 1644.....................1664100
AY233296.1 Hepatitis B virus isolate 185 complete genome 1644.....................1664100
AY167090.1 Hepatitis B virus isolate Ib, complete genome 1644.....................1664100
AY167095.1 Hepatitis B virus isolate IIc, complete genome 1644.....................1664100
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 1644.....................1664100
AY167099.1 Hepatitis B virus isolate IVb, complete genome 1644.....................1664100
AB115551.1 Hepatitis B virus DNA, complete genome, isolate:HBV-CB15 1644.....................1664100
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co1642.....................1662100
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 161644.....................1664100
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 601644.....................1664100
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 1644.....................1664100
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 1644.....................1664100
AY373431.1 Hepatitis B virus clone SWT.4 complete genome 1644.....................1664100
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 1644.....................1664100
AY236160.1 Hepatitis B virus isolate 1A, complete genome 3006.....................3026100
AY236161.1 Hepatitis B virus isolate 12A, complete genome 3006.....................3026100
AY236162.1 Hepatitis B virus isolate 23 A, complete genome 3006.....................3026100
AY236163.1 Hepatitis B virus isolate 29, complete genome 2988.....................3008100
AY236164.1 Hepatitis B virus isolate 30, complete genome 3006.....................3026100
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 1644.....................1664100
AB126581.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU301 1646.....................1666100
AB111115.1 Hepatitis B virus DNA, complete genome, clone: K5-0 1583.....................1603100
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 1583.....................1603100
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 1721.....................1741100
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 1644.....................1664100
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 1644.....................1664100
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 1644.....................1664100
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 1644.....................1664100
AB111123.1 Hepatitis B virus DNA, complete genome, clone: KM4-12 1644.....................1664100
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 1644.....................1664100
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 1644.....................1664100
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 1644.....................1664100
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 1644.....................1664100
AB112066.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY624 1644.....................1664100
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 1644.....................1664100
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 1635.....................1655100
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 1644.....................1664100
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 1644.....................1664100
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 1644.....................1664100
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 1644.....................1664100
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 1644.....................1664100
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 1644.....................1664100
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 1644.....................1664100
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 1644.....................1664100
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 1644.....................1664100
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 1644.....................1664100
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 1644.....................1664100
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 1644.....................1664100
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 1644.....................1664100
AB116087.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND8 1644.....................1664100
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 1644.....................1664100
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 1644.....................1664100
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 1644.....................1664100
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 1644.....................1664100
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 1644.....................1664100
AB116266.1 Hepatitis B virus DNA, complete genome, strain: Ehime TY:871225 1644.....................1664100
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 1644.....................1664100
AY661792.1 Hepatitis B virus isolate ayw, complete genome 1646.....................1666100
AY661793.1 Hepatitis B virus isolate 2, complete genome 1646.....................1666100
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 1644.....................1664100
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 1644.....................1664100
AB120308.1 Hepatitis B virus DNA, complete genome, strain:Ehime-full 20:IM 820821644.....................1664100
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 1646.....................1666100
AY721605.1 Hepatitis B virus isolate AK1.1, complete genome 1646.....................1666100
AY721606.1 Hepatitis B virus isolate AT1.2, complete genome 1646.....................1666100
AY721607.1 Hepatitis B virus isolate HIY1.3, complete genome 1646.....................1666100
AY721608.1 Hepatitis B virus isolate IB1.4, complete genome 1646.....................1666100
AY721609.1 Hepatitis B virus isolate AA1.5, complete genome 1646.....................1666100
AY721610.1 Hepatitis B virus isolate FK1.6, complete genome 1646.....................1666100
AY721611.1 Hepatitis B virus isolate SK1.7, complete genome 1646.....................1666100
AY721612.1 Hepatitis B virus isolate BL1.8, complete genome 1646.....................1666100
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 1644.....................1664100
AY741794.1 Hepatitis B virus isolate IR-IPI-50, complete genome 1646.....................1666100
AY741795.1 Hepatitis B virus isolate IR-IPI-Hi, complete genome 1646.....................1666100
AY741796.1 Hepatitis B virus isolate IR-IPI-P3, complete genome 1646.....................1666100
AY741797.1 Hepatitis B virus isolate IR-IPI-21, complete genome 1646.....................1666100
AY741798.1 Hepatitis B virus isolate IR-IPI-P4, complete genome 1649.....................1669100
AY641560.1 Hepatitis B virus isolate He100, complete genome 1644.....................1664100
AY641561.1 Hepatitis B virus isolate He127, complete genome 1644.....................1664100
AY641562.1 Hepatitis B virus isolate He82, complete genome 1644.....................1664100
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 1644.....................1664100
AY796030.1 Hepatitis B virus isolate FC1.9, complete genome 1646.....................1666100
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 1646.....................1666100
AY796032.1 Hepatitis B virus isolate NA1.11, complete genome 1646.....................1666100
AB113877.1 Hepatitis B virus DNA, complete genome, strain:HCC-3-TT 1644.....................1664100
AB113879.1 Hepatitis B virus DNA, complete genome, strain:AH-1-ON980424 1644.....................1664100
AB109475.1 Hepatitis B virus DNA, complete genome, strain:Ehime7: Iyo 0218004 1644.....................1664100
AB109476.1 Hepatitis B virus DNA, complete genome, strain:Ehime8: Iyo 8288043 1644.....................1664100
AB109477.1 Hepatitis B virus DNA, complete genome, strain:Ehime9: Iyo 529380 1644.....................1664100
AB109478.1 Hepatitis B virus DNA, complete genome, strain:Ehime10: Iyo 41676 1644.....................1664100
AB109479.1 Hepatitis B virus DNA, complete genome, strain:Ehime11: Iyo 529207 1644.....................1664100
AB110075.1 Hepatitis B virus DNA, complete genome, strain: Ehime12:IM 011025 1644.....................1664100
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 1644.....................1664100
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 1644.....................1664100
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 1644.....................1664100
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 1644.....................1664100
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 1644.....................1664100
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 1644.....................1664100
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 1644.....................1664100
AY739674.1 Hepatitis B virus clone A1-33, complete genome 1644.....................1664100
AY739675.1 Hepatitis B virus clone A1-35, complete genome 1644.....................1664100
AY738139.1 Hepatitis B virus clone A1, complete genome 1644.....................1664100
AY738140.1 Hepatitis B virus clone A2, complete genome 1644.....................1664100
AY738141.1 Hepatitis B virus clone A3, complete genome 1644.....................1664100
AY738142.1 Hepatitis B virus clone A4, complete genome 1644.....................1664100
AY738143.1 Hepatitis B virus clone A11, complete genome 1644.....................1664100
AY738144.1 Hepatitis B virus clone B3, complete genome 1644.....................1664100
AY738145.1 Hepatitis B virus clone B5, complete genome 1644.....................1664100
AY738146.1 Hepatitis B virus clone B9, complete genome 1644.....................1664100
AY738147.1 Hepatitis B virus clone B11, complete genome 1644.....................1664100
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 1644.....................1664100
AB188241.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA25 1644.....................1664100
AB188242.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA38 1644.....................1664100
AB188244.1 Hepatitis B virus DNA, complete genome, isolate:UZ24 1644.....................1664100
AJ748098.1 Hepatitis B virus complete genome, genotype C 1644.....................1664100
AB205118.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ1-1-2 1644.....................1664100
AB205122.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH69-1 1644.....................1664100
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 1644.....................1664100
AB205126.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF714-1 1644.....................1664100
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 1644.....................1664100
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 1644.....................1664100
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 1644.....................1664100
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 1644.....................1664100
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 1644.....................1664100
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 1644.....................1664100
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 1644.....................1664100
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 1644.....................1664100
AP007262.1 HBV genotype E DNA, complete genome, isolate: HB-JI411F 1644.....................1664100
AP007263.1 HBV genotype A DNA, complete genome, isolate: HB-JI444AF 1644.....................1664100
AY903452.1 Hepatitis B virus serotype adw2, complete genome 1644.....................1664100
AY935700.1 Hepatitis B virus isolate TH-HBV-012, complete genome 1644.....................1664100
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 1644.....................1664100
AY934765.1 Hepatitis B virus isolate 24306, complete genome 1644.....................1664100
AY934766.1 Hepatitis B virus isolate 24233, complete genome 1644.....................1664100
AY934767.1 Hepatitis B virus isolate 27178, complete genome 1644.....................1664100
AY934768.1 Hepatitis B virus isolate 25830, complete genome 1644.....................1664100
AY934769.1 Hepatitis B virus isolate 23719, complete genome 1644.....................1664100
AY934770.1 Hepatitis B virus isolate 953642, complete genome 1644.....................1664100
AY934771.1 Hepatitis B virus isolate 27439, complete genome 1644.....................1664100
AY934772.1 Hepatitis B virus isolate 1908, complete genome 1644.....................1664100
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 1644.....................1664100
DQ020002.1 Hepatitis B virus isolate 380, complete genome 1644.....................1664100
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 1644.....................1664100
AB212625.1 Hepatitis B virus DNA, complete genome, isolateVT1026 1644.....................1664100
AB205191.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G166 1644.....................1664100
AB214516.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BL597 1644.....................1664100
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 1644.....................1664100
AB194948.1 Hepatitis B virus DNA, complete genome, isolate: CMR936 1644.....................1664100
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 1644.....................1664100
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 1644.....................1664100
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 1644.....................1664100
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 1611.....................1631100
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 1644.....................1664100
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 1644.....................1664100
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 1644.....................1664100
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 1644.....................1664100
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 1644.....................1664100
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 1644.....................1664100
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 1644.....................1664100
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 1644.....................1664100
DQ089765.1 Hepatitis B virus isolate HK428, complete genome 1644.....................1664100
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 1644.....................1664100
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 1644.....................1664100
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 1644.....................1664100
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 1644.....................1664100
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 1644.....................1664100
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 1644.....................1664100
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 1644.....................1664100
DQ089774.1 Hepatitis B virus isolate HK858, complete genome 1644.....................1664100
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 1644.....................1664100
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 1644.....................1664100
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 1644.....................1664100
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 1644.....................1664100
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 1644.....................1664100
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 1644.....................1664100
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 1644.....................1664100
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 1644.....................1664100
DQ089787.1 Hepatitis B virus isolate HK352, complete genome 1644.....................1664100
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 1644.....................1664100
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 1644.....................1664100
DQ089791.1 Hepatitis B virus isolate HK1205, complete genome 1644.....................1664100
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 1644.....................1664100
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 1644.....................1664100
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 1597.....................1617100
DQ089796.1 Hepatitis B virus isolate HK751, complete genome 1644.....................1664100
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 1644.....................1664100
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 1644.....................1664100
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 1605.....................1625100
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 1644.....................1664100
DQ060822.1 Hepatitis B virus isolate 8510-91, complete genome 1644.....................1664100
DQ060823.1 Hepatitis B virus isolate 8504-91, complete genome 1644.....................1664100
DQ060824.1 Hepatitis B virus isolate 0121-20, complete genome 1644.....................1664100
DQ060825.1 Hepatitis B virus isolate 0262-09, complete genome 1644.....................1664100
DQ060826.1 Hepatitis B virus isolate 0433-20, complete genome 1644.....................1664100
DQ060827.1 Hepatitis B virus isolate 0317-04, complete genome 1644.....................1664100
DQ060828.1 Hepatitis B virus isolate 0443-03, complete genome 1644.....................1664100
DQ060829.1 Hepatitis B virus isolate 0350-03, complete genome 1644.....................1664100
DQ060830.1 Hepatitis B virus isolate 235-01, complete genome 1644.....................1664100
DQ111986.1 Hepatitis B virus isolate MBT181, complete genome 1644.....................1664100
DQ111987.1 Hepatitis B virus isolate MMU36, complete genome 1644.....................1664100
AY862860.1 Hepatitis B virus clone Q11, complete genome 1644.....................1664100
AY862861.1 Hepatitis B virus clone Q17, complete genome 1644.....................1664100
AY862864.1 Hepatitis B virus clone Q34, complete genome 1644.....................1664100
AY862865.1 Hepatitis B virus clone Q311, complete genome 1644.....................1664100
AY862866.1 Hepatitis B virus clone Q312, complete genome 1646.....................1666100
AY862867.1 Hepatitis B virus clone Q42, complete genome 1644.....................1664100
AY862868.1 Hepatitis B virus clone Q43, complete genome 1644.....................1664100
AY862869.1 Hepatitis B virus clone Q80, complete genome 1644.....................1664100
AB201287.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1644.....................1664100
AB201288.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1644.....................1664100
AB201289.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1644.....................1664100
AB201290.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds1644.....................1664100
AB119251.1 Hepatitis B virus DNA, complete genome, strain:Ehime13:BD No2,20020821644.....................1664100
AB119252.1 Hepatitis B virus DNA, complete genome, strain:Ehime14:BD No7,20020821644.....................1664100
AB119253.1 Hepatitis B virus DNA, complete genome, strain:Ehime15:BD No27,H12.011644.....................1664100
AB119254.1 Hepatitis B virus DNA, complete genome, strain:Ehime16:BD No53,2003011644.....................1664100
AB119255.1 Hepatitis B virus DNA, complete genome, strain:Ehime17:Iyo 0719039 1644.....................1664100
AB119256.1 Hepatitis B virus DNA, complete genome, strain:Ehime18:Iyo 529246 1644.....................1664100
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 245.....................265100
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 3460.....................3480100
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 227.....................247100
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 3442.....................3462100
AB219529.1 Hepatitis B virus DNA, complete genome, isolate:UK1 1632.....................1652100
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 1644.....................1664100
AB219531.1 Hepatitis B virus DNA, complete genome, isolate:UK3 1644.....................1664100
AB219532.1 Hepatitis B virus DNA, complete genome, isolate:UK4 1644.....................1664100
AB219534.1 Hepatitis B virus DNA, complete genome, isolate:UK6 1614.....................1634100
DQ246215.1 Hepatitis B virus isolate GZ-DYH, complete genome 1644.....................1664100
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 3045.....................3065100
DQ298162.1 Hepatitis B virus isolate LT3.12AM clone 2, complete genome 3045.....................3065100
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 3045.....................3065100
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 3045.....................3065100
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 3045.....................3065100
DQ304547.1 Hepatitis B virus isolate LT4 clone 1, complete genome 3006.....................3026100
DQ304548.1 Hepatitis B virus isolate LT4 clone 2, complete genome 3006.....................3026100
DQ304549.1 Hepatitis B virus isolate LT4 clone 3, complete genome 3006.....................3026100
DQ304550.1 Hepatitis B virus isolate LT4 clone 4, complete genome 3006.....................3026100
DQ304551.1 Hepatitis B virus isolate LT4 clone 5, complete genome 3006.....................3026100
DQ329356.1 Hepatitis B virus isolate LT1 clone 1, complete genome 3001.....................3021100
DQ329357.1 Hepatitis B virus isolate LT1 clone 2, complete genome 3001.....................3021100
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 1623.....................1643100
DQ361535.1 Hepatitis B virus isolate CRP-228, complete genome 1614.....................1634100
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 1644.....................1664100
DQ377160.1 Hepatitis B virus isolate WJT16, complete genome 1644.....................1664100
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 1644.....................1664100
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 1644.....................1664100
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 1644.....................1664100
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 1644.....................1664100
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 1644.....................1664100
AB247916.1 Hepatitis B virus DNA, complete genome, lamivudine resistance with in1644.....................1664100
AJ627217.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20953 1644.....................1664100
AJ627219.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 24039 1644.....................1664100
AJ627220.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 29234 1644.....................1664100
AJ627221.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 30125 1644.....................1664100
AJ627223.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33720 1644.....................1664100
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 1644.....................1664100
AJ627228.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 34408 1632.....................1652100
DQ315776.1 Hepatitis B virus isolate EI00615, complete genome 1644.....................1664100
DQ315777.1 Hepatitis B virus isolate EI03194, complete genome 1644.....................1664100
DQ315778.1 Hepatitis B virus isolate EI0388, complete genome 1644.....................1664100
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 1644.....................1664100
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 1644.....................1664100
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 1644.....................1664100
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 1644.....................1664100
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 1644.....................1664100
DQ399006.1 Hepatitis B virus isolate G1, complete genome 2935.....................2955100
AB219430.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4148, PNN5 1644.....................1664100
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 1644.....................1664100
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 1644.....................1664100
AB222709.1 Hepatitis B virus DNA, complete genome, isolate: UZBV34 1644.....................1664100
AB222710.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6M 1644.....................1664100
AB222711.1 Hepatitis B virus DNA, complete genome, isolate: UZNV24 1644.....................1664100
AB222712.1 Hepatitis B virus DNA, complete genome, isolate: UZBV61 1644.....................1664100
AB222713.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6 1644.....................1664100
AB210818.1 Hepatitis B virus DNA, complete genome, strain:Ehime 21-NM 1644.....................1664100
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 1644.....................1664100
AB210820.1 Hepatitis B virus DNA, complete genome, strain:Tokyo 1 1644.....................1664100
AB210821.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 1-OA 1644.....................1664100
AB210822.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 2-OS 1644.....................1664100
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 1644.....................1664100
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 1644.....................1664100
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 1644.....................1664100
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 1644.....................1664100
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 1644.....................1664100
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 1644.....................1664100
DQ463797.1 Hepatitis B virus isolate 650-15_2004, complete genome 1644.....................1664100
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 1644.....................1664100
DQ463799.1 Hepatitis B virus isolate 539-16_2004, complete genome 1644.....................1664100
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 1644.....................1664100
AM180624.1 Hepatitis B virus complete genome, isolate CAE168 1644.....................1664100
DQ478881.1 Hepatitis B virus isolate CHN-QH2, complete genome 1644.....................1664100
DQ478882.1 Hepatitis B virus isolate CHN-QH3, complete genome 1644.....................1664100
DQ478883.1 Hepatitis B virus isolate CHN-QH33, complete genome 1653.....................1673100
DQ478884.1 Hepatitis B virus isolate CHN-QH4, complete genome 1644.....................1664100
DQ478885.1 Hepatitis B virus isolate CHN-D12, complete genome 1644.....................1664100
DQ478888.1 Hepatitis B virus isolate CHN-QH9, complete genome 1644.....................1664100
DQ478889.1 Hepatitis B virus isolate CHN-QH14, complete genome 1644.....................1664100
DQ478891.1 Hepatitis B virus isolate CHN-QH19, complete genome 1644.....................1664100
DQ478892.1 Hepatitis B virus isolate CHN-QH28, complete genome 1644.....................1664100
DQ478893.1 Hepatitis B virus isolate CHN-QH29, complete genome 1644.....................1664100
DQ478894.1 Hepatitis B virus isolate CHN-QH30, complete genome 1644.....................1664100
DQ478895.1 Hepatitis B virus isolate CHN-QH31, complete genome 1644.....................1664100
DQ478896.1 Hepatitis B virus isolate CHN-QH32, complete genome 1644.....................1664100
DQ478897.1 Hepatitis B virus isolate CHN-QH37, complete genome 1644.....................1664100
DQ478898.1 Hepatitis B virus isolate CHN-QH38, complete genome 1644.....................1664100
DQ478899.1 Hepatitis B virus isolate CHN-D20, complete genome 1644.....................1664100
DQ478900.1 Hepatitis B virus isolate CHN-H172, complete genome 1644.....................1664100
DQ478901.1 Hepatitis B virus isolate CHN-H155, complete genome 1644.....................1664100
DQ486021.1 Hepatitis B virus isolate LT13, complete genome 3006.....................3026100
DQ486022.1 Hepatitis B virus isolate LT11, complete genome 3006.....................3026100
DQ486023.1 Hepatitis B virus isolate LT10, complete genome 2985.....................3005100
DQ486024.1 Hepatitis B virus isolate LT9, complete genome 3006.....................3026100
DQ486025.1 Hepatitis B virus isolate LT12, complete genome 3006.....................3026100
AB241109.1 Hepatitis B virus DNA, complete genome, isolate:PhCH24 1644.....................1664100
AB241110.1 Hepatitis B virus DNA, complete genome, isolate:PhLC03 1644.....................1664100
AB241111.1 Hepatitis B virus DNA, complete genome, isolate:PhLC14 1644.....................1664100
AB241113.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC13 1590.....................1610100
AB241114.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC01 1644.....................1664100
AB241115.1 Hepatitis B virus DNA, complete genome, isolate:PhCH09 1644.....................1664100
AM282986.1 Hepatitis B virus (SUBTYPE ADW2), genotype A, complete genome 1644.....................1664100
AB246317.1 Hepatitis B virus DNA, complete genome, isolate: TA112 1608.....................1628100
DQ788835.1 Hepatitis B virus splice variant AP12, complete genome 1159.....................1179100
DQ788725.1 Hepatitis B virus clone S1, complete genome 1644.....................1664100
DQ788726.1 Hepatitis B virus clone S15, complete genome 1638.....................1658100
DQ788727.1 Hepatitis B virus clone S18, complete genome 1638.....................1658100
DQ788728.1 Hepatitis B virus clone S24, complete genome 1638.....................1658100
DQ788729.1 Hepatitis B virus clone L1, complete genome 1638.....................1658100
AM184125.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate O64 1644.....................1664100
AM184126.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate N35 1644.....................1664100
DQ922649.1 Hepatitis B virus strain B0024, complete genome 1646.....................1666100
DQ922651.1 Hepatitis B virus strain F0691, complete genome 1646.....................1666100
DQ975274.1 Hepatitis B virus strain F0885, complete genome 1646.....................1666100
DQ980547.1 Hepatitis B virus strain E0113, complete genome 1646.....................1666100
DQ986375.1 Hepatitis B virus strain 616-93, complete genome 1646.....................1666100
DQ986376.1 Hepatitis B virus strain F0297, complete genome 1616.....................1636100
AB246335.1 Hepatitis B virus DNA, complete genome, clone: Aa_IND 1644.....................1664100
AB246336.1 Hepatitis B virus DNA, complete genome, clone: Aa_SAF 1644.....................1664100
AB246337.1 Hepatitis B virus DNA, complete genome, clone: Ae_US 1644.....................1664100
AB246338.1 Hepatitis B virus DNA, complete genome, clone: Ae_JPN 1644.....................1664100
AB246344.1 Hepatitis B virus DNA, complete genome, clone: C_JPN22 1644.....................1664100
AB246346.1 Hepatitis B virus DNA, complete genome, clone: C_HK74 1644.....................1664100
AB246347.1 Hepatitis B virus DNA, complete genome, clone: D_IND60 1644.....................1664100
AB246348.1 Hepatitis B virus DNA, complete genome, clone: D_US68 1644.....................1664100
AB288026.1 Hepatitis B virus DNA, complete genome, genotype: C, country: Japan, 1644.....................1664100
AM421529.1 Hepatitis B virus partial core gene, isolate MMA-1 34.....................54100
AM421530.1 Hepatitis B virus partial core gene, isolate MMA-2 34.....................54100
AM421531.1 Hepatitis B virus partial core gene, isolate MMA-3 34.....................54100
AM421532.1 Hepatitis B virus partial core gene, isolate MMA-4 34.....................54100
AM421533.1 Hepatitis B virus partial core gene, isolate MMA-5 34.....................54100
AM421534.1 Hepatitis B virus partial core gene, isolate MMA-6 34.....................54100
AM421535.1 Hepatitis B virus partial core gene, isolate MMA-7 34.....................54100
AM421536.1 Hepatitis B virus partial core gene, isolate MMA-8 34.....................54100
AM421537.1 Hepatitis B virus partial core gene, isolate MMA-9 34.....................54100
AM421539.1 Hepatitis B virus partial core gene, isolate MMA-11 34.....................54100
AM421540.1 Hepatitis B virus partial core gene, isolate MMA-12 34.....................54100
AM421541.1 Hepatitis B virus partial core gene, isolate MMA-13 34.....................54100
AM421542.1 Hepatitis B virus partial core gene, isolate MMA-14 34.....................54100
AM421543.1 Hepatitis B virus partial core gene, isolate MMA-15 34.....................54100
AM421544.1 Hepatitis B virus partial core gene, isolate MMA-16 34.....................54100
AM421545.1 Hepatitis B virus partial core gene, isolate MMA-17 34.....................54100
AM421546.1 Hepatitis B virus partial core gene, isolate MMA-18 34.....................54100
AM421547.1 Hepatitis B virus partial core gene, isolate MMA-19 34.....................54100
AM421548.1 Hepatitis B virus partial core gene, isolate MMA-20 34.....................54100
AB267090.1 Hepatitis B virus ayw/Japan/Ehime 22-HS/2005 DNA, complete genome 1644.....................1664100
EF208113.1 Hepatitis B virus clone B-S3, complete genome 1644.....................1664100
EF208114.1 Hepatitis B virus clone B-S7, complete genome 1644.....................1664100
EF208115.1 Hepatitis B virus clone B-S8, complete genome 1644.....................1664100
AB270547.1 Hepatitis B virus DNA, complete genome, isolate: MGL295F 1644.....................1664100
AB270548.1 Hepatitis B virus DNA, complete genome, isolate: MGL207F 1644.....................1664100
AB270549.1 Hepatitis B virus DNA, complete genome, isolate: MGL79F 1644.....................1664100
AB270534.1 Hepatitis B virus DNA, complete genome, isolate: MGL110F 1644.....................1664100
AB270536.1 Hepatitis B virus DNA, complete genome, isolate: MGL226F 1643.....................1663100
AB270537.1 Hepatitis B virus DNA, complete genome, isolate: MGL22F 1644.....................1664100
AB270538.1 Hepatitis B virus DNA, complete genome, isolate: MGL231F 1644.....................1664100
AB270540.1 Hepatitis B virus DNA, complete genome, isolate: MGL241F 1623.....................1643100
AB270541.1 Hepatitis B virus DNA, complete genome, isolate: MGL47F 1644.....................1664100
AB270542.1 Hepatitis B virus DNA, complete genome, isolate: MGL12F 1644.....................1664100
AB270543.1 Hepatitis B virus DNA, complete genome, isolate: MGL209F 1644.....................1664100
AB270544.1 Hepatitis B virus DNA, complete genome, isolate: MGL215F 1644.....................1664100
AB270545.1 Hepatitis B virus DNA, complete genome, isolate: MGL108F 1644.....................1664100
AB270546.1 Hepatitis B virus DNA, complete genome, isolate: MGL88F 1644.....................1664100
EF103275.1 Hepatitis B virus isolate Ran11, complete genome 1644.....................1664100
EF103276.1 Hepatitis B virus isolate Ran22, complete genome 1644.....................1664100
EF103277.1 Hepatitis B virus isolate Ran33, complete genome 1644.....................1664100
EF103278.1 Hepatitis B virus isolate Ran60, complete genome 1644.....................1664100
EF103279.1 Hepatitis B virus isolate Ran99, complete genome 1644.....................1664100
EF103280.1 Hepatitis B virus isolate Ran100, complete genome 1644.....................1664100
EF103281.1 Hepatitis B virus isolate Ran102, complete genome 1644.....................1664100
EF103282.1 Hepatitis B virus isolate Ran103, complete genome 1644.....................1664100
EF103283.1 Hepatitis B virus isolate Ran105, complete genome 1644.....................1664100
EF103284.1 Hepatitis B virus isolate Ran113, complete genome 1644.....................1664100
EF103285.1 Hepatitis B virus isolate Ran128, complete genome 1644.....................1664100
AB274969.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB320 1644.....................1664100
AB274970.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB291 1644.....................1664100
AB274971.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB295 1644.....................1664100
AB274972.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB250 1589.....................1609100
AB274973.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB18 1638.....................1658100
AB274974.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB60 1644.....................1664100
AB274975.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB241 1644.....................1664100
AB274977.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB183 1644.....................1664100
AB274978.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB261 1644.....................1664100
AB274979.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB302 1644.....................1664100
AB274980.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB90 1644.....................1664100
AB274981.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB331 1644.....................1664100
AB274982.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB130 1644.....................1664100
AM295795.1 Hepatitis B virus complete genome, clone LB1Clone5 1644.....................1664100
AM295796.1 Hepatitis B virus complete genome, clone LB1Clone10 1644.....................1664100
AM295797.1 Hepatitis B virus complete genome, clone LB2Clone6 1644.....................1664100
AM295798.1 Hepatitis B virus complete genome, clone LB3Clone1 1644.....................1664100
AM295799.1 Hepatitis B virus complete genome, clone LB3Clone5 1644.....................1664100
AM295800.2 Hepatitis B virus complete genome, clone LB3Clone11 1645.....................1665100
AB195939.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-1 1644.....................1664100
AB195940.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-2 1644.....................1664100
AB195941.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-3 1644.....................1664100
AB195942.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-1 1644.....................1664100
AB195946.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-2 1599.....................1619100
AB195947.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-1 1644.....................1664100
AB195948.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-2 1644.....................1664100
AB195949.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-1 1644.....................1664100
AB195950.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-2 1644.....................1664100
AB195951.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-3 1644.....................1664100
AB195952.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-1 1644.....................1664100
AB195953.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-2 1644.....................1664100
AB195954.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-3 1644.....................1664100
AB195955.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-1 1644.....................1664100
AB195956.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-2 1644.....................1664100
AB195957.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-3 1644.....................1664100
AM422939.1 Hepatitis B virus, genotype D, complete genome, isolate X28 1644.....................1664100
DQ993680.1 Hepatitis B virus isolate patient 268, complete genome 1644.....................1664100
DQ993681.1 Hepatitis B virus isolate patient 290, complete genome 1644.....................1664100
DQ993682.1 Hepatitis B virus isolate patient 479, complete genome 1644.....................1664100
DQ993683.1 Hepatitis B virus isolate patient 82, complete genome 1644.....................1664100
DQ993685.1 Hepatitis B virus isolate patient 554, complete genome 1644.....................1664100
DQ993687.1 Hepatitis B virus isolate patient 700, complete genome 1644.....................1664100
DQ993688.1 Hepatitis B virus isolate 209-0519-Nature1.2-unSero, complete genome 1645.....................1665100
DQ993689.1 Hepatitis B virus isolate 209-1119-Nature1.1-unSero, complete genome 1645.....................1665100
DQ993690.1 Hepatitis B virus isolate 204-1113-Nature1.1-unSero, complete genome 1644.....................1664100
DQ993691.1 Hepatitis B virus isolate 4007-0803-Nature2.2-unSero, complete genome1644.....................1664100
DQ993692.1 Hepatitis B virus isolate 4007-0810-Nature2.1-unSero, complete genome1644.....................1664100
DQ993693.1 Hepatitis B virus isolate 232-1125-Nature1.1-unSero, complete genome 1644.....................1664100
DQ993694.1 Hepatitis B virus isolate patient 234, complete genome 1644.....................1664100
EF688062.1 Hepatitis B virus isolate GZ28-1, complete genome 1644.....................1664100
EU086721.1 Hepatitis B virus isolate HRO/w4601-2002, complete genome 1644.....................1664100
EF494378.1 Hepatitis B virus isolate TW1244 genotype C, complete genome 1644.....................1664100
EF494379.1 Hepatitis B virus isolate TW8585 genotype C, complete genome 1644.....................1664100
AB300359.1 Hepatitis B virus DNA, complete genome, isolate: patient1 1644.....................1664100
AB300360.1 Hepatitis B virus DNA, complete genome, isolate: patient2 1644.....................1664100
AB300362.1 Hepatitis B virus DNA, complete genome, isolate: patient4 1644.....................1664100
AB300363.1 Hepatitis B virus DNA, complete genome, isolate: patient5 1644.....................1664100
AB300365.1 Hepatitis B virus DNA, complete genome, isolate: patient7 1644.....................1664100
AB300366.1 Hepatitis B virus DNA, complete genome, isolate: patient8 1644.....................1664100
AB300367.1 Hepatitis B virus DNA, complete genome, isolate: patient9 1644.....................1664100
AB300368.1 Hepatitis B virus DNA, complete genome, isolate: patient10 1644.....................1664100
AB300373.1 Hepatitis B virus DNA, complete genome, isolate: patient15 1620.....................1640100
AB368295.1 Hepatitis B virus DNA, complete genome, Genotype B, Subgenotype B4, c1644.....................1664100
AB368296.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c1644.....................1664100
EU239217.1 Hepatitis B virus isolate G2451, complete genome 1644.....................1664100
EU239219.1 Hepatitis B virus isolate PW3, complete genome 1644.....................1664100
EU239220.1 Hepatitis B virus isolate PW5, complete genome 1644.....................1664100
EU239221.1 Hepatitis B virus isolate PW1, complete genome 1644.....................1664100
EU239222.1 Hepatitis B virus isolate PW2, complete genome 1644.....................1664100
EU239223.1 Hepatitis B virus isolate PW4, complete genome 1644.....................1664100
EU239224.1 Hepatitis B virus isolate BD1, complete genome 1644.....................1664100
EU239225.1 Hepatitis B virus isolate PW7, complete genome 1641.....................1661100
EU239226.1 Hepatitis B virus isolate PW6, complete genome 1644.....................1664100
AB287314.1 Hepatitis B virus DNA, complete genome, isolate: Alaska433 1644.....................1664100
AB287315.1 Hepatitis B virus DNA, complete genome, isolate: Alaska419 1644.....................1664100
AB287316.1 Hepatitis B virus DNA, complete genome, isolate: Alaska427 1644.....................1664100
AB287318.1 Hepatitis B virus DNA, complete genome, isolate: Alaska2 1644.....................1664100
AB287319.1 Hepatitis B virus DNA, complete genome, isolate: AlaskaG23 1644.....................1664100
AB287322.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-3 1644.....................1664100
AB287324.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-5 1644.....................1664100
AB287329.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba A55 1644.....................1664100
EU155893.1 Hepatitis B virus isolate 4, complete genome 1644.....................1664100
AB330367.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ14H1644.....................1664100
AB330368.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ54H1644.....................1664100
AB330369.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ5HB1644.....................1664100
AB330370.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ6HB1644.....................1664100
AB330371.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ23H1644.....................1664100
AB330372.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ22H1644.....................1664100
EU185786.1 Hepatitis B virus isolate S-IDU11, complete genome 1644.....................1664100
EU185787.1 Hepatitis B virus isolate S-IDU4, complete genome 1644.....................1664100
EU185788.1 Hepatitis B virus isolate S-IDU19, complete genome 1644.....................1664100
EU185789.1 Hepatitis B virus isolate S-IDU8, complete genome 1644.....................1664100
EU305540.1 Hepatitis B virus isolate G67-123, complete genome 1644.....................1664100
EU305541.1 Hepatitis B virus isolate G67-190, complete genome 1644.....................1664100
EU305542.1 Hepatitis B virus isolate G67-1251, complete genome 1644.....................1664100
AM494689.1 Hepatitis B virus complete genome, isolate CAR006 1632.....................1652100
AM494690.1 Hepatitis B virus complete genome, isolate CAR008 1644.....................1664100
AM494691.1 Hepatitis B virus complete genome, isolate CAR024 1644.....................1664100
AM494692.1 Hepatitis B virus complete genome, isolate CAR026 1644.....................1664100
AM494693.1 Hepatitis B virus complete genome, isolate CAR039 1644.....................1664100
AM494694.1 Hepatitis B virus complete genome, isolate CAR047 1644.....................1664100
AM494696.1 Hepatitis B virus complete genome, isolate CAR060 1644.....................1664100
AM494697.1 Hepatitis B virus complete genome, isolate CAR063 1644.....................1664100
AM494698.1 Hepatitis B virus complete genome, isolate CAR066 1623.....................1643100
AM494699.1 Hepatitis B virus complete genome, isolate CAR082 1644.....................1664100
AM494700.1 Hepatitis B virus complete genome, isolate CAR083 1644.....................1664100
AM494701.1 Hepatitis B virus complete genome, isolate CAR097 1644.....................1664100
AM494702.1 Hepatitis B virus complete genome, isolate CAR106 1644.....................1664100
AM494704.1 Hepatitis B virus complete genome, isolate CAR112 1644.....................1664100
AM494705.1 Hepatitis B virus complete genome, isolate CAR115 1644.....................1664100
AM494706.1 Hepatitis B virus complete genome, isolate CAR131 1644.....................1664100
AM494707.1 Hepatitis B virus complete genome, isolate CAR137 1644.....................1664100
AM494708.1 Hepatitis B virus complete genome, isolate CAR138 1644.....................1664100
AM494709.1 Hepatitis B virus complete genome, isolate CAR143 1644.....................1664100
AM494710.1 Hepatitis B virus complete genome, isolate CAR144 1644.....................1664100
AM494711.1 Hepatitis B virus complete genome, isolate CAR146 1641.....................1661100
AM494712.1 Hepatitis B virus complete genome, isolate CAR150 1641.....................1661100
AM494713.1 Hepatitis B virus complete genome, isolate CAR154 1644.....................1664100
AM494714.1 Hepatitis B virus complete genome, isolate CAR165 1644.....................1664100
AM494715.1 Hepatitis B virus complete genome, isolate CAR171 1644.....................1664100
AM494716.1 Hepatitis B virus complete genome, isolate CAR175 1644.....................1664100
AM494717.1 Hepatitis B virus complete genome, isolate CAR187 1644.....................1664100
AM494718.1 Hepatitis B virus complete genome, isolate CAR204 1644.....................1664100
EU306673.1 Hepatitis B virus clone 213-10, complete genome 1644.....................1664100
EU306674.1 Hepatitis B virus clone 213-6, complete genome 1644.....................1664100
EU306675.1 Hepatitis B virus clone 213-21, complete genome 1644.....................1664100
EU306685.1 Hepatitis B virus clone 327-4, complete genome 1644.....................1664100
EU306686.1 Hepatitis B virus clone 327-28, complete genome 1644.....................1664100
EU306687.1 Hepatitis B virus clone 327-6, complete genome 1644.....................1664100
EU306688.1 Hepatitis B virus clone 327-54, complete genome 1644.....................1664100
EU306689.1 Hepatitis B virus clone 327-27, complete genome 1644.....................1664100
EU306690.1 Hepatitis B virus clone 327-71, complete genome 1644.....................1664100
EU306691.1 Hepatitis B virus clone 327-57, complete genome 1644.....................1664100
EU306692.1 Hepatitis B virus clone 327-73, complete genome 1644.....................1664100
EU306693.1 Hepatitis B virus clone 327-67, complete genome 1644.....................1664100
EU306694.1 Hepatitis B virus clone 327-46, complete genome 1644.....................1664100
EU306713.1 Hepatitis B virus clone 602-27, complete genome 1644.....................1664100
EU306714.1 Hepatitis B virus clone 602-77, complete genome 1644.....................1664100
EU306715.1 Hepatitis B virus clone 602(son)-17, complete genome 1644.....................1664100
EU306716.1 Hepatitis B virus clone 602(son)-18, complete genome 1644.....................1664100
EU306717.1 Hepatitis B virus clone 602(son)-22, complete genome 1644.....................1664100
EU306718.1 Hepatitis B virus clone 602(son)-24, complete genome 1644.....................1664100
EU306719.1 Hepatitis B virus clone 602(son)-23, complete genome 1644.....................1664100
EU306720.1 Hepatitis B virus clone 602(son)-68, complete genome 1644.....................1664100
EU306721.1 Hepatitis B virus clone 602(son)-1, complete genome 1644.....................1664100
EU306722.1 Hepatitis B virus clone 6022-28-, complete genome 1644.....................1664100
EU306723.1 Hepatitis B virus clone 6022-19, complete genome 1644.....................1664100
EU306724.1 Hepatitis B virus clone 6022-2-, complete genome 1644.....................1664100
EU306725.1 Hepatitis B virus clone 6022-17, complete genome 1644.....................1664100
EU306726.1 Hepatitis B virus clone 6022-12-, complete genome 1644.....................1664100
EU306727.1 Hepatitis B virus clone 6022-5-, complete genome 1644.....................1664100
EU306728.1 Hepatitis B virus clone 6022-43, complete genome 1644.....................1664100
EU306729.1 Hepatitis B virus clone 6022-33, complete genome 1644.....................1664100
EU410080.1 Hepatitis B virus isolate ph76, complete genome 1644.....................1664100
EU410081.1 Hepatitis B virus isolate ph80, complete genome 1644.....................1664100
EU439005.1 Hepatitis B virus clone 6022-35 from China, complete genome 1644.....................1664100
EU439006.1 Hepatitis B virus clone 602(S)-3 from China, complete genome 1644.....................1664100
EU439007.1 Hepatitis B virus clone 602(S)-39 from China, complete genome 1645.....................1665100
EU439008.1 Hepatitis B virus clone 6023-27 from China, complete genome 1659.....................1679100
EU439010.1 Hepatitis B virus clone 6023-38 from China, complete genome 1644.....................1664100
EU439016.1 Hepatitis B virus clone zgh-9 from China, complete genome 1644.....................1664100
AB365451.1 Hepatitis B virus DNA, complete genome, isolate: BOL196 1644.....................1664100
AM410963.1 Hepatitis B virus complete genome, clone LB3Clone24 1644.....................1664100
AB426467.1 Hepatitis B virus DNA, complete genome, clone: HBVFH0204 1644.....................1664100
EU547558.1 Hepatitis B virus isolate MC01, complete genome 1644.....................1664100
EU547559.1 Hepatitis B virus isolate MC02, complete genome 1611.....................1631100
EU547561.1 Hepatitis B virus isolate MC04, complete genome 1644.....................1664100
EU439009.1 Hepatitis B virus clone 6023-33 from China, complete genome 1597.....................1617100
AB299858.1 Hepatitis B virus subtype adr DNA, complete genome, clone: HBVFH0204 1644.....................1664100
EU554537.1 Hepatitis B virus isolate S541-13, complete genome 1644.....................1664100
EU554538.1 Hepatitis B virus isolate S541-15, complete genome 1644.....................1664100
EU554539.1 Hepatitis B virus isolate S541-21, complete genome 1644.....................1664100
EU554540.1 Hepatitis B virus isolate S304-10, complete genome 1644.....................1664100
EU562215.1 Hepatitis B virus isolate 11, complete genome 1644.....................1664100
EU562216.1 Hepatitis B virus isolate 13, complete genome 1644.....................1664100
EU562217.1 Hepatitis B virus isolate 16, complete genome 1644.....................1664100
EU562218.1 Hepatitis B virus isolate 7, complete genome 1644.....................1664100
EU562219.1 Hepatitis B virus isolate 5, complete genome 1643.....................1663100
EU560438.1 Hepatitis B virus isolate 2-B74, complete genome 1644.....................1664100
EU560439.1 Hepatitis B virus isolate 7-B74, complete genome 1644.....................1664100
EU560440.1 Hepatitis B virus isolate 1-S869, complete genome 1644.....................1664100
EU560441.1 Hepatitis B virus isolate 4-S869, complete genome 1644.....................1664100
EU570067.1 Hepatitis B virus isolate 18-S541, complete genome 1644.....................1664100
EU570068.1 Hepatitis B virus isolate 26-S541, complete genome 1644.....................1664100
EU570072.1 Hepatitis B virus isolate 1-B74, complete genome 1644.....................1664100
EU579442.1 Hepatitis B virus isolate 6 genotype C, complete genome 1644.....................1664100
EU589340.1 Hepatitis B virus isolate S852-7, complete genome 1599.....................1619100
EU589341.1 Hepatitis B virus isolate S852-10, complete genome 1599.....................1619100
EU589342.1 Hepatitis B virus isolate S852-13, complete genome 1599.....................1619100
EU589343.1 Hepatitis B virus isolate S852-15, complete genome 1599.....................1619100
EU589345.1 Hepatitis B virus isolate S624-2, complete genome 1629.....................1649100
EU414135.1 Hepatitis B virus strain 28025, complete genome 1644.....................1664100
EU414136.1 Hepatitis B virus strain 28052, complete genome 1644.....................1664100
EU414138.1 Hepatitis B virus strain 28129, complete genome 1644.....................1664100
EU414139.1 Hepatitis B virus strain 28027, complete genome 1644.....................1664100
EU414140.1 Hepatitis B virus strain 28050, complete genome 1644.....................1664100
EU414141.1 Hepatitis B virus strain 28051, complete genome 1644.....................1664100
EU414142.1 Hepatitis B virus strain 28004, complete genome 1644.....................1664100
EU414143.1 Hepatitis B virus strain 28042, complete genome 1644.....................1664100
EU747320.1 Hepatitis B virus isolate V51, complete genome 1644.....................1664100
EU717212.1 Hepatitis B virus isolate D26K-7, complete genome 1646.....................1666100
EU330989.1 Hepatitis B virus isolate M84-74, complete genome 1644.....................1664100
EU330990.1 Hepatitis B virus isolate M84-146, complete genome 1644.....................1664100
EU330992.1 Hepatitis B virus isolate M85-6, complete genome 1644.....................1664100
EU330993.1 Hepatitis B virus isolate M85-8, complete genome 1643.....................1663100
EU330994.1 Hepatitis B virus isolate M85-10, complete genome 1644.....................1664100
EU330995.1 Hepatitis B virus isolate M85-80, complete genome 1644.....................1664100
EU330996.1 Hepatitis B virus isolate M85-81, complete genome 1644.....................1664100
EU330997.1 Hepatitis B virus isolate M85-216, complete genome 1644.....................1664100
EU330998.1 Hepatitis B virus isolate M85-1043, complete genome 1644.....................1664100
EU330999.1 Hepatitis B virus isolate M85-1044, complete genome 1644.....................1664100
EU331000.1 Hepatitis B virus isolate M85-1045, complete genome 1644.....................1664100
EU331001.1 Hepatitis B virus isolate M85-1046, complete genome 1644.....................1664100
EU871969.1 Hepatitis B virus isolate 6-024-1, complete genome 1644.....................1664100
EU871970.1 Hepatitis B virus isolate 6-024-3, complete genome 1644.....................1664100
EU871971.1 Hepatitis B virus isolate 6-024-5, complete genome 1644.....................1664100
EU871972.1 Hepatitis B virus isolate 6-024-8, complete genome 1644.....................1664100
EU871975.1 Hepatitis B virus isolate 6-024A-8, complete genome 1644.....................1664100
EU871976.1 Hepatitis B virus isolate 179-04-3, complete genome 1644.....................1664100
EU871977.1 Hepatitis B virus isolate 252-2, complete genome 1644.....................1664100
EU871978.1 Hepatitis B virus isolate 252-95-2, complete genome 1644.....................1664100
EU871979.1 Hepatitis B virus isolate 252-95-4, complete genome 1644.....................1664100
EU871982.1 Hepatitis B virus isolate 318-96-2, complete genome 1644.....................1664100
EU871997.1 Hepatitis B virus isolate 530-00-3, complete genome 1644.....................1664100
EU872000.1 Hepatitis B virus isolate 530-92-2, complete genome 1644.....................1664100
EU872001.1 Hepatitis B virus isolate 530-92-8, complete genome 1644.....................1664100
EU872002.1 Hepatitis B virus isolate 530-97-1, complete genome 1644.....................1664100
EU872003.1 Hepatitis B virus isolate 530-97-2, complete genome 1644.....................1664100
EU872004.1 Hepatitis B virus isolate 530-97-3, complete genome 1644.....................1664100
EU872006.1 Hepatitis B virus isolate 318-92-1, complete genome 1644.....................1664100
EU872007.1 Hepatitis B virus isolate 252-92-6, complete genome 1644.....................1664100
EU872008.1 Hepatitis B virus isolate 252A-8, complete genome 1644.....................1664100
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 1629.....................1649100
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 1663_____................167876
EU872010.1 Hepatitis B virus isolate 252-92-3, complete genome 1644.....................1664100
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 1629.....................1649100
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 1663_____................167876
EU872017.1 Hepatitis B virus isolate 530-00-6, complete genome 1644.....................1664100
EU594382.1 Hepatitis B virus strain 3798-91, complete genome 1644.....................1664100
EU594383.1 Hepatitis B virus strain 2000-00, complete genome 1644.....................1664100
EU594384.1 Hepatitis B virus strain 1906-99, complete genome 1644.....................1664100
EU594385.1 Hepatitis B virus strain 1898-98, complete genome 1644.....................1664100
EU594386.1 Hepatitis B virus strain 644-00, complete genome 1644.....................1664100
EU594387.1 Hepatitis B virus strain 3784-91, complete genome 1644.....................1664100
EU594388.1 Hepatitis B virus strain 3782-91, complete genome 1644.....................1664100
EU594389.1 Hepatitis B virus strain 4435-97, complete genome 1644.....................1664100
EU594390.1 Hepatitis B virus strain 4625-97, complete genome 1644.....................1664100
EU594391.1 Hepatitis B virus strain 4620-97, complete genome 1644.....................1664100
EU594392.1 Hepatitis B virus strain 4600-97, complete genome 1644.....................1664100
EU594393.1 Hepatitis B virus strain 4590-97, complete genome 1644.....................1664100
EU594394.1 Hepatitis B virus strain 4512-97, complete genome 1644.....................1664100
EU594395.1 Hepatitis B virus strain 4509-97, complete genome 1644.....................1664100
EU594396.1 Hepatitis B virus strain 4383-97, complete genome 1644.....................1664100
EU594397.1 Hepatitis B virus strain 4398-97, complete genome 1644.....................1664100
EU594398.1 Hepatitis B virus strain 4496-97, complete genome 1644.....................1664100
EU594399.1 Hepatitis B virus strain 4484-97, complete genome 1644.....................1664100
EU594400.1 Hepatitis B virus strain 2009-02, complete genome 1644.....................1664100
EU594401.1 Hepatitis B virus strain 1989-97, complete genome 1644.....................1664100
EU594402.1 Hepatitis B virus strain 1988-02, complete genome 1644.....................1664100
EU594403.1 Hepatitis B virus strain 1904-99, complete genome 1644.....................1664100
EU594404.1 Hepatitis B virus strain 1901-98, complete genome 1644.....................1664100
EU594405.1 Hepatitis B virus strain 620-98, complete genome 1644.....................1664100
EU594406.1 Hepatitis B virus strain 321-96, complete genome 1644.....................1664100
EU594407.1 Hepatitis B virus strain 295-01, complete genome 1644.....................1664100
EU594408.1 Hepatitis B virus strain 281-01, complete genome 1644.....................1664100
EU594409.1 Hepatitis B virus strain 280-01, complete genome 1644.....................1664100
EU594410.1 Hepatitis B virus strain 279-01, complete genome 1644.....................1664100
EU594415.1 Hepatitis B virus strain 4374-97, complete genome 1644.....................1664100
EU594416.1 Hepatitis B virus strain 4373-97, complete genome 1644.....................1664100
EU594421.1 Hepatitis B virus strain 4658-97, complete genome 1644.....................1664100
EU594422.1 Hepatitis B virus strain 4655-97, complete genome 1644.....................1664100
EU594423.1 Hepatitis B virus strain 4652-97, complete genome 1644.....................1664100
EU594424.1 Hepatitis B virus strain 4651-97, complete genome 1644.....................1664100
EU594425.1 Hepatitis B virus strain 4635-97, complete genome 1644.....................1664100
EU594426.1 Hepatitis B virus strain 4630-97, complete genome 1644.....................1664100
EU594427.1 Hepatitis B virus strain 4628-97, complete genome 1644.....................1664100
EU594428.1 Hepatitis B virus strain 4385-97, complete genome 1644.....................1664100
EU594430.1 Hepatitis B virus strain 4565-97, complete genome 1644.....................1664100
EU594431.1 Hepatitis B virus strain 4547-97, complete genome 1644.....................1664100
EU594432.1 Hepatitis B virus strain 4545-97, complete genome 1644.....................1664100
EU594433.1 Hepatitis B virus strain 4605-97, complete genome 1644.....................1664100
EU594435.1 Hepatitis B virus strain 320-95, complete genome 1644.....................1664100
EU594436.1 Hepatitis B virus strain 4550-97, complete genome 1644.....................1664100
EU787434.1 Hepatitis B virus isolate 92, complete genome 1644.....................1664100
EU787435.1 Hepatitis B virus isolate 114, complete genome 1644.....................1664100
EU787436.1 Hepatitis B virus isolate 165, complete genome 1644.....................1664100
EU787437.1 Hepatitis B virus isolate 17, complete genome 1644.....................1664100
EU787440.1 Hepatitis B virus isolate W17, complete genome 1644.....................1664100
EU787441.1 Hepatitis B virus isolate W32, complete genome 1644.....................1664100
EU787442.1 Hepatitis B virus isolate W37, complete genome 1644.....................1664100
EU787443.1 Hepatitis B virus isolate w40, complete genome 1644.....................1664100
EU787444.1 Hepatitis B virus isolate W41, complete genome 1644.....................1664100
EU787445.1 Hepatitis B virus isolate W51, complete genome 1644.....................1664100
EU787446.1 Hepatitis B virus isolate W75, complete genome 1644.....................1664100
EU787447.1 Hepatitis B virus isolate W46, complete genome 1644.....................1664100
AB453979.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH1 1644.....................1664100
AB453980.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH2 1644.....................1664100
AB453981.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH3 1644.....................1664100
AB453982.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH4 1644.....................1664100
AB453985.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH7 1644.....................1664100
AB453986.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH8 1644.....................1664100
AB453988.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH10 1644.....................1664100
AB453989.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH11 1644.....................1664100
AB453983.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH5 1644.....................1664100
EU921418.1 Hepatitis B virus isolate 22.165.07, complete genome 1641.....................1661100
EU921419.1 Hepatitis B virus isolate 22.252.07, complete genome 1641.....................1661100
EU919197.1 Hepatitis B virus isolate XJU, complete genome 1644.....................1664100
EU939536.1 Hepatitis B virus isolate C3, complete genome 1644.....................1664100
EU939538.1 Hepatitis B virus isolate C9, complete genome 1644.....................1664100
EU939541.1 Hepatitis B virus isolate C25, complete genome 1644.....................1664100
EU939542.1 Hepatitis B virus isolate C26, complete genome 1644.....................1664100
EU939543.1 Hepatitis B virus isolate C38, complete genome 1644.....................1664100
EU939544.1 Hepatitis B virus isolate C39, complete genome 1644.....................1664100
EU939545.1 Hepatitis B virus isolate C41, complete genome 1644.....................1664100
EU939546.1 Hepatitis B virus isolate C44, complete genome 1644.....................1664100
EU939547.1 Hepatitis B virus isolate C45, complete genome 1644.....................1664100
EU939549.1 Hepatitis B virus isolate C49, complete genome 1644.....................1664100
EU939550.1 Hepatitis B virus isolate C55, complete genome 1644.....................1664100
EU939551.1 Hepatitis B virus isolate C56, complete genome 1644.....................1664100
EU939552.1 Hepatitis B virus isolate C57, complete genome 1644.....................1664100
EU939553.1 Hepatitis B virus isolate C60, complete genome 1644.....................1664100
EU939554.1 Hepatitis B virus isolate C61, complete genome 1644.....................1664100
EU939555.1 Hepatitis B virus isolate C63, complete genome 1644.....................1664100
EU939556.1 Hepatitis B virus isolate C64, complete genome 1635.....................1655100
EU939557.1 Hepatitis B virus isolate C65, complete genome 1632.....................1652100
EU939558.1 Hepatitis B virus isolate C66, complete genome 1614.....................1634100
EU939560.1 Hepatitis B virus isolate C69, complete genome 1611.....................1631100
EU939561.1 Hepatitis B virus isolate C70, complete genome 1644.....................1664100
EU939563.1 Hepatitis B virus isolate C76, complete genome 1644.....................1664100
EU939564.1 Hepatitis B virus isolate C77, complete genome 1644.....................1664100
EU939566.1 Hepatitis B virus isolate C88, complete genome 1644.....................1664100
EU939567.1 Hepatitis B virus isolate C91, complete genome 1644.....................1664100
EU939569.1 Hepatitis B virus isolate C102, complete genome 1644.....................1664100
EU939570.1 Hepatitis B virus isolate C103, complete genome 1644.....................1664100
EU939572.1 Hepatitis B virus isolate C105, complete genome 1644.....................1664100
EU939573.1 Hepatitis B virus isolate C106, complete genome 1644.....................1664100
EU939574.1 Hepatitis B virus isolate C109, complete genome 1616.....................1636100
EU939577.1 Hepatitis B virus isolate C116, complete genome 1644.....................1664100
EU939578.1 Hepatitis B virus isolate C119, complete genome 1644.....................1664100
EU939580.1 Hepatitis B virus isolate B1, complete genome 1644.....................1664100
EU939582.1 Hepatitis B virus isolate B25, complete genome 1644.....................1664100
EU939583.1 Hepatitis B virus isolate B31, complete genome 1602.....................1622100
EU939584.1 Hepatitis B virus isolate B107, complete genome 1644.....................1664100
EU939585.1 Hepatitis B virus isolate B126, complete genome 1644.....................1664100
EU939586.1 Hepatitis B virus isolate B142, complete genome 1644.....................1664100
EU939587.1 Hepatitis B virus isolate C2, complete genome 1644.....................1664100
EU939592.1 Hepatitis B virus isolate C141, complete genome 1644.....................1664100
EU939593.1 Hepatitis B virus isolate C144, complete genome 1644.....................1664100
EU939594.1 Hepatitis B virus isolate C146, complete genome 1644.....................1664100
EU939595.1 Hepatitis B virus isolate C147, complete genome 1644.....................1664100
EU939597.1 Hepatitis B virus isolate C151, complete genome 1644.....................1664100
EU939599.1 Hepatitis B virus isolate C172, complete genome 1641.....................1661100
EU939600.1 Hepatitis B virus isolate C176, complete genome 1644.....................1664100
EU939602.1 Hepatitis B virus isolate C179, complete genome 1644.....................1664100
EU939604.1 Hepatitis B virus isolate C192, complete genome 1644.....................1664100
EU939605.1 Hepatitis B virus isolate C200, complete genome 1644.....................1664100
EU939606.1 Hepatitis B virus isolate C206, complete genome 1644.....................1664100
EU939607.1 Hepatitis B virus isolate C207, complete genome 1644.....................1664100
EU939608.1 Hepatitis B virus isolate C208, complete genome 1619.....................1639100
EU939612.1 Hepatitis B virus isolate C213, complete genome 1644.....................1664100
EU939613.1 Hepatitis B virus isolate C214, complete genome 1644.....................1664100
EU939615.1 Hepatitis B virus isolate C226, complete genome 1644.....................1664100
EU939616.1 Hepatitis B virus isolate C228, complete genome 1644.....................1664100
EU939617.1 Hepatitis B virus isolate C229, complete genome 1644.....................1664100
EU939620.1 Hepatitis B virus isolate B140, complete genome 1644.....................1664100
EU939621.1 Hepatitis B virus isolate C94, complete genome 1644.....................1664100
EU939622.1 Hepatitis B virus isolate C124, complete genome 1644.....................1664100
EU939625.1 Hepatitis B virus isolate C167, complete genome 1644.....................1664100
EU939626.1 Hepatitis B virus isolate D158, complete genome 1644.....................1664100
EU939627.1 Hepatitis B virus isolate C15, complete genome 1644.....................1664100
EU939630.1 Hepatitis B virus isolate C122, complete genome 1644.....................1664100
EU939641.1 Hepatitis B virus isolate D18, complete genome 1590.....................1610100
EU939642.1 Hepatitis B virus isolate D20, complete genome 1644.....................1664100
EU939643.1 Hepatitis B virus isolate D32, complete genome 1644.....................1664100
EU939645.1 Hepatitis B virus isolate D38, complete genome 1644.....................1664100
EU939647.1 Hepatitis B virus isolate D90, complete genome 1644.....................1664100
EU939649.1 Hepatitis B virus isolate D98, complete genome 1644.....................1664100
EU939650.1 Hepatitis B virus isolate D103, complete genome 1615.....................1635100
EU939651.1 Hepatitis B virus isolate D104, complete genome 1644.....................1664100
EU939652.1 Hepatitis B virus isolate D107, complete genome 1644.....................1664100
EU939657.1 Hepatitis B virus isolate D139, complete genome 1644.....................1664100
EU939658.1 Hepatitis B virus isolate D142, complete genome 1644.....................1664100
EU939680.1 Hepatitis B virus isolate C186, complete genome 1644.....................1664100
EU939681.1 Hepatitis B virus isolate D146, complete genome 1644.....................1664100
EU366129.2 Hepatitis B virus isolate BA92, complete genome 1644.....................1664100
AB367392.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 1, derived 1644.....................1664100
AB367393.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 2/Adefovir-1644.....................1664100
AB367395.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 4, derived 1644.....................1664100
AB367396.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 5, derived 1644.....................1664100
AB367397.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 6, derived 1644.....................1664100
AB367398.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 7/Adefovir-1644.....................1664100
AB367400.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 9, derived 1644.....................1664100
AB367403.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 12/Adefovir1644.....................1664100
AB367404.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 13/Adefovir1644.....................1664100
AB367405.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 14/Adefovir1596.....................1616100
AB367406.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 15/Adefovir1644.....................1664100
AB367407.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 16/Adefovir1644.....................1664100
AB367412.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 21, derived1644.....................1664100
AB367413.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 22/Adefovir1611.....................1631100
AB367414.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 23/Adefovir1644.....................1664100
AB367415.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 24/Adefovir1659.....................1679100
AB367416.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 25, derived1644.....................1664100
AB367417.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 26, derived1644.....................1664100
AB367420.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 29, derived1644.....................1664100
AB367421.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 30, derived1644.....................1664100
AB367422.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 31/Adefovir1644.....................1664100
AB367423.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 32/Adefovir1644.....................1664100
AB367424.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 33, derived1644.....................1664100
AB367425.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 34/Adefovir1608.....................1628100
AB367427.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 36/Adefovir1644.....................1664100
AB367428.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 37/Adefovir1590.....................1610100
AB367432.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 41, derived1644.....................1664100
AB367434.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 43/Adefovir1644.....................1664100
AB367435.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 44/Adefovir1638.....................1658100
FJ151413.1 Hepatitis B virus strain FD-36-5, complete genome 1156.....................1176100
FJ151414.1 Hepatitis B virus strain FD18-3, complete genome 1159.....................1179100
AB367800.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 24 1644.....................1664100
AB367803.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 13 1644.....................1664100
AB367804.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 6 1644.....................1664100
FJ032331.1 Hepatitis B virus isolate S193-1 from China, complete genome 1644.....................1664100
FJ032334.1 Hepatitis B virus isolate S445-3 from China, complete genome 1644.....................1664100
FJ032336.1 Hepatitis B virus isolate S462-4 from China, complete genome 1644.....................1664100
FJ032337.1 Hepatitis B virus isolate S462-5 from China, complete genome 1644.....................1664100
FJ032338.1 Hepatitis B virus isolate S462-7 from China, complete genome 1644.....................1664100
FJ032339.1 Hepatitis B virus isolate S462-9 from China, complete genome 1644.....................1664100
FJ032350.1 Hepatitis B virus isolate S943-1 from China, complete genome 1644.....................1664100
FJ032351.1 Hepatitis B virus isolate S943-5 from China, complete genome 1644.....................1664100
FJ032355.1 Hepatitis B virus isolate S1030-8 from China, complete genome 1644.....................1664100
FJ032356.1 Hepatitis B virus isolate S1030-9 from China, complete genome 1644.....................1664100
FJ032359.1 Hepatitis B virus isolate S1634-1 from China, complete genome 1644.....................1664100
FJ032360.1 Hepatitis B virus isolate S1634-2 from China, complete genome 1644.....................1664100
FJ032361.1 Hepatitis B virus isolate S1634-7 from China, complete genome 1644.....................1664100
FJ023642.1 Hepatitis B virus isolate C2_C04-1257 S protein (S) and core protein 1644.....................1664100
FJ023632.1 Hepatitis B virus isolate B4_C04-0254 S protein (S) and core protein 1644.....................1664100
FJ023633.1 Hepatitis B virus isolate B4_C04-0583 S protein (S) and core protein 1644.....................1664100
FJ023634.1 Hepatitis B virus isolate B4_C04-1358 S protein (S) and core protein 1644.....................1664100
FJ023635.1 Hepatitis B virus isolate B4_M04-0467 S protein (S) and core protein 1644.....................1664100
FJ023636.1 Hepatitis B virus isolate B4_M04-0876 S protein (S) and core protein 1644.....................1664100
FJ023637.1 Hepatitis B virus isolate B5_M04-0013 S protein (S) and core protein 1644.....................1664100
FJ023638.1 Hepatitis B virus isolate B5_M04-0465 S protein (S) and core protein 1644.....................1664100
FJ023639.1 Hepatitis B virus isolate C2_C04-0968 S protein (S) and core protein 1644.....................1664100
FJ023640.1 Hepatitis B virus isolate C2_C04-1206 S protein (S) and core protein 1617.....................1637100
FJ023641.1 Hepatitis B virus isolate C2_C04-1237 S protein (S) and core protein 1644.....................1664100
FJ023643.1 Hepatitis B virus isolate C2_C04-1306 S protein (S) and core protein 1644.....................1664100
FJ023644.1 Hepatitis B virus isolate C2_C04-1318 S protein (S) and core protein 1644.....................1664100
FJ023645.1 Hepatitis B virus isolate C2_M04-0071 S protein (S) and core protein 1644.....................1664100
FJ023646.1 Hepatitis B virus isolate C2_M04-0201 S protein (S) and core protein 1644.....................1664100
FJ023647.1 Hepatitis B virus isolate C2_M04-0214 S protein (S) and core protein 1644.....................1664100
FJ023648.1 Hepatitis B virus isolate C2_M04-0273 S protein (S) and core protein 1644.....................1664100
FJ023649.1 Hepatitis B virus isolate C2_M04-0289 S protein (S) and core protein 1644.....................1664100