../../tmp/servers/virsirnadb/494663540
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap
Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi11141aataccgcagagtctagactc21
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 235.....................255100
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 255_________............24457
X02763.1 Hepatitis b virus genome (serotype adw2) 1644.....................1664100
X02763.1 Hepatitis b virus genome (serotype adw2) 1664_________............165357
X65257.1 Hepatitis B virus (ayw,patient C) PreS1, PreS2, PreC, C, X and polyme237.....................257100
X65257.1 Hepatitis B virus (ayw,patient C) PreS1, PreS2, PreC, C, X and polyme257_________............24657
X65258.1 Hepatitis B virus (ayw,patient CI) genes PreS1, PreS2, PreC, C, X and237.....................257100
X65258.1 Hepatitis B virus (ayw,patient CI) genes PreS1, PreS2, PreC, C, X and257_________............24657
X65259.1 Hepatitis B virus (ayw,patient E) genes PreS1, PreS2, PreC, C, X and 237.....................257100
X65259.1 Hepatitis B virus (ayw,patient E) genes PreS1, PreS2, PreC, C, X and 257_________............24657
X68292.1 Hepatitis B Virus DNA 237.....................257100
X68292.1 Hepatitis B Virus DNA 257_________............24657
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 235.....................255100
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 255_________............24457
V01460.1 Hepatitis B virus (strain ayw) genome 2950.....................2930100
V01460.1 Hepatitis B virus (strain ayw) genome 2930_________............294157
X02496.1 Human hepatitis B virus strain ayw variant 237.....................257100
X02496.1 Human hepatitis B virus strain ayw variant 257_________............24657
S50225.1 {HBV variant} [hepatitis B virus HBV, surface antigen-negative patien237.....................257100
S50225.1 {HBV variant} [hepatitis B virus HBV, surface antigen-negative patien257_________............24657
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 235.....................255100
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 255_________............24457
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 237.....................257100
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 257_________............24657
X59795.1 Hepatitis B virus (ayw subtype mutant) complete genome 216.....................236100
X59795.1 Hepatitis B virus (ayw subtype mutant) complete genome 236_________............22557
X75657.1 Human hepatitis virus (genotype E, Bas) preS1, preS2, S, C, X, antige235.....................255100
X75657.1 Human hepatitis virus (genotype E, Bas) preS1, preS2, S, C, X, antige255_________............24457
X75664.1 Human hepatitis virus (genotype E, Kou) preS1, preS2, S, C, X, antige235.....................255100
X75664.1 Human hepatitis virus (genotype E, Kou) preS1, preS2, S, C, X, antige255_________............24457
Z35716.1 Human hepatitis B virus (ayw4) genes for surface protein S, core prot237.....................257100
Z35716.1 Human hepatitis B virus (ayw4) genes for surface protein S, core prot257_________............24657
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot237.....................257100
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot257_________............24657
X85254.1 Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polym237.....................257100
X85254.1 Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polym257_________............24657
X80924.1 Hepatitis B virus (patient 4) complete genome 237.....................257100
X80924.1 Hepatitis B virus (patient 4) complete genome 257_________............24657
X80926.1 Hepatitis B virus (patient 5) complete genome 237.....................257100
X80926.1 Hepatitis B virus (patient 5) complete genome 257_________............24657
X80925.1 Hepatitis B virus (patient 6) complete genome 237.....................257100
X80925.1 Hepatitis B virus (patient 6) complete genome 257_________............24657
X51970.1 Hepatitis B virus (HBV 991) complete genome 235.....................255100
X51970.1 Hepatitis B virus (HBV 991) complete genome 255_________............24457
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes235.....................255100
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes255_________............24457
Z72479.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes235.....................255100
Z72479.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes255_________............24457
X97848.1 Hepatitis B virus (patient 2) complete genome 237.....................257100
X97848.1 Hepatitis B virus (patient 2) complete genome 257_________............24657
X97849.1 Hepatitis B virus (patient 3) complete genome 237.....................257100
X97849.1 Hepatitis B virus (patient 3) complete genome 257_________............24657
Y07587.1 Hepatitis B virus, complete genome 237.....................257100
Y07587.1 Hepatitis B virus, complete genome 257_________............24657
U95551.1 Hepatitis B virus subtype ayw, complete genome 237.....................257100
U95551.1 Hepatitis B virus subtype ayw, complete genome 257_________............24657
AF043593.1 Hepatitis B virus isolate 6/89, complete genome 223.....................243100
AF043593.1 Hepatitis B virus isolate 6/89, complete genome 243_________............23257
AF043594.1 Hepatitis B virus isolate 1/91, complete genome 235.....................255100
AF043594.1 Hepatitis B virus isolate 1/91, complete genome 255_________............24457
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 235.....................255100
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 255_________............24457
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 235.....................255100
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 255_________............24457
AJ131567.1 Hepatitis B virus complete genome, isolate gor97 1604.....................1624100
AJ131567.1 Hepatitis B virus complete genome, isolate gor97 1624_________............161357
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 237.....................257100
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 257_________............24657
AF143298.1 Hepatitis B virus clone 7720-G8, complete genome 1580.....................1600100
AF143298.1 Hepatitis B virus clone 7720-G8, complete genome 1600_________............158957
AF143300.1 Hepatitis B virus clone 7832-G4, complete genome 1478.....................1498100
AF143300.1 Hepatitis B virus clone 7832-G4, complete genome 1498_________............148757
AF143301.1 Hepatitis B virus clone BW1903, complete genome 1448.....................1468100
AF143301.1 Hepatitis B virus clone BW1903, complete genome 1468_________............145757
AF143302.1 Hepatitis B virus clone HD1402, complete genome 1547.....................1567100
AF143302.1 Hepatitis B virus clone HD1402, complete genome 1567_________............155657
AF143303.1 Hepatitis B virus clone HD1406, complete genome 1547.....................1567100
AF143303.1 Hepatitis B virus clone HD1406, complete genome 1567_________............155657
AF143304.1 Hepatitis B virus clone HD319, complete genome 1556.....................1576100
AF143304.1 Hepatitis B virus clone HD319, complete genome 1576_________............156557
AF143305.1 Hepatitis B virus clone RM501, complete genome 1511.....................1531100
AF143305.1 Hepatitis B virus clone RM501, complete genome 1531_________............152057
AF143306.1 Hepatitis B virus clone RM517, complete genome 1547.....................1567100
AF143306.1 Hepatitis B virus clone RM517, complete genome 1567_________............155657
AF143307.1 Hepatitis B virus clone RM518, complete genome 1382.....................1402100
AF143307.1 Hepatitis B virus clone RM518, complete genome 1402_________............139157
AF143308.1 Hepatitis B virus clone WB1254, complete genome 1448.....................1468100
AF143308.1 Hepatitis B virus clone WB1254, complete genome 1468_________............145757
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 2083.....................2103100
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 2103_________............209257
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 2083.....................2103100
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 2103_________............209257
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 2083.....................2103100
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 2103_________............209257
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 2083.....................2103100
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 2103_________............209257
AF151735.1 Hepatitis B virus, complete genome 235.....................255100
AF151735.1 Hepatitis B virus, complete genome 255_________............24457
AB033558.1 Hepatitis B virus DNA, complete genome, isolate:JYW796 235.....................255100
AB033558.1 Hepatitis B virus DNA, complete genome, isolate:JYW796 255_________............24457
AB033559.1 Hepatitis B virus DNA, complete genome, isolate:PYW310 235.....................255100
AB033559.1 Hepatitis B virus DNA, complete genome, isolate:PYW310 255_________............24457
AB032431.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV/E-Ch195235.....................255100
AB032431.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV/E-Ch195255_________............24457
AB032432.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch256235.....................255100
AB032432.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch256255_________............24457
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch258235.....................255100
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch258255_________............24457
AF121239.1 Hepatitis B virus isolate HBV/1303, complete genome 235.....................255100
AF121239.1 Hepatitis B virus isolate HBV/1303, complete genome 255_________............24457
AF121240.1 Hepatitis B virus isolate HBV/11066, complete genome 235.....................255100
AF121240.1 Hepatitis B virus isolate HBV/11066, complete genome 255_________............24457
AF121241.1 Hepatitis B virus isolate HBV/1758, complete genome 235.....................255100
AF121241.1 Hepatitis B virus isolate HBV/1758, complete genome 255_________............24457
AF121242.1 Hepatitis B virus isolate HBV/1218, complete genome 235.....................255100
AF121242.1 Hepatitis B virus isolate HBV/1218, complete genome 255_________............24457
AF160501.1 Hepatitis B virus strain IG29227, complete genome 235.....................255100
AF160501.1 Hepatitis B virus strain IG29227, complete genome 255_________............24457
AF222322.1 Hepatitis B virus isolate CH109, complete genome 237.....................257100
AF222322.1 Hepatitis B virus isolate CH109, complete genome 257_________............24657
AF222323.1 Hepatitis B virus isolate CH926, complete genome 237.....................257100
AF222323.1 Hepatitis B virus isolate CH926, complete genome 257_________............24657
AF280817.1 Hepatitis B virus DNA, complete sequence, isolate: HBV-D1 235.....................255100
AF280817.1 Hepatitis B virus DNA, complete sequence, isolate: HBV-D1 255_________............24457
AF242585.1 Hepatitis B virus isolate CHIMP_2, complete genome 235.....................255100
AF242585.1 Hepatitis B virus isolate CHIMP_2, complete genome 255_________............24457
AF242586.1 Hepatitis B virus isolate CHIMP_4, complete genome 235.....................255100
AF242586.1 Hepatitis B virus isolate CHIMP_4, complete genome 255_________............24457
AF241407.1 Hepatitis B virus isolate 11141, complete genome 235.....................255100
AF241407.1 Hepatitis B virus isolate 11141, complete genome 255_________............24457
AF241408.1 Hepatitis B virus isolate 14118, complete genome 235.....................255100
AF241408.1 Hepatitis B virus isolate 14118, complete genome 255_________............24457
AF241410.1 Hepatitis B virus isolate 3270, complete genome 235.....................255100
AF241410.1 Hepatitis B virus isolate 3270, complete genome 255_________............24457
AF241411.1 Hepatitis B virus isolate 8290, complete genome 235.....................255100
AF241411.1 Hepatitis B virus isolate 8290, complete genome 255_________............24457
AF305327.1 Hepatitis B virus isolate CB0376, complete genome 237.....................257100
AF305327.1 Hepatitis B virus isolate CB0376, complete genome 257_________............24657
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 235.....................255100
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 255_________............24457
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 235.....................255100
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 255_________............24457
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 235.....................255100
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 255_________............24457
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 235.....................255100
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 255_________............24457
AY034878.1 Hepatitis B virus isolate HBVKL, complete genome 1631.....................1651100
AY034878.1 Hepatitis B virus isolate HBVKL, complete genome 1651_________............164057
AX155589.1 Sequence 1 from Patent WO0140279 235.....................255100
AX155589.1 Sequence 1 from Patent WO0140279 255_________............24457
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11235.....................255100
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11255_________............24457
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11235.....................255100
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11255_________............24457
AF297619.1 Hepatitis B virus adw2, complete genome 235.....................255100
AF297619.1 Hepatitis B virus adw2, complete genome 255_________............24457
AF297620.1 Hepatitis B virus adw1, complete genome 235.....................255100
AF297620.1 Hepatitis B virus adw1, complete genome 255_________............24457
AF297621.1 Hepatitis B virus isolate 78, complete genome 235.....................255100
AF297621.1 Hepatitis B virus isolate 78, complete genome 255_________............24457
AF297622.1 Hepatitis B virus isolate 79, complete genome 235.....................255100
AF297622.1 Hepatitis B virus isolate 79, complete genome 255_________............24457
AF297623.1 Hepatitis B virus isolate 83, complete genome 184.....................204100
AF297623.1 Hepatitis B virus isolate 83, complete genome 204_________............19357
AF297624.1 Hepatitis B virus isolate 80, complete genome 235.....................255100
AF297624.1 Hepatitis B virus isolate 80, complete genome 255_________............24457
AF297625.1 Hepatitis B virus isolate 84, complete genome 235.....................255100
AF297625.1 Hepatitis B virus isolate 84, complete genome 255_________............24457
AB056513.1 Hepatitis B virus DNA, complete genome, clone:USG17 235.....................255100
AB056513.1 Hepatitis B virus DNA, complete genome, clone:USG17 255_________............24457
AB056514.1 Hepatitis B virus DNA, complete genome, clone:USG15 226.....................246100
AB056514.1 Hepatitis B virus DNA, complete genome, clone:USG15 246_________............23557
AB056515.1 Hepatitis B virus DNA, complete genome, clone:USG16 235.....................255100
AB056515.1 Hepatitis B virus DNA, complete genome, clone:USG16 255_________............24457
AB056516.1 Hepatitis B virus DNA, complete genome, clone:USG18 513.....................533100
AB056516.1 Hepatitis B virus DNA, complete genome, clone:USG18 533_________............52257
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 235.....................255100
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 255_________............24457
AB064310.1 Hepatitis B virus DNA, complete genome, clone:USG769 235.....................255100
AB064310.1 Hepatitis B virus DNA, complete genome, clone:USG769 255_________............24457
AB064311.1 Hepatitis B virus DNA, complete genome, clone:USG825 235.....................255100
AB064311.1 Hepatitis B virus DNA, complete genome, clone:USG825 255_________............24457
AB064312.1 Hepatitis B virus DNA, complete genome, clone:USG916 235.....................255100
AB064312.1 Hepatitis B virus DNA, complete genome, clone:USG916 255_________............24457
AB064313.1 Hepatitis B virus DNA, complete genome, clone:USG2638 235.....................255100
AB064313.1 Hepatitis B virus DNA, complete genome, clone:USG2638 255_________............24457
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 235.....................255100
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 255_________............24457
AF461043.1 Hepatitis B virus, complete genome 235.....................255100
AF461043.1 Hepatitis B virus, complete genome 255_________............24457
AF462041.1 Hepatitis B virus clone pAM6, complete genome 235.....................255100
AF462041.1 Hepatitis B virus clone pAM6, complete genome 255_________............24457
AJ344115.1 Hepatitis B virus complete genome, genotype A, isolate X27 235.....................255100
AJ344115.1 Hepatitis B virus complete genome, genotype A, isolate X27 255_________............24457
AJ344116.1 Hepatitis B virus complete genome, genotype D, isolate GX27 235.....................255100
AJ344116.1 Hepatitis B virus complete genome, genotype D, isolate GX27 255_________............24457
AJ344117.1 Hepatitis B virus complete genome, genotype D 235.....................255100
AJ344117.1 Hepatitis B virus complete genome, genotype D 255_________............24457
U87742.3 Hepatitis B virus isolate 7983, complete genome 237.....................257100
U87742.3 Hepatitis B virus isolate 7983, complete genome 257_________............24657
AB073852.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry11 235.....................255100
AB073852.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry11 255_________............24457
AY090453.1 Hepatitis B virus strain 14-94, complete genome 238.....................258100
AY090453.1 Hepatitis B virus strain 14-94, complete genome 258_________............24757
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro235.....................255100
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro255_________............24457
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro235.....................255100
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro255_________............24457
AY128092.1 Hepatitis B virus clone pEco63, complete genome 237.....................257100
AY128092.1 Hepatitis B virus clone pEco63, complete genome 257_________............24657
AF537371.1 Hepatitis B virus clone 3.4, complete genome 235.....................255100
AF537371.1 Hepatitis B virus clone 3.4, complete genome 255_________............24457
AF537372.1 Hepatitis B virus clone 4B, complete genome 235.....................255100
AF537372.1 Hepatitis B virus clone 4B, complete genome 255_________............24457
AF498266.1 Hepatitis B virus isolate FG, complete genome 235.....................255100
AF498266.1 Hepatitis B virus isolate FG, complete genome 255_________............24457
AF418676.1 Hepatitis B virus patient 567 clone 1, complete genome 220.....................240100
AF418676.1 Hepatitis B virus patient 567 clone 1, complete genome 240_________............22957
AF418677.1 Hepatitis B virus patient 567 clone 2, complete genome 220.....................240100
AF418677.1 Hepatitis B virus patient 567 clone 2, complete genome 240_________............22957
AF418678.1 Hepatitis B virus patient 567 clone 3, complete genome 181.....................201100
AF418678.1 Hepatitis B virus patient 567 clone 3, complete genome 201_________............19057
AF418679.1 Hepatitis B virus patient 821 clone 1, complete genome 237.....................257100
AF418679.1 Hepatitis B virus patient 821 clone 1, complete genome 257_________............24657
AF418680.1 Hepatitis B virus patient 821 clone 2, complete genome 237.....................257100
AF418680.1 Hepatitis B virus patient 821 clone 2, complete genome 257_________............24657
AF418681.1 Hepatitis B virus patient 821 clone 3, complete genome 237.....................257100
AF418681.1 Hepatitis B virus patient 821 clone 3, complete genome 257_________............24657
AF418682.1 Hepatitis B virus patient 4727 clone 1, complete genome 237.....................257100
AF418682.1 Hepatitis B virus patient 4727 clone 1, complete genome 257_________............24657
AF418683.1 Hepatitis B virus patient 4727 clone 2, complete genome 237.....................257100
AF418683.1 Hepatitis B virus patient 4727 clone 2, complete genome 257_________............24657
AF418684.1 Hepatitis B virus patient 313 clone 1, complete genome 237.....................257100
AF418684.1 Hepatitis B virus patient 313 clone 1, complete genome 257_________............24657
AF418685.1 Hepatitis B virus patient 313 clone 2, complete genome 237.....................257100
AF418685.1 Hepatitis B virus patient 313 clone 2, complete genome 257_________............24657
AF418686.1 Hepatitis B virus patient 313 clone 3, complete genome 237.....................257100
AF418686.1 Hepatitis B virus patient 313 clone 3, complete genome 257_________............24657
AF418687.1 Hepatitis B virus patient 313 clone 4, complete genome 234.....................254100
AF418687.1 Hepatitis B virus patient 313 clone 4, complete genome 254_________............24357
AF418688.1 Hepatitis B virus patient 313 clone 5, complete genome 237.....................257100
AF418688.1 Hepatitis B virus patient 313 clone 5, complete genome 257_________............24657
AF418689.1 Hepatitis B virus patient 313 clone 6, complete genome 237.....................257100
AF418689.1 Hepatitis B virus patient 313 clone 6, complete genome 257_________............24657
AF418690.1 Hepatitis B virus patient 313 clone 7, complete genome 237.....................257100
AF418690.1 Hepatitis B virus patient 313 clone 7, complete genome 257_________............24657
AF418691.1 Hepatitis B virus patient 313 clone 8, complete genome 237.....................257100
AF418691.1 Hepatitis B virus patient 313 clone 8, complete genome 257_________............24657
AF418692.1 Hepatitis B virus patient 313 clone 9, complete genome 237.....................257100
AF418692.1 Hepatitis B virus patient 313 clone 9, complete genome 257_________............24657
AY152726.1 Hepatitis B virus isolate 8.22, complete genome 235.....................255100
AY152726.1 Hepatitis B virus isolate 8.22, complete genome 255_________............24457
AY161138.1 Hepatitis B virus clone S1.1 complete genome 235.....................255100
AY161138.1 Hepatitis B virus clone S1.1 complete genome 255_________............24457
AY161139.1 Hepatitis B virus clone S1.2 complete genome 235.....................255100
AY161139.1 Hepatitis B virus clone S1.2 complete genome 255_________............24457
AY161142.1 Hepatitis B virus clone S3.1, complete genome 181.....................201100
AY161142.1 Hepatitis B virus clone S3.1, complete genome 201_________............19057
AY161143.1 Hepatitis B virus clone S3.2, complete genome 220.....................240100
AY161143.1 Hepatitis B virus clone S3.2, complete genome 240_________............22957
AY161144.1 Hepatitis B virus clone S3.3, complete genome 220.....................240100
AY161144.1 Hepatitis B virus clone S3.3, complete genome 240_________............22957
AY161145.1 Hepatitis B virus clone S4.1 complete genome 235.....................255100
AY161145.1 Hepatitis B virus clone S4.1 complete genome 255_________............24457
AY161146.1 Hepatitis B virus clone S4.2 complete genome 235.....................255100
AY161146.1 Hepatitis B virus clone S4.2 complete genome 255_________............24457
AY161147.1 Hepatitis B virus clone S5.1 complete genome 235.....................255100
AY161147.1 Hepatitis B virus clone S5.1 complete genome 255_________............24457
AY161148.1 Hepatitis B virus clone S5.2 complete genome 233.....................253100
AY161148.1 Hepatitis B virus clone S5.2 complete genome 253_________............24257
AY161149.1 Hepatitis B virus clone S5.3 complete genome 235.....................255100
AY161149.1 Hepatitis B virus clone S5.3 complete genome 255_________............24457
AY161150.1 Hepatitis B virus clone S6.1 complete genome 235.....................255100
AY161150.1 Hepatitis B virus clone S6.1 complete genome 255_________............24457
AY161151.1 Hepatitis B virus clone S6.2, complete genome 235.....................255100
AY161151.1 Hepatitis B virus clone S6.2, complete genome 255_________............24457
AY161152.1 Hepatitis B virus clone S6.3, complete genome 235.....................255100
AY161152.1 Hepatitis B virus clone S6.3, complete genome 255_________............24457
AY161153.1 Hepatitis B virus clone S6.4 complete genome 235.....................255100
AY161153.1 Hepatitis B virus clone S6.4 complete genome 255_________............24457
AY161154.1 Hepatitis B virus clone S6.5, complete genome 235.....................255100
AY161154.1 Hepatitis B virus clone S6.5, complete genome 255_________............24457
AY161155.1 Hepatitis B virus clone S6.6, complete genome 235.....................255100
AY161155.1 Hepatitis B virus clone S6.6, complete genome 255_________............24457
AY161156.1 Hepatitis B virus clone S6.7, complete genome 235.....................255100
AY161156.1 Hepatitis B virus clone S6.7, complete genome 255_________............24457
AY161157.1 Hepatitis B virus clone S7.1 complete genome 235.....................255100
AY161157.1 Hepatitis B virus clone S7.1 complete genome 255_________............24457
AY161158.1 Hepatitis B virus clone S7.2 complete genome 235.....................255100
AY161158.1 Hepatitis B virus clone S7.2 complete genome 255_________............24457
AY161159.1 Hepatitis B virus clone S8.1 complete genome 235.....................255100
AY161159.1 Hepatitis B virus clone S8.1 complete genome 255_________............24457
AY161160.1 Hepatitis B virus clone S8.2 complete genome 235.....................255100
AY161160.1 Hepatitis B virus clone S8.2 complete genome 255_________............24457
AY161161.1 Hepatitis B virus clone S9.1 complete genome 235.....................255100
AY161161.1 Hepatitis B virus clone S9.1 complete genome 255_________............24457
AY161162.1 Hepatitis B virus clone S9.2 complete genome 235.....................255100
AY161162.1 Hepatitis B virus clone S9.2 complete genome 255_________............24457
AY161163.1 Hepatitis B virus clone S9.3 complete genome 235.....................255100
AY161163.1 Hepatitis B virus clone S9.3 complete genome 255_________............24457
AB078032.1 Hepatitis B virus complete genome, isolate:AH1-SY 235.....................255100
AB078032.1 Hepatitis B virus complete genome, isolate:AH1-SY 255_________............24457
AB090268.1 Hepatitis B virus DNA, complete genome, strain:CH1-OHs 235.....................255100
AB090268.1 Hepatitis B virus DNA, complete genome, strain:CH1-OHs 255_________............24457
AB090269.1 Hepatitis B virus DNA, complete genome, strain:CH2-OHf 235.....................255100
AB090269.1 Hepatitis B virus DNA, complete genome, strain:CH2-OHf 255_________............24457
AB090270.1 Hepatitis B virus DNA, complete genome, strain:b-dono12 235.....................255100
AB090270.1 Hepatitis B virus DNA, complete genome, strain:b-dono12 255_________............24457
AB091255.1 Hepatitis B virus DNA, complete genome, isplate:ABI-129 235.....................255100
AB091255.1 Hepatitis B virus DNA, complete genome, isplate:ABI-129 255_________............24457
AB091256.1 Hepatitis B virus DNA, complete genome, isplate:ABI-212 235.....................255100
AB091256.1 Hepatitis B virus DNA, complete genome, isplate:ABI-212 255_________............24457
AB106564.1 Hepatitis B virus DNA, complete genome, isolate:HBV-GA325 235.....................255100
AB106564.1 Hepatitis B virus DNA, complete genome, isolate:HBV-GA325 255_________............24457
AB078031.2 Hepatitis B virus complete genome, isolate:FH1-YS 235.....................255100
AB078031.2 Hepatitis B virus complete genome, isolate:FH1-YS 255_________............24457
AB078033.2 Hepatitis B virus complete genome, isolate:IS1-OY 235.....................255100
AB078033.2 Hepatitis B virus complete genome, isolate:IS1-OY 255_________............24457
AB104709.1 Hepatitis B virus DNA, complete sequence, isolate: EG64 237.....................257100
AB104709.1 Hepatitis B virus DNA, complete sequence, isolate: EG64 257_________............24657
AB104710.1 Hepatitis B virus DNA, complete sequence, isolate: EG105 237.....................257100
AB104710.1 Hepatitis B virus DNA, complete sequence, isolate: EG105 257_________............24657
AB104711.1 Hepatitis B virus DNA, complete sequence, isolate: EG104 237.....................257100
AB104711.1 Hepatitis B virus DNA, complete sequence, isolate: EG104 257_________............24657
AB104712.1 Hepatitis B virus DNA, complete sequence, isolate: EG75 237.....................257100
AB104712.1 Hepatitis B virus DNA, complete sequence, isolate: EG75 257_________............24657
AY233274.1 Hepatitis B virus isolate 0962 complete genome 235.....................255100
AY233274.1 Hepatitis B virus isolate 0962 complete genome 255_________............24457
AY233275.1 Hepatitis B virus isolate 163 complete genome 235.....................255100
AY233275.1 Hepatitis B virus isolate 163 complete genome 255_________............24457
AY233276.1 Hepatitis B virus isolate 1839 complete genome 235.....................255100
AY233276.1 Hepatitis B virus isolate 1839 complete genome 255_________............24457
AY233277.1 Hepatitis B virus isolate 1848 complete genome 235.....................255100
AY233277.1 Hepatitis B virus isolate 1848 complete genome 255_________............24457
AY233278.1 Hepatitis B virus isolate 1 complete genome 235.....................255100
AY233278.1 Hepatitis B virus isolate 1 complete genome 255_________............24457
AY233279.1 Hepatitis B virus isolate 28 complete genome 235.....................255100
AY233279.1 Hepatitis B virus isolate 28 complete genome 255_________............24457
AY233280.1 Hepatitis B virus isolate 2 complete genome 235.....................255100
AY233280.1 Hepatitis B virus isolate 2 complete genome 255_________............24457
AY233281.1 Hepatitis B virus isolate 303 complete genome 235.....................255100
AY233281.1 Hepatitis B virus isolate 303 complete genome 255_________............24457
AY233282.1 Hepatitis B virus isolate 306 complete genome 235.....................255100
AY233282.1 Hepatitis B virus isolate 306 complete genome 255_________............24457
AY233283.1 Hepatitis B virus isolate 4038 complete genome 235.....................255100
AY233283.1 Hepatitis B virus isolate 4038 complete genome 255_________............24457
AY233284.1 Hepatitis B virus isolate 5283 complete genome 235.....................255100
AY233284.1 Hepatitis B virus isolate 5283 complete genome 255_________............24457
AY233285.1 Hepatitis B virus isolate 795 complete genome 235.....................255100
AY233285.1 Hepatitis B virus isolate 795 complete genome 255_________............24457
AY233286.1 Hepatitis B virus isolate 818 complete genome 235.....................255100
AY233286.1 Hepatitis B virus isolate 818 complete genome 255_________............24457
AY233287.1 Hepatitis B virus isolate 8225 complete genome 235.....................255100
AY233287.1 Hepatitis B virus isolate 8225 complete genome 255_________............24457
AY233288.1 Hepatitis B virus isolate 823 complete genome 235.....................255100
AY233288.1 Hepatitis B virus isolate 823 complete genome 255_________............24457
AY233289.1 Hepatitis B virus isolate 833 complete genome 235.....................255100
AY233289.1 Hepatitis B virus isolate 833 complete genome 255_________............24457
AY233291.1 Hepatitis B virus isolate 179 complete genome 235.....................255100
AY233291.1 Hepatitis B virus isolate 179 complete genome 255_________............24457
AY233292.1 Hepatitis B virus isolate 184 complete genome 235.....................255100
AY233292.1 Hepatitis B virus isolate 184 complete genome 255_________............24457
AY233293.1 Hepatitis B virus isolate 12 complete genome 235.....................255100
AY233293.1 Hepatitis B virus isolate 12 complete genome 255_________............24457
AY233294.1 Hepatitis B virus isolate 305 complete genome 235.....................255100
AY233294.1 Hepatitis B virus isolate 305 complete genome 255_________............24457
AY233295.1 Hepatitis B virus isolate 8 complete genome 235.....................255100
AY233295.1 Hepatitis B virus isolate 8 complete genome 255_________............24457
AY233296.1 Hepatitis B virus isolate 185 complete genome 235.....................255100
AY233296.1 Hepatitis B virus isolate 185 complete genome 255_________............24457
AY330911.1 Hepatitis B virus isolate Louisa complete genome 235.....................255100
AY330911.1 Hepatitis B virus isolate Louisa complete genome 255_________............24457
AY330912.1 Hepatitis B virus isolate Osang complete genome 235.....................255100
AY330912.1 Hepatitis B virus isolate Osang complete genome 255_________............24457
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co233.....................253100
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co253_________............24257
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 235.....................255100
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 255_________............24457
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 235.....................255100
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 255_________............24457
AY373430.1 Hepatitis B virus clone SWT.3 complete genome 235.....................255100
AY373430.1 Hepatitis B virus clone SWT.3 complete genome 255_________............24457
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 235.....................255100
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 255_________............24457
AY236160.1 Hepatitis B virus isolate 1A, complete genome 1597.....................1617100
AY236160.1 Hepatitis B virus isolate 1A, complete genome 1617_________............160657
AY236162.1 Hepatitis B virus isolate 23 A, complete genome 1597.....................1617100
AY236162.1 Hepatitis B virus isolate 23 A, complete genome 1617_________............160657
AY236163.1 Hepatitis B virus isolate 29, complete genome 1549.....................1569100
AY236163.1 Hepatitis B virus isolate 29, complete genome 1569_________............155857
AY236164.1 Hepatitis B virus isolate 30, complete genome 1597.....................1617100
AY236164.1 Hepatitis B virus isolate 30, complete genome 1617_________............160657
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 235.....................255100
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 255_________............24457
AB126581.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU301 237.....................257100
AB126581.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU301 257_________............24657
AB112066.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY624 235.....................255100
AB112066.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY624 255_________............24457
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 235.....................255100
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 255_________............24457
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 235.....................255100
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 255_________............24457
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 235.....................255100
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 255_________............24457
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 235.....................255100
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 255_________............24457
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 235.....................255100
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 255_________............24457
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 235.....................255100
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 255_________............24457
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 235.....................255100
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 255_________............24457
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 235.....................255100
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 255_________............24457
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 235.....................255100
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 255_________............24457
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 235.....................255100
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 255_________............24457
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 235.....................255100
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 255_________............24457
AB116087.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND8 235.....................255100
AB116087.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND8 255_________............24457
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 235.....................255100
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 255_________............24457
AB116089.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP39 235.....................255100
AB116089.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP39 255_________............24457
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 235.....................255100
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 255_________............24457
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 235.....................255100
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 255_________............24457
AB116092.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH20 235.....................255100
AB116092.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH20 255_________............24457
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 235.....................255100
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 255_________............24457
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 235.....................255100
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 255_________............24457
AB116266.1 Hepatitis B virus DNA, complete genome, strain: Ehime TY:871225 235.....................255100
AB116266.1 Hepatitis B virus DNA, complete genome, strain: Ehime TY:871225 255_________............24457
AY661792.1 Hepatitis B virus isolate ayw, complete genome 237.....................257100
AY661792.1 Hepatitis B virus isolate ayw, complete genome 257_________............24657
AY661793.1 Hepatitis B virus isolate 2, complete genome 237.....................257100
AY661793.1 Hepatitis B virus isolate 2, complete genome 257_________............24657
AB120308.1 Hepatitis B virus DNA, complete genome, strain:Ehime-full 20:IM 82082235.....................255100
AB120308.1 Hepatitis B virus DNA, complete genome, strain:Ehime-full 20:IM 82082255_________............24457
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 237.....................257100
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 257_________............24657
AY721605.1 Hepatitis B virus isolate AK1.1, complete genome 237.....................257100
AY721605.1 Hepatitis B virus isolate AK1.1, complete genome 257_________............24657
AY721606.1 Hepatitis B virus isolate AT1.2, complete genome 237.....................257100
AY721606.1 Hepatitis B virus isolate AT1.2, complete genome 257_________............24657
AY721607.1 Hepatitis B virus isolate HIY1.3, complete genome 237.....................257100
AY721607.1 Hepatitis B virus isolate HIY1.3, complete genome 257_________............24657
AY721608.1 Hepatitis B virus isolate IB1.4, complete genome 237.....................257100
AY721608.1 Hepatitis B virus isolate IB1.4, complete genome 257_________............24657
AY721609.1 Hepatitis B virus isolate AA1.5, complete genome 237.....................257100
AY721609.1 Hepatitis B virus isolate AA1.5, complete genome 257_________............24657
AY721610.1 Hepatitis B virus isolate FK1.6, complete genome 237.....................257100
AY721610.1 Hepatitis B virus isolate FK1.6, complete genome 257_________............24657
AY721611.1 Hepatitis B virus isolate SK1.7, complete genome 237.....................257100
AY721611.1 Hepatitis B virus isolate SK1.7, complete genome 257_________............24657
AY721612.1 Hepatitis B virus isolate BL1.8, complete genome 237.....................257100
AY721612.1 Hepatitis B virus isolate BL1.8, complete genome 257_________............24657
AY741794.1 Hepatitis B virus isolate IR-IPI-50, complete genome 237.....................257100
AY741794.1 Hepatitis B virus isolate IR-IPI-50, complete genome 257_________............24657
AY741795.1 Hepatitis B virus isolate IR-IPI-Hi, complete genome 237.....................257100
AY741795.1 Hepatitis B virus isolate IR-IPI-Hi, complete genome 257_________............24657
AY741796.1 Hepatitis B virus isolate IR-IPI-P3, complete genome 237.....................257100
AY741796.1 Hepatitis B virus isolate IR-IPI-P3, complete genome 257_________............24657
AY741797.1 Hepatitis B virus isolate IR-IPI-21, complete genome 237.....................257100
AY741797.1 Hepatitis B virus isolate IR-IPI-21, complete genome 257_________............24657
AY796030.1 Hepatitis B virus isolate FC1.9, complete genome 237.....................257100
AY796030.1 Hepatitis B virus isolate FC1.9, complete genome 257_________............24657
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 237.....................257100
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 257_________............24657
AY796032.1 Hepatitis B virus isolate NA1.11, complete genome 237.....................257100
AY796032.1 Hepatitis B virus isolate NA1.11, complete genome 257_________............24657
AB109475.1 Hepatitis B virus DNA, complete genome, strain:Ehime7: Iyo 0218004 235.....................255100
AB109475.1 Hepatitis B virus DNA, complete genome, strain:Ehime7: Iyo 0218004 255_________............24457
AB109476.1 Hepatitis B virus DNA, complete genome, strain:Ehime8: Iyo 8288043 235.....................255100
AB109476.1 Hepatitis B virus DNA, complete genome, strain:Ehime8: Iyo 8288043 255_________............24457
AB109477.1 Hepatitis B virus DNA, complete genome, strain:Ehime9: Iyo 529380 235.....................255100
AB109477.1 Hepatitis B virus DNA, complete genome, strain:Ehime9: Iyo 529380 255_________............24457
AB109478.1 Hepatitis B virus DNA, complete genome, strain:Ehime10: Iyo 41676 235.....................255100
AB109478.1 Hepatitis B virus DNA, complete genome, strain:Ehime10: Iyo 41676 255_________............24457
AB109479.1 Hepatitis B virus DNA, complete genome, strain:Ehime11: Iyo 529207 235.....................255100
AB109479.1 Hepatitis B virus DNA, complete genome, strain:Ehime11: Iyo 529207 255_________............24457
AB110075.1 Hepatitis B virus DNA, complete genome, strain: Ehime12:IM 011025 235.....................255100
AB110075.1 Hepatitis B virus DNA, complete genome, strain: Ehime12:IM 011025 255_________............24457
AY739674.1 Hepatitis B virus clone A1-33, complete genome 235.....................255100
AY739674.1 Hepatitis B virus clone A1-33, complete genome 255_________............24457
AY739675.1 Hepatitis B virus clone A1-35, complete genome 235.....................255100
AY739675.1 Hepatitis B virus clone A1-35, complete genome 255_________............24457
AY738144.1 Hepatitis B virus clone B3, complete genome 235.....................255100
AY738144.1 Hepatitis B virus clone B3, complete genome 255_________............24457
AY738145.1 Hepatitis B virus clone B5, complete genome 235.....................255100
AY738145.1 Hepatitis B virus clone B5, complete genome 255_________............24457
AY738146.1 Hepatitis B virus clone B9, complete genome 235.....................255100
AY738146.1 Hepatitis B virus clone B9, complete genome 255_________............24457
AY738147.1 Hepatitis B virus clone B11, complete genome 235.....................255100
AY738147.1 Hepatitis B virus clone B11, complete genome 255_________............24457
AY902768.1 Hepatitis B virus isolate MTB166, complete genome 235.....................255100
AY902768.1 Hepatitis B virus isolate MTB166, complete genome 255_________............24457
AY902769.1 Hepatitis B virus isolate MTB009, complete genome 235.....................255100
AY902769.1 Hepatitis B virus isolate MTB009, complete genome 255_________............24457
AY902770.1 Hepatitis B virus isolate MTB012, complete genome 235.....................255100
AY902770.1 Hepatitis B virus isolate MTB012, complete genome 255_________............24457
AY902772.1 Hepatitis B virus isolate MTB158, complete genome 235.....................255100
AY902772.1 Hepatitis B virus isolate MTB158, complete genome 255_________............24457
AY902773.1 Hepatitis B virus isolate MTB159, complete genome 235.....................255100
AY902773.1 Hepatitis B virus isolate MTB159, complete genome 255_________............24457
AY902774.1 Hepatitis B virus isolate MTB160, complete genome 235.....................255100
AY902774.1 Hepatitis B virus isolate MTB160, complete genome 255_________............24457
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 235.....................255100
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 255_________............24457
AY902776.1 Hepatitis B virus isolate MTB163, complete genome 235.....................255100
AY902776.1 Hepatitis B virus isolate MTB163, complete genome 255_________............24457
AY902777.1 Hepatitis B virus isolate MTB004, complete genome 235.....................255100
AY902777.1 Hepatitis B virus isolate MTB004, complete genome 255_________............24457
AB188241.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA25 235.....................255100
AB188241.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA25 255_________............24457
AB188242.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA38 235.....................255100
AB188242.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA38 255_________............24457
AB205118.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ1-1-2 235.....................255100
AB205118.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ1-1-2 255_________............24457
AB205126.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF714-1 235.....................255100
AB205126.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF714-1 255_________............24457
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 235.....................255100
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 255_________............24457
AB205128.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU316-1 235.....................255100
AB205128.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU316-1 255_________............24457
AB205129.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758-2 235.....................255100
AB205129.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758-2 255_________............24457
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 235.....................255100
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 255_________............24457
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 235.....................255100
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 255_________............24457
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 235.....................255100
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 255_________............24457
AY817511.1 Hepatitis B virus isolate CHN-L49 from China, complete genome 235.....................255100
AY817511.1 Hepatitis B virus isolate CHN-L49 from China, complete genome 255_________............24457
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 235.....................255100
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 255_________............24457
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 235.....................255100
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 255_________............24457
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 235.....................255100
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 255_________............24457
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 235.....................255100
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 255_________............24457
AY945307.1 Hepatitis B virus, complete genome 235.....................255100
AY945307.1 Hepatitis B virus, complete genome 255_________............24457
AP007262.1 HBV genotype E DNA, complete genome, isolate: HB-JI411F 235.....................255100
AP007262.1 HBV genotype E DNA, complete genome, isolate: HB-JI411F 255_________............24457
AP007263.1 HBV genotype A DNA, complete genome, isolate: HB-JI444AF 235.....................255100
AP007263.1 HBV genotype A DNA, complete genome, isolate: HB-JI444AF 255_________............24457
AP007264.1 HBV genotype G DNA, complete genome, isolate: HB-JI444GF 235.....................255100
AP007264.1 HBV genotype G DNA, complete genome, isolate: HB-JI444GF 255_________............24457
AY903452.1 Hepatitis B virus serotype adw2, complete genome 235.....................255100
AY903452.1 Hepatitis B virus serotype adw2, complete genome 255_________............24457
AY935700.1 Hepatitis B virus isolate TH-HBV-012, complete genome 235.....................255100
AY935700.1 Hepatitis B virus isolate TH-HBV-012, complete genome 255_________............24457
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 235.....................255100
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 255_________............24457
AY934764.1 Hepatitis B virus isolate 9210699, complete genome 235.....................255100
AY934764.1 Hepatitis B virus isolate 9210699, complete genome 255_________............24457
AY934765.1 Hepatitis B virus isolate 24306, complete genome 235.....................255100
AY934765.1 Hepatitis B virus isolate 24306, complete genome 255_________............24457
AY934766.1 Hepatitis B virus isolate 24233, complete genome 235.....................255100
AY934766.1 Hepatitis B virus isolate 24233, complete genome 255_________............24457
AY934767.1 Hepatitis B virus isolate 27178, complete genome 235.....................255100
AY934767.1 Hepatitis B virus isolate 27178, complete genome 255_________............24457
AY934768.1 Hepatitis B virus isolate 25830, complete genome 235.....................255100
AY934768.1 Hepatitis B virus isolate 25830, complete genome 255_________............24457
AY934769.1 Hepatitis B virus isolate 23719, complete genome 235.....................255100
AY934769.1 Hepatitis B virus isolate 23719, complete genome 255_________............24457
AY934770.1 Hepatitis B virus isolate 953642, complete genome 235.....................255100
AY934770.1 Hepatitis B virus isolate 953642, complete genome 255_________............24457
AY934772.1 Hepatitis B virus isolate 1908, complete genome 235.....................255100
AY934772.1 Hepatitis B virus isolate 1908, complete genome 255_________............24457
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 235.....................255100
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 255_________............24457
AY934774.1 Hepatitis B virus isolate 9615549, complete genome 235.....................255100
AY934774.1 Hepatitis B virus isolate 9615549, complete genome 255_________............24457
DQ020002.1 Hepatitis B virus isolate 380, complete genome 235.....................255100
DQ020002.1 Hepatitis B virus isolate 380, complete genome 255_________............24457
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 235.....................255100
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 255_________............24457
AB205188.1 Hepatitis B virus DNA, complete genome, isolate: HBV-GA283 220.....................240100
AB205188.1 Hepatitis B virus DNA, complete genome, isolate: HBV-GA283 240_________............22957
AB205189.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G138 235.....................255100
AB205189.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G138 255_________............24457
AB205190.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G123 235.....................255100
AB205190.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G123 255_________............24457
AB205191.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G166 235.....................255100
AB205191.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G166 255_________............24457
AB205192.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758 235.....................255100
AB205192.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758 255_________............24457
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 235.....................255100
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 255_________............24457
AB194948.1 Hepatitis B virus DNA, complete genome, isolate: CMR936 235.....................255100
AB194948.1 Hepatitis B virus DNA, complete genome, isolate: CMR936 255_________............24457
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 235.....................255100
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 255_________............24457
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 235.....................255100
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 255_________............24457
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 235.....................255100
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 255_________............24457
AB194952.1 Hepatitis B virus DNA, complete genome, isolate: CMR711 235.....................255100
AB194952.1 Hepatitis B virus DNA, complete genome, isolate: CMR711 255_________............24457
DQ078791.1 Hepatitis B virus from Thailand, complete genome 235.....................255100
DQ078791.1 Hepatitis B virus from Thailand, complete genome 255_________............24457
DQ089802.1 Hepatitis B virus isolate HK1371, complete genome 235.....................255100
DQ089802.1 Hepatitis B virus isolate HK1371, complete genome 255_________............24457
DQ060822.1 Hepatitis B virus isolate 8510-91, complete genome 235.....................255100
DQ060822.1 Hepatitis B virus isolate 8510-91, complete genome 255_________............24457
DQ060823.1 Hepatitis B virus isolate 8504-91, complete genome 235.....................255100
DQ060823.1 Hepatitis B virus isolate 8504-91, complete genome 255_________............24457
DQ060824.1 Hepatitis B virus isolate 0121-20, complete genome 235.....................255100
DQ060824.1 Hepatitis B virus isolate 0121-20, complete genome 255_________............24457
DQ060825.1 Hepatitis B virus isolate 0262-09, complete genome 235.....................255100
DQ060825.1 Hepatitis B virus isolate 0262-09, complete genome 255_________............24457
DQ060826.1 Hepatitis B virus isolate 0433-20, complete genome 235.....................255100
DQ060826.1 Hepatitis B virus isolate 0433-20, complete genome 255_________............24457
DQ060827.1 Hepatitis B virus isolate 0317-04, complete genome 235.....................255100
DQ060827.1 Hepatitis B virus isolate 0317-04, complete genome 255_________............24457
DQ060828.1 Hepatitis B virus isolate 0443-03, complete genome 235.....................255100
DQ060828.1 Hepatitis B virus isolate 0443-03, complete genome 255_________............24457
DQ060829.1 Hepatitis B virus isolate 0350-03, complete genome 235.....................255100
DQ060829.1 Hepatitis B virus isolate 0350-03, complete genome 255_________............24457
DQ060830.1 Hepatitis B virus isolate 235-01, complete genome 235.....................255100
DQ060830.1 Hepatitis B virus isolate 235-01, complete genome 255_________............24457
DQ111987.1 Hepatitis B virus isolate MMU36, complete genome 235.....................255100
DQ111987.1 Hepatitis B virus isolate MMU36, complete genome 255_________............24457
AY862860.1 Hepatitis B virus clone Q11, complete genome 235.....................255100
AY862860.1 Hepatitis B virus clone Q11, complete genome 255_________............24457
AY862861.1 Hepatitis B virus clone Q17, complete genome 235.....................255100
AY862861.1 Hepatitis B virus clone Q17, complete genome 255_________............24457
AY862862.1 Hepatitis B virus clone Q20, complete genome 235.....................255100
AY862862.1 Hepatitis B virus clone Q20, complete genome 255_________............24457
AY862863.1 Hepatitis B virus clone Q23, complete genome 235.....................255100
AY862863.1 Hepatitis B virus clone Q23, complete genome 255_________............24457
AY862864.1 Hepatitis B virus clone Q34, complete genome 235.....................255100
AY862864.1 Hepatitis B virus clone Q34, complete genome 255_________............24457
AY862865.1 Hepatitis B virus clone Q311, complete genome 235.....................255100
AY862865.1 Hepatitis B virus clone Q311, complete genome 255_________............24457
AY862866.1 Hepatitis B virus clone Q312, complete genome 237.....................257100
AY862866.1 Hepatitis B virus clone Q312, complete genome 257_________............24657
AY862867.1 Hepatitis B virus clone Q42, complete genome 235.....................255100
AY862867.1 Hepatitis B virus clone Q42, complete genome 255_________............24457
AY862868.1 Hepatitis B virus clone Q43, complete genome 235.....................255100
AY862868.1 Hepatitis B virus clone Q43, complete genome 255_________............24457
AB201287.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds235.....................255100
AB201287.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds255_________............24457
AB201288.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds235.....................255100
AB201288.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds255_________............24457
AB201289.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds235.....................255100
AB201289.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds255_________............24457
AB201290.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds235.....................255100
AB201290.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds255_________............24457
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 235.....................255100
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 255_________............24457
AB119251.1 Hepatitis B virus DNA, complete genome, strain:Ehime13:BD No2,2002082235.....................255100
AB119251.1 Hepatitis B virus DNA, complete genome, strain:Ehime13:BD No2,2002082255_________............24457
AB119252.1 Hepatitis B virus DNA, complete genome, strain:Ehime14:BD No7,2002082235.....................255100
AB119252.1 Hepatitis B virus DNA, complete genome, strain:Ehime14:BD No7,2002082255_________............24457
AB119253.1 Hepatitis B virus DNA, complete genome, strain:Ehime15:BD No27,H12.01235.....................255100
AB119253.1 Hepatitis B virus DNA, complete genome, strain:Ehime15:BD No27,H12.01255_________............24457
AB119254.1 Hepatitis B virus DNA, complete genome, strain:Ehime16:BD No53,200301235.....................255100
AB119254.1 Hepatitis B virus DNA, complete genome, strain:Ehime16:BD No53,200301255_________............24457
AB119255.1 Hepatitis B virus DNA, complete genome, strain:Ehime17:Iyo 0719039 235.....................255100
AB119255.1 Hepatitis B virus DNA, complete genome, strain:Ehime17:Iyo 0719039 255_________............24457
AB119256.1 Hepatitis B virus DNA, complete genome, strain:Ehime18:Iyo 529246 235.....................255100
AB119256.1 Hepatitis B virus DNA, complete genome, strain:Ehime18:Iyo 529246 255_________............24457
AB188245.2 Hepatitis B virus DNA, complete genome, isolate:ALTAY136 235.....................255100
AB188245.2 Hepatitis B virus DNA, complete genome, isolate:ALTAY136 255_________............24457
DQ207798.1 Hepatitis B virus strain N2829, complete genome 232.....................252100
DQ207798.1 Hepatitis B virus strain N2829, complete genome 252_________............24157
AB219529.1 Hepatitis B virus DNA, complete genome, isolate:UK1 223.....................243100
AB219529.1 Hepatitis B virus DNA, complete genome, isolate:UK1 243_________............23257
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 235.....................255100
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 255_________............24457
AB219531.1 Hepatitis B virus DNA, complete genome, isolate:UK3 235.....................255100
AB219531.1 Hepatitis B virus DNA, complete genome, isolate:UK3 255_________............24457
AB219532.1 Hepatitis B virus DNA, complete genome, isolate:UK4 235.....................255100
AB219532.1 Hepatitis B virus DNA, complete genome, isolate:UK4 255_________............24457
AB219533.1 Hepatitis B virus DNA, complete genome, isolate:UK5 235.....................255100
AB219533.1 Hepatitis B virus DNA, complete genome, isolate:UK5 255_________............24457
AB219534.1 Hepatitis B virus DNA, complete genome, isolate:UK6 205.....................225100
AB219534.1 Hepatitis B virus DNA, complete genome, isolate:UK6 225_________............21457
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 1636.....................1656100
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 1656_________............164557
DQ298162.1 Hepatitis B virus isolate LT3.12AM clone 2, complete genome 1636.....................1656100
DQ298162.1 Hepatitis B virus isolate LT3.12AM clone 2, complete genome 1656_________............164557
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 1636.....................1656100
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 1656_________............164557
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 1636.....................1656100
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 1656_________............164557
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 1636.....................1656100
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 1656_________............164557
DQ304547.1 Hepatitis B virus isolate LT4 clone 1, complete genome 1597.....................1617100
DQ304547.1 Hepatitis B virus isolate LT4 clone 1, complete genome 1617_________............160657
DQ304548.1 Hepatitis B virus isolate LT4 clone 2, complete genome 1597.....................1617100
DQ304548.1 Hepatitis B virus isolate LT4 clone 2, complete genome 1617_________............160657
DQ304549.1 Hepatitis B virus isolate LT4 clone 3, complete genome 1597.....................1617100
DQ304549.1 Hepatitis B virus isolate LT4 clone 3, complete genome 1617_________............160657
DQ304550.1 Hepatitis B virus isolate LT4 clone 4, complete genome 1597.....................1617100
DQ304550.1 Hepatitis B virus isolate LT4 clone 4, complete genome 1617_________............160657
DQ304551.1 Hepatitis B virus isolate LT4 clone 5, complete genome 1597.....................1617100
DQ304551.1 Hepatitis B virus isolate LT4 clone 5, complete genome 1617_________............160657
DQ329356.1 Hepatitis B virus isolate LT1 clone 1, complete genome 1592.....................1612100
DQ329356.1 Hepatitis B virus isolate LT1 clone 1, complete genome 1612_________............160157
DQ329357.1 Hepatitis B virus isolate LT1 clone 2, complete genome 1592.....................1612100
DQ329357.1 Hepatitis B virus isolate LT1 clone 2, complete genome 1612_________............160157
AJ627215.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 06115 235.....................255100
AJ627215.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 06115 255_________............24457
AJ627216.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 17707 235.....................255100
AJ627216.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 17707 255_________............24457
AJ627218.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21116 235.....................255100
AJ627218.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21116 255_________............24457
AJ627219.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 24039 235.....................255100
AJ627219.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 24039 255_________............24457
AJ627220.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 29234 235.....................255100
AJ627220.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 29234 255_________............24457
AJ627221.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 30125 235.....................255100
AJ627221.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 30125 255_________............24457
AJ627222.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 31228 235.....................255100
AJ627222.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 31228 255_________............24457
AJ627223.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33720 235.....................255100
AJ627223.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33720 255_________............24457
AJ627224.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33852 235.....................255100
AJ627224.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33852 255_________............24457
AJ627226.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20952 226.....................246100
AJ627226.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20952 246_________............23557
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 235.....................255100
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 255_________............24457
AJ627228.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 34408 223.....................243100
AJ627228.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 34408 243_________............23257
DQ315776.1 Hepatitis B virus isolate EI00615, complete genome 235.....................255100
DQ315776.1 Hepatitis B virus isolate EI00615, complete genome 255_________............24457
DQ315777.1 Hepatitis B virus isolate EI03194, complete genome 235.....................255100
DQ315777.1 Hepatitis B virus isolate EI03194, complete genome 255_________............24457
DQ315778.1 Hepatitis B virus isolate EI0388, complete genome 235.....................255100
DQ315778.1 Hepatitis B virus isolate EI0388, complete genome 255_________............24457
DQ315779.1 Hepatitis B virus isolate EI0399, complete genome 235.....................255100
DQ315779.1 Hepatitis B virus isolate EI0399, complete genome 255_________............24457
DQ315780.1 Hepatitis B virus isolate EI02456, complete genome 205.....................225100
DQ315780.1 Hepatitis B virus isolate EI02456, complete genome 225_________............21457
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 235.....................255100
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 255_________............24457
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 235.....................255100
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 255_________............24457
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 235.....................255100
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 255_________............24457
DQ399006.1 Hepatitis B virus isolate G1, complete genome 1517.....................1537100
DQ399006.1 Hepatitis B virus isolate G1, complete genome 1537_________............152657
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 235.....................255100
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 255_________............24457
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 235.....................255100
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 255_________............24457
AB222709.1 Hepatitis B virus DNA, complete genome, isolate: UZBV34 235.....................255100
AB222709.1 Hepatitis B virus DNA, complete genome, isolate: UZBV34 255_________............24457
AB222710.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6M 235.....................255100
AB222710.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6M 255_________............24457
AB222711.1 Hepatitis B virus DNA, complete genome, isolate: UZNV24 235.....................255100
AB222711.1 Hepatitis B virus DNA, complete genome, isolate: UZNV24 255_________............24457
AB222712.1 Hepatitis B virus DNA, complete genome, isolate: UZBV61 235.....................255100
AB222712.1 Hepatitis B virus DNA, complete genome, isolate: UZBV61 255_________............24457
AB222713.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6 235.....................255100
AB222713.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6 255_________............24457
AB210818.1 Hepatitis B virus DNA, complete genome, strain:Ehime 21-NM 235.....................255100
AB210818.1 Hepatitis B virus DNA, complete genome, strain:Ehime 21-NM 255_________............24457
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 235.....................255100
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 255_________............24457
AB210820.1 Hepatitis B virus DNA, complete genome, strain:Tokyo 1 235.....................255100
AB210820.1 Hepatitis B virus DNA, complete genome, strain:Tokyo 1 255_________............24457
AB210821.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 1-OA 235.....................255100
AB210821.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 1-OA 255_________............24457
AB210822.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 2-OS 235.....................255100
AB210822.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 2-OS 255_________............24457
DQ463787.1 Hepatitis B virus isolate 928-9_1979, complete genome 235.....................255100
DQ463787.1 Hepatitis B virus isolate 928-9_1979, complete genome 255_________............24457
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 235.....................255100
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 255_________............24457
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 235.....................255100
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 255_________............24457
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 235.....................255100
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 255_________............24457
DQ463791.1 Hepatitis B virus isolate 539-16_1979, complete genome 235.....................255100
DQ463791.1 Hepatitis B virus isolate 539-16_1979, complete genome 255_________............24457
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 235.....................255100
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 255_________............24457
DQ463793.1 Hepatitis B virus isolate 462-4_1979, complete genome 235.....................255100
DQ463793.1 Hepatitis B virus isolate 462-4_1979, complete genome 255_________............24457
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 235.....................255100
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 255_________............24457
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 235.....................255100
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 255_________............24457
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 235.....................255100
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 255_________............24457
DQ463800.1 Hepatitis B virus isolate 524-3_2004, complete genome 235.....................255100
DQ463800.1 Hepatitis B virus isolate 524-3_2004, complete genome 255_________............24457
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 235.....................255100
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 255_________............24457
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 235.....................255100
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 255_________............24457
AM180623.1 Hepatitis B virus complete genome, isolate MAL36 235.....................255100
AM180623.1 Hepatitis B virus complete genome, isolate MAL36 255_________............24457
AM180624.1 Hepatitis B virus complete genome, isolate CAE168 235.....................255100
AM180624.1 Hepatitis B virus complete genome, isolate CAE168 255_________............24457
DQ478881.1 Hepatitis B virus isolate CHN-QH2, complete genome 235.....................255100
DQ478881.1 Hepatitis B virus isolate CHN-QH2, complete genome 255_________............24457
DQ478882.1 Hepatitis B virus isolate CHN-QH3, complete genome 235.....................255100
DQ478882.1 Hepatitis B virus isolate CHN-QH3, complete genome 255_________............24457
DQ478883.1 Hepatitis B virus isolate CHN-QH33, complete genome 235.....................255100
DQ478883.1 Hepatitis B virus isolate CHN-QH33, complete genome 255_________............24457
DQ478884.1 Hepatitis B virus isolate CHN-QH4, complete genome 235.....................255100
DQ478884.1 Hepatitis B virus isolate CHN-QH4, complete genome 255_________............24457
DQ478886.1 Hepatitis B virus isolate CHN-QH5, complete genome 235.....................255100
DQ478886.1 Hepatitis B virus isolate CHN-QH5, complete genome 255_________............24457
DQ478887.1 Hepatitis B virus isolate CHN-QH8, complete genome 235.....................255100
DQ478887.1 Hepatitis B virus isolate CHN-QH8, complete genome 255_________............24457
DQ478888.1 Hepatitis B virus isolate CHN-QH9, complete genome 235.....................255100
DQ478888.1 Hepatitis B virus isolate CHN-QH9, complete genome 255_________............24457
DQ478889.1 Hepatitis B virus isolate CHN-QH14, complete genome 235.....................255100
DQ478889.1 Hepatitis B virus isolate CHN-QH14, complete genome 255_________............24457
DQ478890.1 Hepatitis B virus isolate CHN-QH18, complete genome 235.....................255100
DQ478890.1 Hepatitis B virus isolate CHN-QH18, complete genome 255_________............24457
DQ478891.1 Hepatitis B virus isolate CHN-QH19, complete genome 235.....................255100
DQ478891.1 Hepatitis B virus isolate CHN-QH19, complete genome 255_________............24457
DQ478892.1 Hepatitis B virus isolate CHN-QH28, complete genome 235.....................255100
DQ478892.1 Hepatitis B virus isolate CHN-QH28, complete genome 255_________............24457
DQ478893.1 Hepatitis B virus isolate CHN-QH29, complete genome 235.....................255100
DQ478893.1 Hepatitis B virus isolate CHN-QH29, complete genome 255_________............24457
DQ478894.1 Hepatitis B virus isolate CHN-QH30, complete genome 235.....................255100
DQ478894.1 Hepatitis B virus isolate CHN-QH30, complete genome 255_________............24457
DQ478895.1 Hepatitis B virus isolate CHN-QH31, complete genome 235.....................255100
DQ478895.1 Hepatitis B virus isolate CHN-QH31, complete genome 255_________............24457
DQ478896.1 Hepatitis B virus isolate CHN-QH32, complete genome 235.....................255100
DQ478896.1 Hepatitis B virus isolate CHN-QH32, complete genome 255_________............24457
DQ478897.1 Hepatitis B virus isolate CHN-QH37, complete genome 235.....................255100
DQ478897.1 Hepatitis B virus isolate CHN-QH37, complete genome 255_________............24457
DQ478898.1 Hepatitis B virus isolate CHN-QH38, complete genome 235.....................255100
DQ478898.1 Hepatitis B virus isolate CHN-QH38, complete genome 255_________............24457
DQ486022.1 Hepatitis B virus isolate LT11, complete genome 1597.....................1617100
DQ486022.1 Hepatitis B virus isolate LT11, complete genome 1617_________............160657
DQ486023.1 Hepatitis B virus isolate LT10, complete genome 1576.....................1596100
DQ486023.1 Hepatitis B virus isolate LT10, complete genome 1596_________............158557
DQ486025.1 Hepatitis B virus isolate LT12, complete genome 1597.....................1617100
DQ486025.1 Hepatitis B virus isolate LT12, complete genome 1617_________............160657
AB241114.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC01 235.....................255100
AB241114.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC01 255_________............24457
AB241115.1 Hepatitis B virus DNA, complete genome, isolate:PhCH09 235.....................255100
AB241115.1 Hepatitis B virus DNA, complete genome, isolate:PhCH09 255_________............24457
AM282986.1 Hepatitis B virus (SUBTYPE ADW2), genotype A, complete genome 235.....................255100
AM282986.1 Hepatitis B virus (SUBTYPE ADW2), genotype A, complete genome 255_________............24457
AB246317.1 Hepatitis B virus DNA, complete genome, isolate: TA112 199.....................219100
AB246317.1 Hepatitis B virus DNA, complete genome, isolate: TA112 219_________............20857
DQ788725.1 Hepatitis B virus clone S1, complete genome 235.....................255100
DQ788725.1 Hepatitis B virus clone S1, complete genome 255_________............24457
DQ788726.1 Hepatitis B virus clone S15, complete genome 229.....................249100
DQ788726.1 Hepatitis B virus clone S15, complete genome 249_________............23857
DQ788727.1 Hepatitis B virus clone S18, complete genome 229.....................249100
DQ788727.1 Hepatitis B virus clone S18, complete genome 249_________............23857
DQ788728.1 Hepatitis B virus clone S24, complete genome 229.....................249100
DQ788728.1 Hepatitis B virus clone S24, complete genome 249_________............23857
DQ788729.1 Hepatitis B virus clone L1, complete genome 229.....................249100
DQ788729.1 Hepatitis B virus clone L1, complete genome 249_________............23857
AM184126.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate N35 235.....................255100
AM184126.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate N35 255_________............24457
AM117394.1 Hepatitis B virus, isolate CHIMP_DJA, complete genome 234.....................254100
AM117394.1 Hepatitis B virus, isolate CHIMP_DJA, complete genome 254_________............24357
AM117395.1 Hepatitis B virus, isolate CHIMP_MAK, complete genome 234.....................254100
AM117395.1 Hepatitis B virus, isolate CHIMP_MAK, complete genome 254_________............24357
AM117396.1 Hepatitis B virus, isolate CHIMP_BAT, complete genome 234.....................254100
AM117396.1 Hepatitis B virus, isolate CHIMP_BAT, complete genome 254_________............24357
AM117397.1 Hepatitis B virus, isolate CHIMP_ED, complete genome 234.....................254100
AM117397.1 Hepatitis B virus, isolate CHIMP_ED, complete genome 254_________............24357
AB246335.1 Hepatitis B virus DNA, complete genome, clone: Aa_IND 235.....................255100
AB246335.1 Hepatitis B virus DNA, complete genome, clone: Aa_IND 255_________............24457
AB246336.1 Hepatitis B virus DNA, complete genome, clone: Aa_SAF 235.....................255100
AB246336.1 Hepatitis B virus DNA, complete genome, clone: Aa_SAF 255_________............24457
AB246337.1 Hepatitis B virus DNA, complete genome, clone: Ae_US 235.....................255100
AB246337.1 Hepatitis B virus DNA, complete genome, clone: Ae_US 255_________............24457
AB246338.1 Hepatitis B virus DNA, complete genome, clone: Ae_JPN 235.....................255100
AB246338.1 Hepatitis B virus DNA, complete genome, clone: Ae_JPN 255_________............24457
AB246347.1 Hepatitis B virus DNA, complete genome, clone: D_IND60 235.....................255100
AB246347.1 Hepatitis B virus DNA, complete genome, clone: D_IND60 255_________............24457
AB246348.1 Hepatitis B virus DNA, complete genome, clone: D_US68 235.....................255100
AB246348.1 Hepatitis B virus DNA, complete genome, clone: D_US68 255_________............24457
AB267090.1 Hepatitis B virus ayw/Japan/Ehime 22-HS/2005 DNA, complete genome 235.....................255100
AB267090.1 Hepatitis B virus ayw/Japan/Ehime 22-HS/2005 DNA, complete genome 255_________............24457
EF208113.1 Hepatitis B virus clone B-S3, complete genome 235.....................255100
EF208113.1 Hepatitis B virus clone B-S3, complete genome 255_________............24457
EF208114.1 Hepatitis B virus clone B-S7, complete genome 235.....................255100
EF208114.1 Hepatitis B virus clone B-S7, complete genome 255_________............24457
EF208115.1 Hepatitis B virus clone B-S8, complete genome 235.....................255100
EF208115.1 Hepatitis B virus clone B-S8, complete genome 255_________............24457
AB270547.1 Hepatitis B virus DNA, complete genome, isolate: MGL295F 235.....................255100
AB270547.1 Hepatitis B virus DNA, complete genome, isolate: MGL295F 255_________............24457
AB270549.1 Hepatitis B virus DNA, complete genome, isolate: MGL79F 235.....................255100
AB270549.1 Hepatitis B virus DNA, complete genome, isolate: MGL79F 255_________............24457
AB270534.1 Hepatitis B virus DNA, complete genome, isolate: MGL110F 235.....................255100
AB270534.1 Hepatitis B virus DNA, complete genome, isolate: MGL110F 255_________............24457
AB270535.1 Hepatitis B virus DNA, complete genome, isolate: MGL50F 235.....................255100
AB270535.1 Hepatitis B virus DNA, complete genome, isolate: MGL50F 255_________............24457
AB270536.1 Hepatitis B virus DNA, complete genome, isolate: MGL226F 234.....................254100
AB270536.1 Hepatitis B virus DNA, complete genome, isolate: MGL226F 254_________............24357
AB270537.1 Hepatitis B virus DNA, complete genome, isolate: MGL22F 235.....................255100
AB270537.1 Hepatitis B virus DNA, complete genome, isolate: MGL22F 255_________............24457
AB270538.1 Hepatitis B virus DNA, complete genome, isolate: MGL231F 235.....................255100
AB270538.1 Hepatitis B virus DNA, complete genome, isolate: MGL231F 255_________............24457
AB270539.1 Hepatitis B virus DNA, complete genome, isolate: MGL200F 235.....................255100
AB270539.1 Hepatitis B virus DNA, complete genome, isolate: MGL200F 255_________............24457
AB270540.1 Hepatitis B virus DNA, complete genome, isolate: MGL241F 214.....................234100
AB270540.1 Hepatitis B virus DNA, complete genome, isolate: MGL241F 234_________............22357
AB270541.1 Hepatitis B virus DNA, complete genome, isolate: MGL47F 235.....................255100
AB270541.1 Hepatitis B virus DNA, complete genome, isolate: MGL47F 255_________............24457
AB270542.1 Hepatitis B virus DNA, complete genome, isolate: MGL12F 235.....................255100
AB270542.1 Hepatitis B virus DNA, complete genome, isolate: MGL12F 255_________............24457
AB270543.1 Hepatitis B virus DNA, complete genome, isolate: MGL209F 235.....................255100
AB270543.1 Hepatitis B virus DNA, complete genome, isolate: MGL209F 255_________............24457
AB270544.1 Hepatitis B virus DNA, complete genome, isolate: MGL215F 235.....................255100
AB270544.1 Hepatitis B virus DNA, complete genome, isolate: MGL215F 255_________............24457
AB270545.1 Hepatitis B virus DNA, complete genome, isolate: MGL108F 235.....................255100
AB270545.1 Hepatitis B virus DNA, complete genome, isolate: MGL108F 255_________............24457
AB270546.1 Hepatitis B virus DNA, complete genome, isolate: MGL88F 235.....................255100
AB270546.1 Hepatitis B virus DNA, complete genome, isolate: MGL88F 255_________............24457
EF103275.1 Hepatitis B virus isolate Ran11, complete genome 235.....................255100
EF103275.1 Hepatitis B virus isolate Ran11, complete genome 255_________............24457
EF103276.1 Hepatitis B virus isolate Ran22, complete genome 235.....................255100
EF103276.1 Hepatitis B virus isolate Ran22, complete genome 255_________............24457
EF103277.1 Hepatitis B virus isolate Ran33, complete genome 235.....................255100
EF103277.1 Hepatitis B virus isolate Ran33, complete genome 255_________............24457
EF103278.1 Hepatitis B virus isolate Ran60, complete genome 235.....................255100
EF103278.1 Hepatitis B virus isolate Ran60, complete genome 255_________............24457
EF103279.1 Hepatitis B virus isolate Ran99, complete genome 235.....................255100
EF103279.1 Hepatitis B virus isolate Ran99, complete genome 255_________............24457
EF103280.1 Hepatitis B virus isolate Ran100, complete genome 235.....................255100
EF103280.1 Hepatitis B virus isolate Ran100, complete genome 255_________............24457
EF103281.1 Hepatitis B virus isolate Ran102, complete genome 235.....................255100
EF103281.1 Hepatitis B virus isolate Ran102, complete genome 255_________............24457
EF103282.1 Hepatitis B virus isolate Ran103, complete genome 235.....................255100
EF103282.1 Hepatitis B virus isolate Ran103, complete genome 255_________............24457
EF103284.1 Hepatitis B virus isolate Ran113, complete genome 235.....................255100
EF103284.1 Hepatitis B virus isolate Ran113, complete genome 255_________............24457
EF103285.1 Hepatitis B virus isolate Ran128, complete genome 235.....................255100
EF103285.1 Hepatitis B virus isolate Ran128, complete genome 255_________............24457
AB274969.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB320 235.....................255100
AB274969.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB320 255_________............24457
AB274970.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB291 235.....................255100
AB274970.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB291 255_________............24457
AB274971.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB295 235.....................255100
AB274971.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB295 255_________............24457
AB274972.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB250 180.....................200100
AB274972.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB250 200_________............18957
AB274973.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB18 229.....................249100
AB274973.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB18 249_________............23857
AB274974.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB60 235.....................255100
AB274974.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB60 255_________............24457
AB274975.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB241 235.....................255100
AB274975.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB241 255_________............24457
AB274976.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB382 235.....................255100
AB274976.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB382 255_________............24457
AB274977.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB183 235.....................255100
AB274977.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB183 255_________............24457
AB274978.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB261 235.....................255100
AB274978.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB261 255_________............24457
AB274979.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB302 235.....................255100
AB274979.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB302 255_________............24457
AB274980.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB90 235.....................255100
AB274980.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB90 255_________............24457
AB274981.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB331 235.....................255100
AB274981.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB331 255_________............24457
AB274982.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB130 235.....................255100
AB274982.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB130 255_________............24457
AB274983.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB85 235.....................255100
AB274983.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB85 255_________............24457
AB274984.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB109 235.....................255100
AB274984.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB109 255_________............24457
AB274985.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB145 229.....................249100
AB274985.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB145 249_________............23857
AM295795.1 Hepatitis B virus complete genome, clone LB1Clone5 235.....................255100
AM295795.1 Hepatitis B virus complete genome, clone LB1Clone5 255_________............24457
AM295796.1 Hepatitis B virus complete genome, clone LB1Clone10 235.....................255100
AM295796.1 Hepatitis B virus complete genome, clone LB1Clone10 255_________............24457
AM295797.1 Hepatitis B virus complete genome, clone LB2Clone6 235.....................255100
AM295797.1 Hepatitis B virus complete genome, clone LB2Clone6 255_________............24457
AM295798.1 Hepatitis B virus complete genome, clone LB3Clone1 235.....................255100
AM295798.1 Hepatitis B virus complete genome, clone LB3Clone1 255_________............24457
AM295799.1 Hepatitis B virus complete genome, clone LB3Clone5 235.....................255100
AM295799.1 Hepatitis B virus complete genome, clone LB3Clone5 255_________............24457
AM295800.2 Hepatitis B virus complete genome, clone LB3Clone11 235.....................255100
AM295800.2 Hepatitis B virus complete genome, clone LB3Clone11 255_________............24457
EF137802.1 Hepatitis B virus strain JH4-1896-G, complete genome 235.....................255100
EF137802.1 Hepatitis B virus strain JH4-1896-G, complete genome 255_________............24457
EF137803.1 Hepatitis B virus strain JH4-1896-A, complete genome 235.....................255100
EF137803.1 Hepatitis B virus strain JH4-1896-A, complete genome 255_________............24457
AM422939.1 Hepatitis B virus, genotype D, complete genome, isolate X28 235.....................255100
AM422939.1 Hepatitis B virus, genotype D, complete genome, isolate X28 255_________............24457
EF634480.1 Hepatitis B virus clone G6, complete genome 235.....................255100
EF634480.1 Hepatitis B virus clone G6, complete genome 255_________............24457
EF634481.1 Hepatitis B virus clone G1, complete genome 235.....................255100
EF634481.1 Hepatitis B virus clone G1, complete genome 255_________............24457
EF464097.1 Hepatitis B virus isolate 06hac, complete genome 235.....................255100
EF464097.1 Hepatitis B virus isolate 06hac, complete genome 255_________............24457
EF464098.1 Hepatitis B virus isolate 09hgg, complete genome 235.....................255100
EF464098.1 Hepatitis B virus isolate 09hgg, complete genome 255_________............24457
EF464099.1 Hepatitis B virus isolate 05hgg, complete genome 235.....................255100
EF464099.1 Hepatitis B virus isolate 05hgg, complete genome 255_________............24457
EU086721.1 Hepatitis B virus isolate HRO/w4601-2002, complete genome 235.....................255100
EU086721.1 Hepatitis B virus isolate HRO/w4601-2002, complete genome 255_________............24457
EF494378.1 Hepatitis B virus isolate TW1244 genotype C, complete genome 235.....................255100
EF494378.1 Hepatitis B virus isolate TW1244 genotype C, complete genome 255_________............24457
EU054331.1 Hepatitis B virus strain FE-929-MO, complete genome 235.....................255100
EU054331.1 Hepatitis B virus strain FE-929-MO, complete genome 255_________............24457
AB300366.1 Hepatitis B virus DNA, complete genome, isolate: patient8 235.....................255100
AB300366.1 Hepatitis B virus DNA, complete genome, isolate: patient8 255_________............24457
AB300367.1 Hepatitis B virus DNA, complete genome, isolate: patient9 235.....................255100
AB300367.1 Hepatitis B virus DNA, complete genome, isolate: patient9 255_________............24457
EF473976.1 Hepatitis B virus isolate Alr049East, complete genome 235.....................255100
EF473976.1 Hepatitis B virus isolate Alr049East, complete genome 255_________............24457
AB368296.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c235.....................255100
AB368296.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c255_________............24457
EU239217.1 Hepatitis B virus isolate G2451, complete genome 235.....................255100
EU239217.1 Hepatitis B virus isolate G2451, complete genome 255_________............24457
EU239218.1 Hepatitis B virus isolate BD2, complete genome 235.....................255100
EU239218.1 Hepatitis B virus isolate BD2, complete genome 255_________............24457
EU239219.1 Hepatitis B virus isolate PW3, complete genome 235.....................255100
EU239219.1 Hepatitis B virus isolate PW3, complete genome 255_________............24457
EU239221.1 Hepatitis B virus isolate PW1, complete genome 235.....................255100
EU239221.1 Hepatitis B virus isolate PW1, complete genome 255_________............24457
EU239222.1 Hepatitis B virus isolate PW2, complete genome 235.....................255100
EU239222.1 Hepatitis B virus isolate PW2, complete genome 255_________............24457
EU239223.1 Hepatitis B virus isolate PW4, complete genome 235.....................255100
EU239223.1 Hepatitis B virus isolate PW4, complete genome 255_________............24457
EU239224.1 Hepatitis B virus isolate BD1, complete genome 235.....................255100
EU239224.1 Hepatitis B virus isolate BD1, complete genome 255_________............24457
EU239225.1 Hepatitis B virus isolate PW7, complete genome 232.....................252100
EU239225.1 Hepatitis B virus isolate PW7, complete genome 252_________............24157
EU239226.1 Hepatitis B virus isolate PW6, complete genome 235.....................255100
EU239226.1 Hepatitis B virus isolate PW6, complete genome 255_________............24457
AB287314.1 Hepatitis B virus DNA, complete genome, isolate: Alaska433 235.....................255100
AB287314.1 Hepatitis B virus DNA, complete genome, isolate: Alaska433 255_________............24457
AB287315.1 Hepatitis B virus DNA, complete genome, isolate: Alaska419 235.....................255100
AB287315.1 Hepatitis B virus DNA, complete genome, isolate: Alaska419 255_________............24457
AB287316.1 Hepatitis B virus DNA, complete genome, isolate: Alaska427 235.....................255100
AB287316.1 Hepatitis B virus DNA, complete genome, isolate: Alaska427 255_________............24457
AB287317.1 Hepatitis B virus DNA, complete genome, isolate: Alaska416 235.....................255100
AB287317.1 Hepatitis B virus DNA, complete genome, isolate: Alaska416 255_________............24457
AB287318.1 Hepatitis B virus DNA, complete genome, isolate: Alaska2 235.....................255100
AB287318.1 Hepatitis B virus DNA, complete genome, isolate: Alaska2 255_________............24457
AB287320.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-1 235.....................255100
AB287320.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-1 255_________............24457
AB287321.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-2 235.....................255100
AB287321.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-2 255_________............24457
AB287322.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-3 235.....................255100
AB287322.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-3 255_________............24457
AB287324.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-5 235.....................255100
AB287324.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-5 255_________............24457
AB287325.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-6 235.....................255100
AB287325.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-6 255_________............24457
EU155895.1 Hepatitis B virus isolate 5b, complete genome 235.....................255100
EU155895.1 Hepatitis B virus isolate 5b, complete genome 255_________............24457
D00220.2HPBVCG Hepatitis B virus DNA, complete genome, strain: LSH 235.....................255100
D00220.2HPBVCG Hepatitis B virus DNA, complete genome, strain: LSH 255_________............24457
AB330367.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ14H235.....................255100
AB330367.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ14H255_________............24457
AB330368.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ54H235.....................255100
AB330368.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ54H255_________............24457
AB330369.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ5HB235.....................255100
AB330369.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ5HB255_________............24457
AB330370.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ6HB235.....................255100
AB330370.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ6HB255_________............24457
AB330371.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ23H235.....................255100
AB330371.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ23H255_________............24457
AB330372.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ22H235.....................255100
AB330372.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ22H255_________............24457
EU185780.1 Hepatitis B virus isolate H-IDU7 (Rec.Arg-1) D3/A2 recombinant, compl235.....................255100
EU185780.1 Hepatitis B virus isolate H-IDU7 (Rec.Arg-1) D3/A2 recombinant, compl255_________............24457
AM494689.1 Hepatitis B virus complete genome, isolate CAR006 223.....................243100
AM494689.1 Hepatitis B virus complete genome, isolate CAR006 243_________............23257
AM494690.1 Hepatitis B virus complete genome, isolate CAR008 235.....................255100
AM494690.1 Hepatitis B virus complete genome, isolate CAR008 255_________............24457
AM494691.1 Hepatitis B virus complete genome, isolate CAR024 235.....................255100
AM494691.1 Hepatitis B virus complete genome, isolate CAR024 255_________............24457
AM494692.1 Hepatitis B virus complete genome, isolate CAR026 235.....................255100
AM494692.1 Hepatitis B virus complete genome, isolate CAR026 255_________............24457
AM494693.1 Hepatitis B virus complete genome, isolate CAR039 235.....................255100
AM494693.1 Hepatitis B virus complete genome, isolate CAR039 255_________............24457
AM494694.1 Hepatitis B virus complete genome, isolate CAR047 235.....................255100
AM494694.1 Hepatitis B virus complete genome, isolate CAR047 255_________............24457
AM494695.1 Hepatitis B virus complete genome, isolate CAR053 235.....................255100
AM494695.1 Hepatitis B virus complete genome, isolate CAR053 255_________............24457
AM494696.1 Hepatitis B virus complete genome, isolate CAR060 235.....................255100
AM494696.1 Hepatitis B virus complete genome, isolate CAR060 255_________............24457
AM494697.1 Hepatitis B virus complete genome, isolate CAR063 235.....................255100
AM494697.1 Hepatitis B virus complete genome, isolate CAR063 255_________............24457
AM494698.1 Hepatitis B virus complete genome, isolate CAR066 214.....................234100
AM494698.1 Hepatitis B virus complete genome, isolate CAR066 234_________............22357
AM494699.1 Hepatitis B virus complete genome, isolate CAR082 235.....................255100
AM494699.1 Hepatitis B virus complete genome, isolate CAR082 255_________............24457
AM494700.1 Hepatitis B virus complete genome, isolate CAR083 235.....................255100
AM494700.1 Hepatitis B virus complete genome, isolate CAR083 255_________............24457
AM494701.1 Hepatitis B virus complete genome, isolate CAR097 235.....................255100
AM494701.1 Hepatitis B virus complete genome, isolate CAR097 255_________............24457
AM494702.1 Hepatitis B virus complete genome, isolate CAR106 235.....................255100
AM494702.1 Hepatitis B virus complete genome, isolate CAR106 255_________............24457
AM494704.1 Hepatitis B virus complete genome, isolate CAR112 235.....................255100
AM494704.1 Hepatitis B virus complete genome, isolate CAR112 255_________............24457
AM494705.1 Hepatitis B virus complete genome, isolate CAR115 235.....................255100
AM494705.1 Hepatitis B virus complete genome, isolate CAR115 255_________............24457
AM494706.1 Hepatitis B virus complete genome, isolate CAR131 235.....................255100
AM494706.1 Hepatitis B virus complete genome, isolate CAR131 255_________............24457
AM494707.1 Hepatitis B virus complete genome, isolate CAR137 235.....................255100
AM494707.1 Hepatitis B virus complete genome, isolate CAR137 255_________............24457
AM494708.1 Hepatitis B virus complete genome, isolate CAR138 235.....................255100
AM494708.1 Hepatitis B virus complete genome, isolate CAR138 255_________............24457
AM494709.1 Hepatitis B virus complete genome, isolate CAR143 235.....................255100
AM494709.1 Hepatitis B virus complete genome, isolate CAR143 255_________............24457
AM494710.1 Hepatitis B virus complete genome, isolate CAR144 235.....................255100
AM494710.1 Hepatitis B virus complete genome, isolate CAR144 255_________............24457
AM494711.1 Hepatitis B virus complete genome, isolate CAR146 232.....................252100
AM494711.1 Hepatitis B virus complete genome, isolate CAR146 252_________............24157
AM494712.1 Hepatitis B virus complete genome, isolate CAR150 232.....................252100
AM494712.1 Hepatitis B virus complete genome, isolate CAR150 252_________............24157
AM494713.1 Hepatitis B virus complete genome, isolate CAR154 235.....................255100
AM494713.1 Hepatitis B virus complete genome, isolate CAR154 255_________............24457
AM494714.1 Hepatitis B virus complete genome, isolate CAR165 235.....................255100
AM494714.1 Hepatitis B virus complete genome, isolate CAR165 255_________............24457
AM494715.1 Hepatitis B virus complete genome, isolate CAR171 235.....................255100
AM494715.1 Hepatitis B virus complete genome, isolate CAR171 255_________............24457
AM494716.1 Hepatitis B virus complete genome, isolate CAR175 235.....................255100
AM494716.1 Hepatitis B virus complete genome, isolate CAR175 255_________............24457
AM494717.1 Hepatitis B virus complete genome, isolate CAR187 235.....................255100
AM494717.1 Hepatitis B virus complete genome, isolate CAR187 255_________............24457
AM494718.1 Hepatitis B virus complete genome, isolate CAR204 235.....................255100
AM494718.1 Hepatitis B virus complete genome, isolate CAR204 255_________............24457
EU410082.1 Hepatitis B virus isolate ph81, complete genome 235.....................255100
EU410082.1 Hepatitis B virus isolate ph81, complete genome 255_________............24457
AM410963.1 Hepatitis B virus complete genome, clone LB3Clone24 235.....................255100
AM410963.1 Hepatitis B virus complete genome, clone LB3Clone24 255_________............24457
DQ991753.2 Hepatitis B virus isolate Irish-13, complete genome 235.....................255100
DQ991753.2 Hepatitis B virus isolate Irish-13, complete genome 255_________............24457
EU414133.1 Hepatitis B virus strain 28058, complete genome 235.....................255100
EU414133.1 Hepatitis B virus strain 28058, complete genome 255_________............24457
EU414135.1 Hepatitis B virus strain 28025, complete genome 235.....................255100
EU414135.1 Hepatitis B virus strain 28025, complete genome 255_________............24457
EU414136.1 Hepatitis B virus strain 28052, complete genome 235.....................255100
EU414136.1 Hepatitis B virus strain 28052, complete genome 255_________............24457
EU414137.1 Hepatitis B virus strain 28059, complete genome 235.....................255100
EU414137.1 Hepatitis B virus strain 28059, complete genome 255_________............24457
EU414138.1 Hepatitis B virus strain 28129, complete genome 235.....................255100
EU414138.1 Hepatitis B virus strain 28129, complete genome 255_________............24457
EU414139.1 Hepatitis B virus strain 28027, complete genome 235.....................255100
EU414139.1 Hepatitis B virus strain 28027, complete genome 255_________............24457
EU414140.1 Hepatitis B virus strain 28050, complete genome 235.....................255100
EU414140.1 Hepatitis B virus strain 28050, complete genome 255_________............24457
EU414141.1 Hepatitis B virus strain 28051, complete genome 235.....................255100
EU414141.1 Hepatitis B virus strain 28051, complete genome 255_________............24457
EU414142.1 Hepatitis B virus strain 28004, complete genome 235.....................255100
EU414142.1 Hepatitis B virus strain 28004, complete genome 255_________............24457
EU414143.1 Hepatitis B virus strain 28042, complete genome 235.....................255100
EU414143.1 Hepatitis B virus strain 28042, complete genome 255_________............24457
AB375165.1 Hepatitis B virus DNA, complete genome, strain: MEXICO8-G 235.....................255100
AB375165.1 Hepatitis B virus DNA, complete genome, strain: MEXICO8-G 255_________............24457
AB375166.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-G 235.....................255100
AB375166.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-G 255_________............24457
AB375167.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32-G 235.....................255100
AB375167.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32-G 255_________............24457
AB375168.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-G 235.....................255100
AB375168.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-G 255_________............24457
AB375169.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-G 235.....................255100
AB375169.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-G 255_________............24457
AB375170.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-G 235.....................255100
AB375170.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-G 255_________............24457
EU594382.1 Hepatitis B virus strain 3798-91, complete genome 235.....................255100
EU594382.1 Hepatitis B virus strain 3798-91, complete genome 255_________............24457
EU594383.1 Hepatitis B virus strain 2000-00, complete genome 235.....................255100
EU594383.1 Hepatitis B virus strain 2000-00, complete genome 255_________............24457
EU594384.1 Hepatitis B virus strain 1906-99, complete genome 235.....................255100
EU594384.1 Hepatitis B virus strain 1906-99, complete genome 255_________............24457
EU594385.1 Hepatitis B virus strain 1898-98, complete genome 235.....................255100
EU594385.1 Hepatitis B virus strain 1898-98, complete genome 255_________............24457
EU594386.1 Hepatitis B virus strain 644-00, complete genome 235.....................255100
EU594386.1 Hepatitis B virus strain 644-00, complete genome 255_________............24457
EU594387.1 Hepatitis B virus strain 3784-91, complete genome 235.....................255100
EU594387.1 Hepatitis B virus strain 3784-91, complete genome 255_________............24457
EU594388.1 Hepatitis B virus strain 3782-91, complete genome 235.....................255100
EU594388.1 Hepatitis B virus strain 3782-91, complete genome 255_________............24457
EU594389.1 Hepatitis B virus strain 4435-97, complete genome 235.....................255100
EU594389.1 Hepatitis B virus strain 4435-97, complete genome 255_________............24457
EU594390.1 Hepatitis B virus strain 4625-97, complete genome 235.....................255100
EU594390.1 Hepatitis B virus strain 4625-97, complete genome 255_________............24457
EU594391.1 Hepatitis B virus strain 4620-97, complete genome 235.....................255100
EU594391.1 Hepatitis B virus strain 4620-97, complete genome 255_________............24457
EU594392.1 Hepatitis B virus strain 4600-97, complete genome 235.....................255100
EU594392.1 Hepatitis B virus strain 4600-97, complete genome 255_________............24457
EU594393.1 Hepatitis B virus strain 4590-97, complete genome 235.....................255100
EU594393.1 Hepatitis B virus strain 4590-97, complete genome 255_________............24457
EU594394.1 Hepatitis B virus strain 4512-97, complete genome 235.....................255100
EU594394.1 Hepatitis B virus strain 4512-97, complete genome 255_________............24457
EU594395.1 Hepatitis B virus strain 4509-97, complete genome 235.....................255100
EU594395.1 Hepatitis B virus strain 4509-97, complete genome 255_________............24457
EU594396.1 Hepatitis B virus strain 4383-97, complete genome 235.....................255100
EU594396.1 Hepatitis B virus strain 4383-97, complete genome 255_________............24457
EU594397.1 Hepatitis B virus strain 4398-97, complete genome 235.....................255100
EU594397.1 Hepatitis B virus strain 4398-97, complete genome 255_________............24457
EU594398.1 Hepatitis B virus strain 4496-97, complete genome 235.....................255100
EU594398.1 Hepatitis B virus strain 4496-97, complete genome 255_________............24457
EU594399.1 Hepatitis B virus strain 4484-97, complete genome 235.....................255100
EU594399.1 Hepatitis B virus strain 4484-97, complete genome 255_________............24457
EU594400.1 Hepatitis B virus strain 2009-02, complete genome 235.....................255100
EU594400.1 Hepatitis B virus strain 2009-02, complete genome 255_________............24457
EU594401.1 Hepatitis B virus strain 1989-97, complete genome 235.....................255100
EU594401.1 Hepatitis B virus strain 1989-97, complete genome 255_________............24457
EU594402.1 Hepatitis B virus strain 1988-02, complete genome 235.....................255100
EU594402.1 Hepatitis B virus strain 1988-02, complete genome 255_________............24457
EU594403.1 Hepatitis B virus strain 1904-99, complete genome 235.....................255100
EU594403.1 Hepatitis B virus strain 1904-99, complete genome 255_________............24457
EU594405.1 Hepatitis B virus strain 620-98, complete genome 235.....................255100
EU594405.1 Hepatitis B virus strain 620-98, complete genome 255_________............24457
EU594406.1 Hepatitis B virus strain 321-96, complete genome 235.....................255100
EU594406.1 Hepatitis B virus strain 321-96, complete genome 255_________............24457
EU594407.1 Hepatitis B virus strain 295-01, complete genome 235.....................255100
EU594407.1 Hepatitis B virus strain 295-01, complete genome 255_________............24457
EU594408.1 Hepatitis B virus strain 281-01, complete genome 235.....................255100
EU594408.1 Hepatitis B virus strain 281-01, complete genome 255_________............24457
EU594409.1 Hepatitis B virus strain 280-01, complete genome 235.....................255100
EU594409.1 Hepatitis B virus strain 280-01, complete genome 255_________............24457
EU594410.1 Hepatitis B virus strain 279-01, complete genome 235.....................255100
EU594410.1 Hepatitis B virus strain 279-01, complete genome 255_________............24457
EU594415.1 Hepatitis B virus strain 4374-97, complete genome 235.....................255100
EU594415.1 Hepatitis B virus strain 4374-97, complete genome 255_________............24457
EU594416.1 Hepatitis B virus strain 4373-97, complete genome 235.....................255100
EU594416.1 Hepatitis B virus strain 4373-97, complete genome 255_________............24457
EU594421.1 Hepatitis B virus strain 4658-97, complete genome 235.....................255100
EU594421.1 Hepatitis B virus strain 4658-97, complete genome 255_________............24457
EU594422.1 Hepatitis B virus strain 4655-97, complete genome 235.....................255100
EU594422.1 Hepatitis B virus strain 4655-97, complete genome 255_________............24457
EU594423.1 Hepatitis B virus strain 4652-97, complete genome 235.....................255100
EU594423.1 Hepatitis B virus strain 4652-97, complete genome 255_________............24457
EU594424.1 Hepatitis B virus strain 4651-97, complete genome 235.....................255100
EU594424.1 Hepatitis B virus strain 4651-97, complete genome 255_________............24457
EU594425.1 Hepatitis B virus strain 4635-97, complete genome 235.....................255100
EU594425.1 Hepatitis B virus strain 4635-97, complete genome 255_________............24457
EU594426.1 Hepatitis B virus strain 4630-97, complete genome 235.....................255100
EU594426.1 Hepatitis B virus strain 4630-97, complete genome 255_________............24457
EU594427.1 Hepatitis B virus strain 4628-97, complete genome 235.....................255100
EU594427.1 Hepatitis B virus strain 4628-97, complete genome 255_________............24457
EU594428.1 Hepatitis B virus strain 4385-97, complete genome 235.....................255100
EU594428.1 Hepatitis B virus strain 4385-97, complete genome 255_________............24457
EU594430.1 Hepatitis B virus strain 4565-97, complete genome 235.....................255100
EU594430.1 Hepatitis B virus strain 4565-97, complete genome 255_________............24457
EU594431.1 Hepatitis B virus strain 4547-97, complete genome 235.....................255100
EU594431.1 Hepatitis B virus strain 4547-97, complete genome 255_________............24457
EU594432.1 Hepatitis B virus strain 4545-97, complete genome 235.....................255100
EU594432.1 Hepatitis B virus strain 4545-97, complete genome 255_________............24457
EU594433.1 Hepatitis B virus strain 4605-97, complete genome 235.....................255100
EU594433.1 Hepatitis B virus strain 4605-97, complete genome 255_________............24457
EU594434.1 Hepatitis B virus strain 683-95, complete genome 235.....................255100
EU594434.1 Hepatitis B virus strain 683-95, complete genome 255_________............24457
EU594435.1 Hepatitis B virus strain 320-95, complete genome 235.....................255100
EU594435.1 Hepatitis B virus strain 320-95, complete genome 255_________............24457
EU594436.1 Hepatitis B virus strain 4550-97, complete genome 235.....................255100
EU594436.1 Hepatitis B virus strain 4550-97, complete genome 255_________............24457
EU787434.1 Hepatitis B virus isolate 92, complete genome 235.....................255100
EU787434.1 Hepatitis B virus isolate 92, complete genome 255_________............24457
EU787435.1 Hepatitis B virus isolate 114, complete genome 235.....................255100
EU787435.1 Hepatitis B virus isolate 114, complete genome 255_________............24457
EU787436.1 Hepatitis B virus isolate 165, complete genome 235.....................255100
EU787436.1 Hepatitis B virus isolate 165, complete genome 255_________............24457
EU787437.1 Hepatitis B virus isolate 17, complete genome 235.....................255100
EU787437.1 Hepatitis B virus isolate 17, complete genome 255_________............24457
EU787438.1 Hepatitis B virus isolate 7, complete genome 235.....................255100
EU787438.1 Hepatitis B virus isolate 7, complete genome 255_________............24457
EU787439.1 Hepatitis B virus isolate 89, complete genome 235.....................255100
EU787439.1 Hepatitis B virus isolate 89, complete genome 255_________............24457
EU787440.1 Hepatitis B virus isolate W17, complete genome 235.....................255100
EU787440.1 Hepatitis B virus isolate W17, complete genome 255_________............24457
EU787441.1 Hepatitis B virus isolate W32, complete genome 235.....................255100
EU787441.1 Hepatitis B virus isolate W32, complete genome 255_________............24457
EU787442.1 Hepatitis B virus isolate W37, complete genome 235.....................255100
EU787442.1 Hepatitis B virus isolate W37, complete genome 255_________............24457
EU787443.1 Hepatitis B virus isolate w40, complete genome 235.....................255100
EU787443.1 Hepatitis B virus isolate w40, complete genome 255_________............24457
EU787445.1 Hepatitis B virus isolate W51, complete genome 235.....................255100
EU787445.1 Hepatitis B virus isolate W51, complete genome 255_________............24457
EU787446.1 Hepatitis B virus isolate W75, complete genome 235.....................255100
EU787446.1 Hepatitis B virus isolate W75, complete genome 255_________............24457
EU787447.1 Hepatitis B virus isolate W46, complete genome 235.....................255100
EU787447.1 Hepatitis B virus isolate W46, complete genome 255_________............24457
AB453979.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH1 235.....................255100
AB453979.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH1 255_________............24457
AB453980.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH2 235.....................255100
AB453980.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH2 255_________............24457
AB453981.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH3 235.....................255100
AB453981.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH3 255_________............24457
AB453982.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH4 235.....................255100
AB453982.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH4 255_________............24457
AB453984.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH6 235.....................255100
AB453984.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH6 255_________............24457
AB453985.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH7 235.....................255100
AB453985.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH7 255_________............24457
AB453986.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH8 235.....................255100
AB453986.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH8 255_________............24457
AB453987.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH9 235.....................255100
AB453987.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH9 255_________............24457
AB453988.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH10 235.....................255100
AB453988.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH10 255_________............24457
AB453989.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH11 235.....................255100
AB453989.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH11 255_________............24457
AB453983.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH5 235.....................255100
AB453983.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH5 255_________............24457
EU921418.1 Hepatitis B virus isolate 22.165.07, complete genome 235.....................255100
EU921418.1 Hepatitis B virus isolate 22.165.07, complete genome 255_________............24457
EU921419.1 Hepatitis B virus isolate 22.252.07, complete genome 235.....................255100
EU921419.1 Hepatitis B virus isolate 22.252.07, complete genome 255_________............24457
EU919197.1 Hepatitis B virus isolate XJU, complete genome 235.....................255100
EU919197.1 Hepatitis B virus isolate XJU, complete genome 255_________............24457
EU939680.1 Hepatitis B virus isolate C186, complete genome 235.....................255100
EU939680.1 Hepatitis B virus isolate C186, complete genome 255_________............24457
EU939681.1 Hepatitis B virus isolate D146, complete genome 235.....................255100
EU939681.1 Hepatitis B virus isolate D146, complete genome 255_________............24457
EU366129.2 Hepatitis B virus isolate BA92, complete genome 235.....................255100
EU366129.2 Hepatitis B virus isolate BA92, complete genome 255_________............24457
AB367430.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 39/Adefovir223.....................243100
AB367430.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 39/Adefovir243_________............23257
FJ023659.1 Hepatitis B virus isolate I1_M04-0469, complete genome 235.....................255100
FJ023659.1 Hepatitis B virus isolate I1_M04-0469, complete genome 255_________............24457
FJ023660.1 Hepatitis B virus isolate I1_M04-3692, complete genome 235.....................255100
FJ023660.1 Hepatitis B virus isolate I1_M04-3692, complete genome 255_________............24457
FJ023661.1 Hepatitis B virus isolate I1_M05-0592, complete genome 235.....................255100
FJ023661.1 Hepatitis B virus isolate I1_M05-0592, complete genome 255_________............24457
FJ023663.1 Hepatitis B virus isolate I1_M04-3979, complete genome 235.....................255100
FJ023663.1 Hepatitis B virus isolate I1_M04-3979, complete genome 255_________............24457
FJ023664.1 Hepatitis B virus isolate I2_M04-0026, complete genome 235.....................255100
FJ023664.1 Hepatitis B virus isolate I2_M04-0026, complete genome 255_________............24457
FJ023665.1 Hepatitis B virus isolate I2_M04-0033, complete genome 235.....................255100
FJ023665.1 Hepatitis B virus isolate I2_M04-0033, complete genome 255_________............24457
FJ023666.1 Hepatitis B virus isolate I2_M04-1907, complete genome 235.....................255100
FJ023666.1 Hepatitis B virus isolate I2_M04-1907, complete genome 255_________............24457
FJ023667.1 Hepatitis B virus isolate I2_M04-2742, complete genome 235.....................255100
FJ023667.1 Hepatitis B virus isolate I2_M04-2742, complete genome 255_________............24457
FJ023669.1 Hepatitis B virus isolate I2_M04-3665, complete genome 235.....................255100
FJ023669.1 Hepatitis B virus isolate I2_M04-3665, complete genome 255_________............24457
FJ023670.1 Hepatitis B virus isolate I2_M04-3724, complete genome 235.....................255100
FJ023670.1 Hepatitis B virus isolate I2_M04-3724, complete genome 255_________............24457
FJ023672.1 Hepatitis B virus isolate I2_M04-2305, complete genome 235.....................255100
FJ023672.1 Hepatitis B virus isolate I2_M04-2305, complete genome 255_________............24457
FJ023673.1 Hepatitis B virus isolate I2_M04-4997, complete genome 235.....................255100
FJ023673.1 Hepatitis B virus isolate I2_M04-4997, complete genome 255_________............24457
FJ023674.1 Hepatitis B virus isolate I2/C2_C04-0790 S protein (S) and core prote235.....................255100
FJ023674.1 Hepatitis B virus isolate I2/C2_C04-0790 S protein (S) and core prote255_________............24457
FJ023675.1 Hepatitis B virus isolate I1/I2_M04-3739 S protein (S) and core prote235.....................255100
FJ023675.1 Hepatitis B virus isolate I1/I2_M04-3739 S protein (S) and core prote255_________............24457
FJ023676.1 Hepatitis B virus isolate I1/I2_M04-2531 S protein (S) and core prote235.....................255100
FJ023676.1 Hepatitis B virus isolate I1/I2_M04-2531 S protein (S) and core prote255_________............24457
FJ023650.1 Hepatitis B virus isolate C2_M04-0341 S protein (S) and core protein 235.....................255100
FJ023650.1 Hepatitis B virus isolate C2_M04-0341 S protein (S) and core protein 255_________............24457
FJ386590.1 Hepatitis B virus isolate 1841, complete genome 235.....................255100
FJ386590.1 Hepatitis B virus isolate 1841, complete genome 255_________............24457
FM199974.1 Hepatitis B virus complete genome, strain 45021 235.....................255100
FM199974.1 Hepatitis B virus complete genome, strain 45021 255_________............24457
FM199977.1 Hepatitis B virus complete genome, strain 45088 235.....................255100
FM199977.1 Hepatitis B virus complete genome, strain 45088 255_________............24457
FM199978.1 Hepatitis B virus complete genome, strain 49136 235.....................255100
FM199978.1 Hepatitis B virus complete genome, strain 49136 255_________............24457
FM199979.1 Hepatitis B virus complete genome, strain 49224 235.....................255100
FM199979.1 Hepatitis B virus complete genome, strain 49224 255_________............24457
FM199980.1 Hepatitis B virus complete genome, strain 49244 235.....................255100
FM199980.1 Hepatitis B virus complete genome, strain 49244 255_________............24457
FM199981.1 Hepatitis B virus complete genome, strain 49263 235.....................255100
FM199981.1 Hepatitis B virus complete genome, strain 49263 255_________............24457
AB493845.1 Hepatitis B virus DNA, complete genome, isolate: 07UC 215.....................235100
AB493845.1 Hepatitis B virus DNA, complete genome, isolate: 07UC 235_________............22457
AB493846.1 Hepatitis B virus DNA, complete genome, isolate: 17UC 235.....................255100
AB493846.1 Hepatitis B virus DNA, complete genome, isolate: 17UC 255_________............24457
AB493848.1 Hepatitis B virus DNA, complete genome, isolate: P7 214.....................234100
AB493848.1 Hepatitis B virus DNA, complete genome, isolate: P7 234_________............22357
FJ349296.1 Hepatitis B virus strain 29-OYE-10, complete genome 235.....................255100
FJ349296.1 Hepatitis B virus strain 29-OYE-10, complete genome 255_________............24457
GQ167301.1 Hepatitis B virus isolate ZADGM452, complete genome 235.....................255100
GQ167301.1 Hepatitis B virus isolate ZADGM452, complete genome 255_________............24457
GQ167302.1 Hepatitis B virus isolate ZADGM4521, complete genome 235.....................255100
GQ167302.1 Hepatitis B virus isolate ZADGM4521, complete genome 255_________............24457
AB362931.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon235.....................255100
AB362931.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon255_________............24457
AP011090.1 Hepatitis B virus DNA, complete genome, strain: B0714189(WBK)F 235.....................255100
AP011090.1 Hepatitis B virus DNA, complete genome, strain: B0714189(WBK)F 255_________............24457
AP011091.1 Hepatitis B virus DNA, complete genome, strain: B0714202(BMA)F 235.....................255100
AP011091.1 Hepatitis B virus DNA, complete genome, strain: B0714202(BMA)F 255_________............24457
GQ184322.1 Hepatitis B virus isolate ZADGM4522, complete genome 235.....................255100
GQ184322.1 Hepatitis B virus isolate ZADGM4522, complete genome 255_________............24457
GQ184323.1 Hepatitis B virus isolate ZADGM1121, complete genome 235.....................255100
GQ184323.1 Hepatitis B virus isolate ZADGM1121, complete genome 255_________............24457
GQ184324.1 Hepatitis B virus isolate ZADGM1122, complete genome 235.....................255100
GQ184324.1 Hepatitis B virus isolate ZADGM1122, complete genome 255_________............24457
FJ899792.1 Hepatitis B virus isolate D146-1, complete genome 235.....................255100
FJ899792.1 Hepatitis B virus isolate D146-1, complete genome 255_________............24457
GQ414522.1 Hepatitis B virus strain GTA_CT, complete genome 2083.....................2103100
GQ414522.1 Hepatitis B virus strain GTA_CT, complete genome 2103_________............209257
GQ377532.1 Hepatitis B virus isolate J37, complete genome 235.....................255100
GQ377532.1 Hepatitis B virus isolate J37, complete genome 255_________............24457
GQ377589.1 Hepatitis B virus isolate J145, complete genome 235.....................255100
GQ377589.1 Hepatitis B virus isolate J145, complete genome 255_________............24457
GQ377627.1 Hepatitis B virus isolate J231, complete genome 235.....................255100
GQ377627.1 Hepatitis B virus isolate J231, complete genome 255_________............24457
GQ475313.1 Hepatitis B virus isolate KOR9CHB, complete genome 235.....................255100
GQ475313.1 Hepatitis B virus isolate KOR9CHB, complete genome 255_________............24457
GQ475315.1 Hepatitis B virus isolate KOR11CHB, complete genome 235.....................255100
GQ475315.1 Hepatitis B virus isolate KOR11CHB, complete genome 255_________............24457
GQ475344.1 Hepatitis B virus isolate KOR40HCC, complete genome 235.....................255100
GQ475344.1 Hepatitis B virus isolate KOR40HCC, complete genome 255_________............24457
FJ798095.1 Hepatitis B virus isolate ggcam19, complete genome 235.....................255100
FJ798095.1 Hepatitis B virus isolate ggcam19, complete genome 255_________............24457
FJ798096.1 Hepatitis B virus isolate ggcam7, complete genome 235.....................255100
FJ798096.1 Hepatitis B virus isolate ggcam7, complete genome 255_________............24457
FJ798097.1 Hepatitis B virus isolate ggcam22, complete genome 235.....................255100
FJ798097.1 Hepatitis B virus isolate ggcam22, complete genome 255_________............24457
FJ798098.1 Hepatitis B virus isolate cpzcam17, complete genome 235.....................255100
FJ798098.1 Hepatitis B virus isolate cpzcam17, complete genome 255_________............24457
FJ798099.1 Hepatitis B virus isolate cpzcam6, complete genome 235.....................255100
FJ798099.1 Hepatitis B virus isolate cpzcam6, complete genome 255_________............24457
AB471856.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C1 235.....................255100
AB471856.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C1 255_________............24457
AB471857.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C2 235.....................255100
AB471857.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C2 255_________............24457
AF043560.2 Hepatitis B virus isolate BA2, complete genome 235.....................255100
AF043560.2 Hepatitis B virus isolate BA2, complete genome 255_________............24457
AF043580.2 Hepatitis B virus isolate BA3, complete genome 235.....................255100
AF043580.2 Hepatitis B virus isolate BA3, complete genome 255_________............24457
FN594748.1 Hepatitis B virus complete genome, isolate bne6 235.....................255100
FN594748.1 Hepatitis B virus complete genome, isolate bne6 255_________............24457
FN594749.1 Hepatitis B virus complete genome, isolate bne8 235.....................255100
FN594749.1 Hepatitis B virus complete genome, isolate bne8 255_________............24457
FN594750.1 Hepatitis B virus complete genome, isolate bne12 235.....................255100
FN594750.1 Hepatitis B virus complete genome, isolate bne12 255_________............24457
FN594751.1 Hepatitis B virus complete genome, isolate bne52H 235.....................255100
FN594751.1 Hepatitis B virus complete genome, isolate bne52H 255_________............24457
FN594752.1 Hepatitis B virus complete genome, isolate bne134 235.....................255100
FN594752.1 Hepatitis B virus complete genome, isolate bne134 255_________............24457
FN594753.1 Hepatitis B virus complete genome, isolate bne137 220.....................240100
FN594753.1 Hepatitis B virus complete genome, isolate bne137 240_________............22957
FN594754.1 Hepatitis B virus complete genome, isolate bne200 235.....................255100
FN594754.1 Hepatitis B virus complete genome, isolate bne200 255_________............24457
FN594755.1 Hepatitis B virus complete genome, isolate bne241 235.....................255100
FN594755.1 Hepatitis B virus complete genome, isolate bne241 255_________............24457
FN594756.1 Hepatitis B virus complete genome, isolate bne250 235.....................255100
FN594756.1 Hepatitis B virus complete genome, isolate bne250 255_________............24457
FN594757.1 Hepatitis B virus complete genome, isolate bne305 220.....................240100
FN594757.1 Hepatitis B virus complete genome, isolate bne305 240_________............22957
FN594758.1 Hepatitis B virus complete genome, isolate bne341 235.....................255100
FN594758.1 Hepatitis B virus complete genome, isolate bne341 255_________............24457
FN594759.1 Hepatitis B virus complete genome, isolate bne342 235.....................255100
FN594759.1 Hepatitis B virus complete genome, isolate bne342 255_________............24457
FN594760.1 Hepatitis B virus complete genome, isolate bne362 235.....................255100
FN594760.1 Hepatitis B virus complete genome, isolate bne362 255_________............24457
FN594761.1 Hepatitis B virus complete genome, isolate bne385 235.....................255100
FN594761.1 Hepatitis B virus complete genome, isolate bne385 255_________............24457
FN594762.1 Hepatitis B virus complete genome, isolate bne439 235.....................255100
FN594762.1 Hepatitis B virus complete genome, isolate bne439 255_________............24457
FN594763.1 Hepatitis B virus complete genome, isolate bne446 235.....................255100
FN594763.1 Hepatitis B virus complete genome, isolate bne446 255_________............24457
FN594764.1 Hepatitis B virus complete genome, isolate bne9439 235.....................255100
FN594764.1 Hepatitis B virus complete genome, isolate bne9439 255_________............24457
FN594765.1 Hepatitis B virus complete genome, isolate bne9447 235.....................255100
FN594765.1 Hepatitis B virus complete genome, isolate bne9447 255_________............24457
FN594766.1 Hepatitis B virus complete genome, isolate bne9449 235.....................255100
FN594766.1 Hepatitis B virus complete genome, isolate bne9449 255_________............24457
FN594767.1 Hepatitis B virus complete genome, isolate bne127 235.....................255100
FN594767.1 Hepatitis B virus complete genome, isolate bne127 255_________............24457
FN594768.1 Hepatitis B virus complete genome, isolate bne272 235.....................255100
FN594768.1 Hepatitis B virus complete genome, isolate bne272 255_________............24457
FN594769.1 Hepatitis B virus complete genome, isolate bne281 235.....................255100
FN594769.1 Hepatitis B virus complete genome, isolate bne281 255_________............24457
FN594770.1 Hepatitis B virus complete genome, isolate bne367 235.....................255100
FN594770.1 Hepatitis B virus complete genome, isolate bne367 255_________............24457
FN594771.1 Hepatitis B virus complete genome, isolate bne442 235.....................255100
FN594771.1 Hepatitis B virus complete genome, isolate bne442 255_________............24457
GU357844.1 Hepatitis B virus isolate W29, complete genome 235.....................255100
GU357844.1 Hepatitis B virus isolate W29, complete genome 255_________............24457
GU357846.1 Hepatitis B virus isolate Y10, complete genome 235.....................255100
GU357846.1 Hepatitis B virus isolate Y10, complete genome 255_________............24457
GU565217.1 Hepatitis B virus strain CLB-DonX, complete genome 235.....................255100
GU565217.1 Hepatitis B virus strain CLB-DonX, complete genome 255_________............24457
AB549213.1 Hepatitis B virus DNA, complete genome, clone: G-C-F 235.....................255100
AB549213.1 Hepatitis B virus DNA, complete genome, clone: G-C-F 255_________............24457
FN545821.1 Hepatitis B virus complete genome, strain 29122 235.....................255100
FN545821.1 Hepatitis B virus complete genome, strain 29122 255_________............24457
FN545822.1 Hepatitis B virus complete genome, strain 29134 235.....................255100
FN545822.1 Hepatitis B virus complete genome, strain 29134 255_________............24457
FN545823.1 Hepatitis B virus complete genome, strain 29135 235.....................255100
FN545823.1 Hepatitis B virus complete genome, strain 29135 255_________............24457
FN545824.1 Hepatitis B virus complete genome, strain 29136 181.....................201100
FN545824.1 Hepatitis B virus complete genome, strain 29136 201_________............19057
FN545825.1 Hepatitis B virus complete genome, strain 29137 235.....................255100
FN545825.1 Hepatitis B virus complete genome, strain 29137 255_________............24457
FN545826.1 Hepatitis B virus complete genome, strain 34010 235.....................255100
FN545826.1 Hepatitis B virus complete genome, strain 34010 255_________............24457
FN545827.1 Hepatitis B virus complete genome, strain 34011 223.....................243100
FN545827.1 Hepatitis B virus complete genome, strain 34011 243_________............23257
FN545831.1 Hepatitis B virus complete genome, strain 42002 235.....................255100
FN545831.1 Hepatitis B virus complete genome, strain 42002 255_________............24457
FN545836.1 Hepatitis B virus complete genome, strain 42128 235.....................255100
FN545836.1 Hepatitis B virus complete genome, strain 42128 255_________............24457
FN545841.1 Hepatitis B virus complete genome, strain 42349 235.....................255100
FN545841.1 Hepatitis B virus complete genome, strain 42349 255_________............24457
FN545842.1 Hepatitis B virus complete genome, strain 42366 235.....................255100
FN545842.1 Hepatitis B virus complete genome, strain 42366 255_________............24457
AB555496.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA31 235.....................255100
AB555496.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA31 255_________............24457
AB555497.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA37 235.....................255100
AB555497.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA37 255_________............24457
AB555500.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA64 235.....................255100
AB555500.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA64 255_________............24457
AB555501.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA65 235.....................255100
AB555501.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA65 255_________............24457
AB540584.1 HBV genotype C DNA, complete genome, strain: C0901190(NT16) 235.....................255100
AB540584.1 HBV genotype C DNA, complete genome, strain: C0901190(NT16) 255_________............24457
AB480036.2 Hepatitis B virus DNA, complete genome, strain: 06-17 235.....................255100
AB480036.2 Hepatitis B virus DNA, complete genome, strain: 06-17 255_________............24457
AB480038.2 Hepatitis B virus DNA, complete genome, strain: 06-23 235.....................255100
AB480038.2 Hepatitis B virus DNA, complete genome, strain: 06-23 255_________............24457
AB480039.2 Hepatitis B virus DNA, complete genome, strain: 06-27 235.....................255100
AB480039.2 Hepatitis B virus DNA, complete genome, strain: 06-27 255_________............24457
AB480040.2 Hepatitis B virus DNA, complete genome, strain: 06-44 235.....................255100
AB480040.2 Hepatitis B virus DNA, complete genome, strain: 06-44 255_________............24457
AB480041.2 Hepatitis B virus DNA, complete genome, strain: 06-51 235.....................255100
AB480041.2 Hepatitis B virus DNA, complete genome, strain: 06-51 255_________............24457
FR714490.1 Hepatitis B virus complete genome, isolate DL706, X/C recombinant 235.....................255100
FR714490.1 Hepatitis B virus complete genome, isolate DL706, X/C recombinant 255_________............24457
FR714491.1 Hepatitis B virus complete genome, isolate GM012, X/C recombinant 235.....................255100
FR714491.1 Hepatitis B virus complete genome, isolate GM012, X/C recombinant 255_________............24457
FR714492.1 Hepatitis B virus complete genome, isolate GY235, X/C recombinant 235.....................255100
FR714492.1 Hepatitis B virus complete genome, isolate GY235, X/C recombinant 255_________............24457
FR714493.1 Hepatitis B virus complete genome, isolate NA167, X/C recombinant 235.....................255100
FR714493.1 Hepatitis B virus complete genome, isolate NA167, X/C recombinant 255_________............24457
FR714494.1 Hepatitis B virus complete genome, isolate NS052, X/C recombinant 235.....................255100
FR714494.1 Hepatitis B virus complete genome, isolate NS052, X/C recombinant 255_________............24457
FR714495.1 Hepatitis B virus complete genome, isolate QB062, X/C recombinant 235.....................255100
FR714495.1 Hepatitis B virus complete genome, isolate QB062, X/C recombinant 255_________............24457
FR714497.1 Hepatitis B virus complete genome, isolate QP046, X/C recombinant 235.....................255100
FR714497.1 Hepatitis B virus complete genome, isolate QP046, X/C recombinant 255_________............24457
FR714498.1 Hepatitis B virus complete genome, isolate QQB36, X/C recombinant 235.....................255100
FR714498.1 Hepatitis B virus complete genome, isolate QQB36, X/C recombinant 255_________............24457
FR714499.1 Hepatitis B virus complete genome, isolate TF051, X/C recombinant 235.....................255100
FR714499.1 Hepatitis B virus complete genome, isolate TF051, X/C recombinant 255_________............24457
FR714500.1 Hepatitis B virus complete genome, isolate TX164, X/C recombinant 235.....................255100
FR714500.1 Hepatitis B virus complete genome, isolate TX164, X/C recombinant 255_________............24457
FR714501.1 Hepatitis B virus complete genome, isolate TX327, X/C recombinant 235.....................255100
FR714501.1 Hepatitis B virus complete genome, isolate TX327, X/C recombinant 255_________............24457
FR714502.1 Hepatitis B virus complete genome, isolate TZ087, X/C recombinant 235.....................255100
FR714502.1 Hepatitis B virus complete genome, isolate TZ087, X/C recombinant 255_________............24457
FR714503.1 Hepatitis B virus complete genome, isolate TZ306, X/C recombinant 235.....................255100
FR714503.1 Hepatitis B virus complete genome, isolate TZ306, X/C recombinant 255_________............24457
FR714504.1 Hepatitis B virus complete genome, isolate WL339, X/C recombinant 235.....................255100
FR714504.1 Hepatitis B virus complete genome, isolate WL339, X/C recombinant 255_________............24457
FR714505.1 Hepatitis B virus complete genome, isolate XW233, X/C recombinant 235.....................255100
FR714505.1 Hepatitis B virus complete genome, isolate XW233, X/C recombinant 255_________............24457
FR714506.1 Hepatitis B virus complete genome, isolate YL204, X/C recombinant 235.....................255100
FR714506.1 Hepatitis B virus complete genome, isolate YL204, X/C recombinant 255_________............24457
GU177079.1 Hepatitis B virus isolate DN171, complete genome 235.....................255100
GU177079.1 Hepatitis B virus isolate DN171, complete genome 255_________............24457
AB554016.1 HBV genotype D DNA, complete genome, isolate: TRF08226 235.....................255100
AB554016.1 HBV genotype D DNA, complete genome, isolate: TRF08226 255_________............24457
AB554023.1 HBV genotype D DNA, complete genome, isolate: GRS08457 235.....................255100
AB554023.1 HBV genotype D DNA, complete genome, isolate: GRS08457 255_________............24457
AB554024.1 HBV genotype D DNA, complete genome, isolate: GRS08538 235.....................255100
AB554024.1 HBV genotype D DNA, complete genome, isolate: GRS08538 255_________............24457
AB562462.1 Hepatitis B virus DNA, complete genome, isolate: HPA184_07 235.....................255100
AB562462.1 Hepatitis B virus DNA, complete genome, isolate: HPA184_07 255_________............24457
AB562463.1 Hepatitis B virus DNA, complete genome, isolate: HPC017_07 235.....................255100
AB562463.1 Hepatitis B virus DNA, complete genome, isolate: HPC017_07 255_________............24457
HQ236016.1 Hepatitis B virus isolate RS3, complete genome 235.....................255100
HQ236016.1 Hepatitis B virus isolate RS3, complete genome 255_________............24457
AB583679.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8134 235.....................255100
AB583679.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8134 255_________............24457
AB583680.1 Hepatitis B virus DNA, complete genome, isolate: Pkst7912 235.....................255100
AB583680.1 Hepatitis B virus DNA, complete genome, isolate: Pkst7912 255_________............24457
AB583681.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8216 235.....................255100
AB583681.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8216 255_________............24457
HQ231877.1 Hepatitis B virus isolate B3-1, complete genome 235.....................255100
HQ231877.1 Hepatitis B virus isolate B3-1, complete genome 255_________............24457
HQ231878.1 Hepatitis B virus isolate B3-2, complete genome 235.....................255100
HQ231878.1 Hepatitis B virus isolate B3-2, complete genome 255_________............24457
HQ231879.1 Hepatitis B virus isolate B3-4, complete genome 235.....................255100
HQ231879.1 Hepatitis B virus isolate B3-4, complete genome 255_________............24457
HQ231880.1 Hepatitis B virus isolate B3-5, complete genome 235.....................255100
HQ231880.1 Hepatitis B virus isolate B3-5, complete genome 255_________............24457
HQ231881.1 Hepatitis B virus isolate B3-6, complete genome 235.....................255100
HQ231881.1 Hepatitis B virus isolate B3-6, complete genome 255_________............24457
HQ231882.1 Hepatitis B virus isolate B3-7, complete genome 235.....................255100
HQ231882.1 Hepatitis B virus isolate B3-7, complete genome 255_________............24457
HQ231883.1 Hepatitis B virus isolate B3-8, complete genome 235.....................255100
HQ231883.1 Hepatitis B virus isolate B3-8, complete genome 255_________............24457
HQ231884.1 Hepatitis B virus isolate B3-9, complete genome 235.....................255100
HQ231884.1 Hepatitis B virus isolate B3-9, complete genome 255_________............24457
HQ231885.1 Hepatitis B virus isolate B3-10, complete genome 235.....................255100
HQ231885.1 Hepatitis B virus isolate B3-10, complete genome 255_________............24457
JF440017.1 Hepatitis B virus isolate FOL496, complete genome 1607.....................1627100
JF440017.1 Hepatitis B virus isolate FOL496, complete genome 1627_________............161657
JF491447.1 Hepatitis B virus isolate QH-13, complete genome 235.....................255100
JF491447.1 Hepatitis B virus isolate QH-13, complete genome 255_________............24457
JF491448.1 Hepatitis B virus isolate QH-29, complete genome 235.....................255100
JF491448.1 Hepatitis B virus isolate QH-29, complete genome 255_________............24457
JF491449.1 Hepatitis B virus isolate QH-32, complete genome 235.....................255100
JF491449.1 Hepatitis B virus isolate QH-32, complete genome 255_________............24457
JF491450.1 Hepatitis B virus isolate QH-33, complete genome 235.....................255100
JF491450.1 Hepatitis B virus isolate QH-33, complete genome 255_________............24457
JF491451.1 Hepatitis B virus isolate QH-35, complete genome 235.....................255100
JF491451.1 Hepatitis B virus isolate QH-35, complete genome 255_________............24457
JF491452.1 Hepatitis B virus isolate QH-53, complete genome 235.....................255100
JF491452.1 Hepatitis B virus isolate QH-53, complete genome 255_________............24457
JF491453.1 Hepatitis B virus isolate QH-90, complete genome 235.....................255100
JF491453.1 Hepatitis B virus isolate QH-90, complete genome 255_________............24457
JF491454.1 Hepatitis B virus isolate QH-79, complete genome 235.....................255100
JF491454.1 Hepatitis B virus isolate QH-79, complete genome 255_________............24457
JF491455.1 Hepatitis B virus isolate Tibet-31, complete genome 235.....................255100
JF491455.1 Hepatitis B virus isolate Tibet-31, complete genome 255_________............24457
JF491456.1 Hepatitis B virus isolate Tibet-53, complete genome 235.....................255100
JF491456.1 Hepatitis B virus isolate Tibet-53, complete genome 255_________............24457
AF241409.1 Hepatitis B virus isolate 6871, complete genome 235...................._25495
AY233290.1 Hepatitis B virus isolate 85 complete genome 235...................._25495
AJ627217.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20953 236_....................25595
AJ627217.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20953 255_________............24457
DQ463797.1 Hepatitis B virus isolate 650-15_2004, complete genome 235...................._25495
FM199976.1 Hepatitis B virus complete genome, strain 45082 235...................._25495
FN545833.1 Hepatitis B virus complete genome, strain 42063 235......r..............25595
FN545833.1 Hepatitis B virus complete genome, strain 42063 255_________............24457
HM146131.1 Hepatitis B virus isolate TCGA5889, complete genome 110_....................12995
HM146131.1 Hepatitis B virus isolate TCGA5889, complete genome 129_________............11857
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 235......a..............25595
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 255_________............24457
X01587.1 Hepatitis B virus subtype adr4 (HBV) 108......a..............12895
X01587.1 Hepatitis B virus subtype adr4 (HBV) 128_________............11757
X14193.1 Hepatitis B virus DNA for adr mutant 235......a..............25595
X14193.1 Hepatitis B virus DNA for adr mutant 255_________............24457
X69798.1 Hepatitis B virus, subtype adw4 genes 235......a..............25595
X69798.1 Hepatitis B virus, subtype adw4 genes 255_________............24457
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 109......a..............12995
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 129_________............11857
D00329.1HPBADW1 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl235......a..............25595
D00329.1HPBADW1 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl255_________............24457
D00330.1HPBADW2 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl235......a..............25595
D00330.1HPBADW2 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl255_________............24457
D12980.1HPBCG Hepatitis B virus subtype adr(SRADR) DNA, complete genome 109......a..............12995
D12980.1HPBCG Hepatitis B virus subtype adr(SRADR) DNA, complete genome 129_________............11857
L08805.1HPBETNC Hepatitis B virus envelope, surface and nucleocapsid protein g237......a..............25795
L08805.1HPBETNC Hepatitis B virus envelope, surface and nucleocapsid protein g257_________............24657
M54923.1HPBADWZ Hepatitis B virus (subtype adw), complete genome 235......a..............25595
M54923.1HPBADWZ Hepatitis B virus (subtype adw), complete genome 255_________............24457
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 235......a..............25595
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 255_________............24457
M32138.1HPBHBVAA Hepatitis B virus variant HBV-alpha1, complete genome 237.......a.............25795
M32138.1HPBHBVAA Hepatitis B virus variant HBV-alpha1, complete genome 257_________............24657
L27106.1HPBMUT Hepatitis B virus mutant complete genome 237.......a.............25795
L27106.1HPBMUT Hepatitis B virus mutant complete genome 257_________............24657
X75665.1 Human hepatitis virus (genotype C, HMA) preS1, preS2, S, C, X, antige235......a..............25595
X75665.1 Human hepatitis virus (genotype C, HMA) preS1, preS2, S, C, X, antige255_________............24457
X75663.1 Human hepatitis virus (genotype F, 9203) preS1, preS2, S, C, X, and P235......a..............25595
X75663.1 Human hepatitis virus (genotype F, 9203) preS1, preS2, S, C, X, and P255_________............24457
X75658.1 Human hepatitis virus (genotype F, Fou) preS1, preS2, S, C, X, antige235......a..............25595
X75658.1 Human hepatitis virus (genotype F, Fou) preS1, preS2, S, C, X, antige255_________............24457
X75656.1 Human hepatitis virus (genotype C, Cha) preS1, preS2, S, C, X, antige235......a..............25595
X75656.1 Human hepatitis virus (genotype C, Cha) preS1, preS2, S, C, X, antige259_____.c.c............24466
X52939.1 Hepatitis B virus genome with a pre X orf 108......a..............12895
X52939.1 Hepatitis B virus genome with a pre X orf 128_________............11757
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 237......a..............25795
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 257_________............24657
D23677.1HPBA1HKK2 Hepatitis B virus (A1-HBVKK2) complete genome sequence 235......a..............25595
D23677.1HPBA1HKK2 Hepatitis B virus (A1-HBVKK2) complete genome sequence 255_________............24457
D23678.1HPBA2HYS2 Hepatitis B virus (A2-HBVYS2) complete genome sequence 235......a..............25595
D23678.1HPBA2HYS2 Hepatitis B virus (A2-HBVYS2) complete genome sequence 255_________............24457
D23679.1HPBA3HMS2 Hepatitis B virus (A3-HBVMS2) complete genome sequence 235......a..............25595
D23679.1HPBA3HMS2 Hepatitis B virus (A3-HBVMS2) complete genome sequence 255_________............24457
D23680.1HPBB4HST1 Hepatitis B virus (B4-HBVST1) complete genome sequence 235......a..............25595
D23680.1HPBB4HST1 Hepatitis B virus (B4-HBVST1) complete genome sequence 255_________............24457
D23681.1HPBC4HST2 Hepatitis B virus (C4-HBVST2) complete genome sequence 235......a..............25595
D23681.1HPBC4HST2 Hepatitis B virus (C4-HBVST2) complete genome sequence 255_________............24457
D23684.1HPBC6T588 Hepatitis B virus (C6-TKB588) complete genome sequence 235......a..............25595
D23684.1HPBC6T588 Hepatitis B virus (C6-TKB588) complete genome sequence 255_________............24457
D50489.1HPBA11A Hepatitis B virus DNA, complete genome, isolate:A11 237......a..............25795
D50489.1HPBA11A Hepatitis B virus DNA, complete genome, isolate:A11 257_________............24657
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete237......a..............25795
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete257_________............24657
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete237......a..............25795
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete257_________............24657
X97850.1 Hepatitis B virus (patient 4) complete genome 237......a..............25795
X97850.1 Hepatitis B virus (patient 4) complete genome 257_________............24657
X97851.1 Hepatitis B virus (patient 6) complete genome 237......a..............25795
X97851.1 Hepatitis B virus (patient 6) complete genome 257_________............24657
U46935.1HBU46935 Hepatitis B virus complete genome 235......a..............25595
U46935.1HBU46935 Hepatitis B virus complete genome 255_________............24457
X98073.1 Hepatitis B virus complete genome with insertion in core promoter (no235......a..............25595
X98073.1 Hepatitis B virus complete genome with insertion in core promoter (no255_________............24457
X98072.1 Hepatitis B virus complete genome with insertion in core promoter 235......a..............25595
X98072.1 Hepatitis B virus complete genome with insertion in core promoter 255_________............24457
X98077.1 Hepatitis B virus complete genome, wild type 235......a..............25595
X98077.1 Hepatitis B virus complete genome, wild type 255_________............24457
X98074.1 Hepatitis B virus complete genome with insertion in core promoter, 76235......a..............25595
X98074.1 Hepatitis B virus complete genome with insertion in core promoter, 76255_________............24457
X98075.1 Hepatitis B virus complete genome with insertion in core promoter, 19235......a..............25595
X98075.1 Hepatitis B virus complete genome with insertion in core promoter, 19255_________............24457
X98076.1 Hepatitis B virus complete genome with insertion in core promoter, 33235......a..............25595
X98076.1 Hepatitis B virus complete genome with insertion in core promoter, 33255_________............24457
D50521.1 Hepatitis B virus clone HBV-ASA-FH1 genomic DNA, complete sequence 235......a..............25595
D50521.1 Hepatitis B virus clone HBV-ASA-FH1 genomic DNA, complete sequence 255_________............24457
D50522.1 Hepatitis B virus clone HBV-ASA-FH2 genomic DNA, complete sequence 235......a..............25595
D50522.1 Hepatitis B virus clone HBV-ASA-FH2 genomic DNA, complete sequence 255_________............24457
D50517.1 Hepatitis B virus clone HBV-ASA-EX1 genomic DNA, complete sequence 235......a..............25595
D50517.1 Hepatitis B virus clone HBV-ASA-EX1 genomic DNA, complete sequence 255_________............24457
D50518.1 Hepatitis B virus clone HBV-ASA-EX2 genomic DNA, complete sequence 235......a..............25595
D50518.1 Hepatitis B virus clone HBV-ASA-EX2 genomic DNA, complete sequence 255_________............24457
D50519.1 Hepatitis B virus clone HBV-ASA-EX3 genomic DNA, complete sequence 235......a..............25595
D50519.1 Hepatitis B virus clone HBV-ASA-EX3 genomic DNA, complete sequence 255_________............24457
D50520.1 Hepatitis B virus clone HBV-ASA-EX4 genomic DNA, complete sequence 235......a..............25595
D50520.1 Hepatitis B virus clone HBV-ASA-EX4 genomic DNA, complete sequence 255_________............24457
AB014360.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D01HCC 235......a..............25595
AB014360.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D01HCC 255_________............24457
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 187......a..............20795
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 207_________............19657
AB014362.1 Hepatitis B virus genomic DNA, complete sequence, isolate 03D03HCC 235......a..............25595
AB014362.1 Hepatitis B virus genomic DNA, complete sequence, isolate 03D03HCC 255_________............24457
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 235......a..............25595
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 255_________............24457
AB014366.1 Hepatitis B virus genomic DNA, complete sequence, isolate 07D07HCC 235......a..............25595
AB014366.1 Hepatitis B virus genomic DNA, complete sequence, isolate 07D07HCC 255_________............24457
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 235......a..............25595
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 255_________............24457
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 187......a..............20795
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 207_________............19657
AB014373.1 Hepatitis B virus genomic DNA, complete sequence, isolate 14D14HCC 187......a..............20795
AB014373.1 Hepatitis B virus genomic DNA, complete sequence, isolate 14D14HCC 207_________............19657
AB014374.1 Hepatitis B virus genomic DNA, complete sequence, isolate 15D15HCC 235......a..............25595
AB014374.1 Hepatitis B virus genomic DNA, complete sequence, isolate 15D15HCC 255_________............24457
AB014375.1 Hepatitis B virus genomic DNA, complete sequence, isolate 16T01HCC 190......a..............21095
AB014375.1 Hepatitis B virus genomic DNA, complete sequence, isolate 16T01HCC 210_________............19957
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 235......a..............25595
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 255_________............24457
AB014377.1 Hepatitis B virus genomic DNA, complete sequence, isolate 18T03HCC 235......a..............25595
AB014377.1 Hepatitis B virus genomic DNA, complete sequence, isolate 18T03HCC 255_________............24457
AB014379.1 Hepatitis B virus genomic DNA, complete sequence, isolate 20Y02HCC 235......a..............25595
AB014379.1 Hepatitis B virus genomic DNA, complete sequence, isolate 20Y02HCC 255_________............24457
AB014380.1 Hepatitis B virus genomic DNA, complete sequence, isolate 21Y03HCC 235......a..............25595
AB014380.1 Hepatitis B virus genomic DNA, complete sequence, isolate 21Y03HCC 255_________............24457
AB014387.1 Hepatitis B virus genomic DNA, complete sequence, isolate 28Y10HCC 190......a..............21095
AB014387.1 Hepatitis B virus genomic DNA, complete sequence, isolate 28Y10HCC 210_________............19957
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 235......a..............25595
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 255_________............24457
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 196......a..............21695
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 216_________............20557
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 235......a..............25595
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 255_________............24457
AB014394.1 Hepatitis B virus genomic DNA, complete sequence, isolate 35Y17HCC 235......a..............25595
AB014394.1 Hepatitis B virus genomic DNA, complete sequence, isolate 35Y17HCC 255_________............24457
AB014395.1 Hepatitis B virus genomic DNA, complete sequence, isolate 36Y18HCC 222......a..............24295
AB014395.1 Hepatitis B virus genomic DNA, complete sequence, isolate 36Y18HCC 242_________............23157
AB014371.1 Hepatitis B virus genomic DNA, complete sequence, isolate 12D12HCC 235......a..............25595
AB014371.1 Hepatitis B virus genomic DNA, complete sequence, isolate 12D12HCC 255_________............24457
AB014381.1 Hepatitis B virus genomic DNA, complete sequence, isolate 22Y04HCC 235......a..............25595
AB014381.1 Hepatitis B virus genomic DNA, complete sequence, isolate 22Y04HCC 255_________............24457
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 235......a..............25595
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 255_________............24457
AB014383.1 Hepatitis B virus genomic DNA, complete sequence, isolate 24Y06HCC 235......a..............25595
AB014383.1 Hepatitis B virus genomic DNA, complete sequence, isolate 24Y06HCC 255_________............24457
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 235......a..............25595
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 255_________............24457
AB014393.1 Hepatitis B virus genomic DNA, complete sequence, isolate 34Y16HCC 235......a..............25595
AB014393.1 Hepatitis B virus genomic DNA, complete sequence, isolate 34Y16HCC 255_________............24457
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 235......a..............25595
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 255_________............24457
AB014398.1 Hepatitis B virus genomic DNA, complete sequence, isolate 39Y21HCC 187......a..............20795
AB014398.1 Hepatitis B virus genomic DNA, complete sequence, isolate 39Y21HCC 207_________............19657
AB014399.1 Hepatitis B virus genomic DNA, complete sequence, isolate 40Y22HCC 235......a..............25595
AB014399.1 Hepatitis B virus genomic DNA, complete sequence, isolate 40Y22HCC 255_________............24457
AJ131569.1 Hepatitis B virus complete genome, isolate gib759 1604......a..............162495
AJ131569.1 Hepatitis B virus complete genome, isolate gib759 1624_________............161357
AJ131575.1 Hepatitis B virus complete genome, isolate chimp82 1604......a..............162495
AJ131575.1 Hepatitis B virus complete genome, isolate chimp82 1624_________............161357
AF068756.1 Hepatitis B virus, complete genome 238......a..............25895
AF068756.1 Hepatitis B virus, complete genome 258_________............24757
AF100308.1 Hepatitis B virus strain 2-18, complete genome 237......a..............25795
AF100308.1 Hepatitis B virus strain 2-18, complete genome 257_________............24657
AF100309.1 Hepatitis B virus strain 56, complete genome 237......a..............25795
AF100309.1 Hepatitis B virus strain 56, complete genome 257_________............24657
AJ131133.1 Hepatitis B virus, complete genome, strain JL1 235......a..............25595
AJ131133.1 Hepatitis B virus, complete genome, strain JL1 255_________............24457
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 235......a..............25595
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 255_________............24457
Y18856.1 Hepatitis B virus complete genome, isolate HBV-C5 235......a..............25595
Y18856.1 Hepatitis B virus complete genome, isolate HBV-C5 255_________............24457
Y18857.1 Hepatitis B virus complete genome, isolate HBV-C6 235......a..............25595
Y18857.1 Hepatitis B virus complete genome, isolate HBV-C6 255_________............24457
Y18858.1 Hepatitis B virus complete genome, isolate HBV-C7 235......a..............25595
Y18858.1 Hepatitis B virus complete genome, isolate HBV-C7 255_________............24457
AF143299.1 Hepatitis B virus clone 7744-G9, complete genome 1463......a..............148395
AF143299.1 Hepatitis B virus clone 7744-G9, complete genome 1483_________............147257
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 2083.......a.............210395
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 2103_________............209257
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-2235......a..............25595
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-2255_________............24457
AB031266.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-3235......a..............25595
AB031266.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-3255_________............24457
AB031267.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-6235......a..............25595
AB031267.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-6255_________............24457
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 237......a..............25795
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 257_________............24657
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 237......a..............25795
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 257_________............24657
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 233......a..............25395
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 253_________............24257
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 233......a..............25395
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 253_________............24257
AB026815.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 2:full 233......a..............25395
AB026815.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 2:full 253_________............24257
AB033550.1 Hepatitis B virus DNA, complete genome 235......a..............25595
AB033550.1 Hepatitis B virus DNA, complete genome 255_________............24457
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 235......a..............25595
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 255_________............24457
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 235......a..............25595
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 255_________............24457
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 235......a..............25595
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 255_________............24457
AB033554.1 Hepatitis B virus DNA, complete genome, isolate:RTB299 235......a..............25595
AB033554.1 Hepatitis B virus DNA, complete genome, isolate:RTB299 255_________............24457
AB033555.1 Hepatitis B virus DNA, complete genome, isolate:PAD744 235......a..............25595
AB033555.1 Hepatitis B virus DNA, complete genome, isolate:PAD744 255_________............24457
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 235......a..............25595
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 255_________............24457
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 235......a..............25595
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 255_________............24457
AB010289.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-1 235......a..............25595
AB010289.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-1 255_________............24457
AB010290.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-2 235......a..............25595
AB010290.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-2 255_________............24457
AB010291.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-3 235......a..............25595
AB010291.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-3 255_________............24457
AB010292.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-4 235......a..............25595
AB010292.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-4 255_________............24457
AF121243.1 Hepatitis B virus isolate HBV/14611, complete genome 235......a..............25595
AF121243.1 Hepatitis B virus isolate HBV/14611, complete genome 255_________............24457
AF121244.1 Hepatitis B virus isolate HBV/15122, complete genome 235......a..............25595
AF121244.1 Hepatitis B virus isolate HBV/15122, complete genome 255_________............24457
AF121245.1 Hepatitis B virus isolate HBV/16091, complete genome 235......a..............25595
AF121245.1 Hepatitis B virus isolate HBV/16091, complete genome 255_________............24457
AF121246.1 Hepatitis B virus isolate HBV/IK29902, complete genome 235......a..............25595
AF121246.1 Hepatitis B virus isolate HBV/IK29902, complete genome 255_________............24457
AF121247.1 Hepatitis B virus isolate HBV/719, complete genome 235......a..............25595
AF121247.1 Hepatitis B virus isolate HBV/719, complete genome 255_________............24457
AF121248.1 Hepatitis B virus isolate HBV/139-1, complete genome 235......a..............25595
AF121248.1 Hepatitis B virus isolate HBV/139-1, complete genome 255_________............24457
AF121249.1 Hepatitis B virus isolate HBV/4014, complete genome 235......a..............25595
AF121249.1 Hepatitis B virus isolate HBV/4014, complete genome 255_________............24457
AF121250.1 Hepatitis B virus isolate HBV/6395, complete genome 235......a..............25595
AF121250.1 Hepatitis B virus isolate HBV/6395, complete genome 255_________............24457
AF121251.1 Hepatitis B virus isolate HBV/9873, complete genome 235......a..............25595
AF121251.1 Hepatitis B virus isolate HBV/9873, complete genome 255_________............24457
AF233236.1 Hepatitis B virus strain adw2 isolate HBV334, complete genome 1491......a..............151195
AF233236.1 Hepatitis B virus strain adw2 isolate HBV334, complete genome 1511_________............150057
AF282917.1 Hepatitis B virus isolate HBV-B1, complete genome 235......a..............25595
AF282917.1 Hepatitis B virus isolate HBV-B1, complete genome 255_________............24457
AF282918.1 Hepatitis B virus isolate HBV-B2, complete genome 235......a..............25595
AF282918.1 Hepatitis B virus isolate HBV-B2, complete genome 255_________............24457
AB046525.1 Hepatitis B virus genomic DNA, complete sequence, isolate:PttHBV-ChBa202...........a.........22295
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 237......a..............25795
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 257_________............24657
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 237......a..............25795
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 257_________............24657
AF182804.1 Hepatitis B virus strain WLAP10, complete genome 237......a..............25795
AF182804.1 Hepatitis B virus strain WLAP10, complete genome 257_________............24657
AF182805.1 Hepatitis B virus strain WLAID, complete genome 204......a..............22495
AF182805.1 Hepatitis B virus strain WLAID, complete genome 224_________............21357
AB050018.1 Hepatitis B virus DNA, complete genome 235......a..............25595
AB050018.1 Hepatitis B virus DNA, complete genome 255_________............24457
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 235......a..............25595
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 255_________............24457
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 235......a..............25595
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 255_________............24457
AB042284.1 Hepatitis B virus DNA, complete genome, isolate:NSS-3 235......a..............25595
AB042284.1 Hepatitis B virus DNA, complete genome, isolate:NSS-3 255_________............24457
AB042285.1 Hepatitis B virus DNA, complete genome, isolate:NSS-4 235......a..............25595
AB042285.1 Hepatitis B virus DNA, complete genome, isolate:NSS-4 255_________............24457
AB036905.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-235......a..............25595
AB036905.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-255_________............24457
AB036906.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-235......a..............25595
AB036906.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-255_________............24457
AB036907.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-235......a..............25595
AB036907.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-255_________............24457
AB036908.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036908.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036909.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-235......a..............25595
AB036909.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-255_________............24457
AB036910.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036910.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036911.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036911.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036912.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036912.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036913.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036913.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036914.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036914.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036915.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036915.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036916.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036916.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036917.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036917.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036918.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036918.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036919.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036919.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB036920.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:235......a..............25595
AB036920.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:255_________............24457
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 235......a..............25595
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 255_________............24457
AB049610.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN29 235......a..............25595
AB049610.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN29 255_________............24457
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 235......a..............25595
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 255_________............24457
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 235......a..............25595
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 255_________............24457
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 235......a..............25595
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 255_________............24457
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 235......a..............25595
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 255_________............24457
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 235......a..............25595
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 255_________............24457
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 235......a..............25595
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 255_________............24457
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 235......a..............25595
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 255_________............24457
AF223961.1 Hepatitis B virus strain C-1858 isolate ea8, complete genome 235......a..............25595
AF223961.1 Hepatitis B virus strain C-1858 isolate ea8, complete genome 255_________............24457
AF223962.1 Hepatitis B virus strain C-1858 isolate sa4, complete genome 235......a..............25595
AF223962.1 Hepatitis B virus strain C-1858 isolate sa4, complete genome 255_________............24457
AF223963.1 Hepatitis B virus strain C-1858 isolate sa11, complete genome 235......a..............25595
AF223963.1 Hepatitis B virus strain C-1858 isolate sa11, complete genome 255_________............24457
AF223964.1 Hepatitis B virus strain C-1858 isolate sa14, complete genome 235......a..............25595
AF223964.1 Hepatitis B virus strain C-1858 isolate sa14, complete genome 255_________............24457
AF223965.1 Hepatitis B virus strain C-1858 isolate sa16, complete genome 235......a..............25595
AF223965.1 Hepatitis B virus strain C-1858 isolate sa16, complete genome 255_________............24457
AB048704.1 Hepatitis B virus DNA, complete genome, serotype:ayw 235......t..............25595
AB048704.1 Hepatitis B virus DNA, complete genome, serotype:ayw 255_________............24457
AB048705.1 Hepatitis B virus DNA, complete genome, serotype:ayw 235......t..............25595
AB048705.1 Hepatitis B virus DNA, complete genome, serotype:ayw 255_________............24457
AF330110.1 Hepatitis B virus strain T-1858 genotype C, complete genome 235......a..............25595
AF330110.1 Hepatitis B virus strain T-1858 genotype C, complete genome 255_________............24457
AF363961.1 Hepatitis B virus strain G683-1, complete genome 1630......a..............165095
AF363961.1 Hepatitis B virus strain G683-1, complete genome 1650_________............163957
AF363962.1 Hepatitis B virus strain G683-2, complete genome 1597......a..............161795
AF363962.1 Hepatitis B virus strain G683-2, complete genome 1617_________............160657
AF363963.1 Hepatitis B virus strain G683-3, complete genome 1630......a..............165095
AF363963.1 Hepatitis B virus strain G683-3, complete genome 1650_________............163957
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 1630......a..............165095
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 1650_________............163957
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 1534......a..............155495
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 1554_________............154357
AY040627.1 Hepatitis B virus genotype C, complete genome 235......a..............25595
AY040627.1 Hepatitis B virus genotype C, complete genome 255_________............24457
AJ309369.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 10235.................g...25595
AF411408.1 Hepatitis B virus strain FMU#14, complete genome 237......a..............25795
AF411408.1 Hepatitis B virus strain FMU#14, complete genome 257_________............24657
AF411409.1 Hepatitis B virus strain FMC#16, complete genome 237......a..............25795
AF411409.1 Hepatitis B virus strain FMC#16, complete genome 257_________............24657
AF411410.1 Hepatitis B virus strain FMC#20, complete genome 210......a..............23095
AF411410.1 Hepatitis B virus strain FMC#20, complete genome 230_________............21957
AF411411.1 Hepatitis B virus strain FMC#97, complete genome 237......a..............25795
AF411411.1 Hepatitis B virus strain FMC#97, complete genome 257_________............24657
AF411412.1 Hepatitis B virus strain FMC#15, complete genome 237......a..............25795
AF411412.1 Hepatitis B virus strain FMC#15, complete genome 257_________............24657
AB059659.1 Hepatitis B virus DNA, complete genome, clone:US10 235......a..............25595
AB059659.1 Hepatitis B virus DNA, complete genome, clone:US10 255_________............24457
AB059660.1 Hepatitis B virus DNA, complete genome, clone:US1778 235......a..............25595
AB059660.1 Hepatitis B virus DNA, complete genome, clone:US1778 255_________............24457
AB059661.1 Hepatitis B virus DNA, complete genome, clone:US2065 235......a..............25595
AB059661.1 Hepatitis B virus DNA, complete genome, clone:US2065 255_________............24457
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 235......a..............25595
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 255_________............24457
AY033072.1 Hepatitis B virus serotype ayw1, complete genome 1630......a..............165095
AY033072.1 Hepatitis B virus serotype ayw1, complete genome 1650_________............163957
AY033073.1 Hepatitis B virus serotype ayw1, complete genome 1630......a..............165095
AY033073.1 Hepatitis B virus serotype ayw1, complete genome 1650_________............163957
AY066028.1 Hepatitis B virus isolate FH4, complete genome 237......a..............25795
AY066028.1 Hepatitis B virus isolate FH4, complete genome 257_________............24657
AB064316.1 Hepatitis B virus DNA, complete genome, clone:US2573 235......a..............25595
AB064316.1 Hepatitis B virus DNA, complete genome, clone:US2573 255_________............24457
AF458664.1 Hepatitis B virus isolate C84, complete genome 237......a..............25795
AF458664.1 Hepatitis B virus isolate C84, complete genome 257_________............24657
AF458665.1 Hepatitis B virus isolate C733, complete genome 237......t..............25795
AF458665.1 Hepatitis B virus isolate C733, complete genome 257_________............24657
AF461357.1 Hepatitis B virus isolate FH5, compete genome 237......a..............25795
AF461357.1 Hepatitis B virus isolate FH5, compete genome 257_________............24657
AF461358.1 Hepatitis B virus isolate FH8, compete genome 237......a..............25795
AF461358.1 Hepatitis B virus isolate FH8, compete genome 257_________............24657
AF461359.1 Hepatitis B virus isolate c16, compete genome 237......a..............25795
AF461359.1 Hepatitis B virus isolate c16, compete genome 257_________............24657
AF461360.1 Hepatitis B virus isolate FH14-2, compete genome 237......a..............25795
AF461360.1 Hepatitis B virus isolate FH14-2, compete genome 257_________............24657
AF461361.1 Hepatitis B virus isolate FH3Q, compete genome 231......a..............25195
AF461361.1 Hepatitis B virus isolate FH3Q, compete genome 251_________............24057
AF461362.1 Hepatitis B virus isolate FH10, compete genome 175......a..............19595
AF461362.1 Hepatitis B virus isolate FH10, compete genome 195_________............18457
AF461363.1 Hepatitis B virus isolate C8, compete genome 237......a..............25795
AF461363.1 Hepatitis B virus isolate C8, compete genome 257_________............24657
AF473543.1 Hepatitis B virus isolate 2e, complete genome 235......a..............25595
AF473543.1 Hepatitis B virus isolate 2e, complete genome 255_________............24457
AF479684.1 Hepatitis B virus isolate 3c, complete genome 235......a..............25595
AF479684.1 Hepatitis B virus isolate 3c, complete genome 255_________............24457
AF405706.1 Hepatitis B virus isolate 235/01, complete genome 235......a..............25595
AF405706.1 Hepatitis B virus isolate 235/01, complete genome 255_________............24457
U87746.3 Hepatitis B virus isolate 7782, complete genome 237...........a.........25795
AB073821.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi20 235......a..............25595
AB073821.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi20 255_________............24457
AB073822.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi32 235......a..............25595
AB073822.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi32 255_________............24457
AB073823.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi35 235......a..............25595
AB073823.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi35 255_________............24457
AB073824.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi4 235......a..............25595
AB073824.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi4 255_________............24457
AB073825.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi51 235......a..............25595
AB073825.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi51 255_________............24457
AB073826.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi89 235......a..............25595
AB073826.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi89 255_________............24457
AB073827.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK11 235......a..............25595
AB073827.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK11 255_________............24457
AB073828.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK37 235......a..............25595
AB073828.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK37 255_________............24457
AB073829.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK38 235......a..............25595
AB073829.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK38 255_________............24457
AB073830.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH57 235......a..............25595
AB073830.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH57 255_________............24457
AB073831.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH61 235......a..............25595
AB073831.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH61 255_________............24457
AB073832.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th65 235......a..............25595
AB073832.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th65 255_________............24457
AB073833.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi59 235......a..............25595
AB073833.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi59 255_________............24457
AB073834.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi16 235......a..............25595
AB073834.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi16 255_________............24457
AB073835.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi29 235......a..............25595
AB073835.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi29 255_________............24457
AB073836.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw25 235......a..............25595
AB073836.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw25 255_________............24457
AB073837.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ku1 235......a..............25595
AB073837.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ku1 255_________............24457
AB073838.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ho7 235......a..............25595
AB073838.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ho7 255_________............24457
AB073839.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw174 235......a..............25595
AB073839.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw174 255_________............24457
AB073840.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw36 235......a..............25595
AB073840.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw36 255_________............24457
AB073841.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw30 235......a..............25595
AB073841.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw30 255_________............24457
AB073842.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw11 235......a..............25595
AB073842.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw11 255_________............24457
AB073844.1 Hepatitis B virus DNA, complete genome, isolate:HBV-T11 235......a..............25595
AB073844.1 Hepatitis B virus DNA, complete genome, isolate:HBV-T11 255_________............24457
AB073845.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ya16 235......a..............25595
AB073845.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ya16 255_________............24457
AB073846.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry565 235......a..............25595
AB073846.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry565 255_________............24457
AB073847.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Fu53 235......a..............25595
AB073847.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Fu53 255_________............24457
AB073848.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HUS 235......a..............25595
AB073848.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HUS 255_________............24457
AB073849.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na101 235......a..............25595
AB073849.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na101 255_________............24457
AB073850.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na102 235......a..............25595
AB073850.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na102 255_________............24457
AB073851.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry1 235......a..............25595
AB073851.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry1 255_________............24457
AB073854.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry30 235......a..............25595
AB073854.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry30 255_________............24457
AB073855.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry34 235......a..............25595
AB073855.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry34 255_________............24457
AB073856.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry46 235......a..............25595
AB073856.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry46 255_________............24457
AB073857.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry48 235......a..............25595
AB073857.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry48 255_________............24457
AB073858.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Shin 235......a..............25595
AB073858.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Shin 255_________............24457
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 235......a..............25595
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 255_________............24457
U87747.3 Hepatitis B virus isolate Wong, complete genome 237......a..............25795
U87747.3 Hepatitis B virus isolate Wong, complete genome 257_________............24657
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 235......a..............25595
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 255_________............24457
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 235......a..............25595
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 255_________............24457
AY090452.1 Hepatitis B virus strain Z29, complete genome 238.......a.............25895
AY090452.1 Hepatitis B virus strain Z29, complete genome 258_________............24757
AY090454.1 Hepatitis B virus strain 1853Nic, complete genome 238......a..............25895
AY090454.1 Hepatitis B virus strain 1853Nic, complete genome 258_________............24757
AY090455.1 Hepatitis B virus strain 1889Nic, complete genome 238......a..............25895
AY090455.1 Hepatitis B virus strain 1889Nic, complete genome 258_________............24757
AY090456.1 Hepatitis B virus strain 1980Nic, complete genome 226......a..............24695
AY090456.1 Hepatitis B virus strain 1980Nic, complete genome 246_________............23557
AY090457.1 Hepatitis B virus strain 2928Nic, complete genome 238......a..............25895
AY090457.1 Hepatitis B virus strain 2928Nic, complete genome 258_________............24757
AY090458.1 Hepatitis B virus strain 70H, complete genome 238......a..............25895
AY090458.1 Hepatitis B virus strain 70H, complete genome 258_________............24757
AY090459.1 Hepatitis B virus strain 7768H, complete genome 238......a..............25895
AY090459.1 Hepatitis B virus strain 7768H, complete genome 258_________............24757
AY090460.1 Hepatitis B virus strain LAS2523, complete genome 238......a..............25895
AY090460.1 Hepatitis B virus strain LAS2523, complete genome 258_________............24757
AY090461.1 Hepatitis B virus strain 1116Sal, complete genome 238......a..............25895
AY090461.1 Hepatitis B virus strain 1116Sal, complete genome 258_________............24757
AY123424.1 Hepatitis B virus, complete genome 237......a..............25795
AY123424.1 Hepatitis B virus, complete genome 257_________............24657
AY123041.1 Hepatitis B virus serotype adr, complete genome 109......a..............12995
AY123041.1 Hepatitis B virus serotype adr, complete genome 129_________............11857
AF286594.1 Hepatitis B virus subtype adr, complete genome 235......a..............25595
AF286594.1 Hepatitis B virus subtype adr, complete genome 255_________............24457
AF536524.1 Hepatitis B virus clone 2A, complete genome 235......a..............25595
AF536524.1 Hepatitis B virus clone 2A, complete genome 255_________............24457
AF418674.1 Hepatitis B virus patient 1185 clone 1, complete genome 237.............a.......25795
AF418675.1 Hepatitis B virus patient 1185 clone 2, complete genome 237.............a.......25795
AY163869.1 Hepatitis B virus isolate FMClx-1, complete genome 237......a..............25795
AY163869.1 Hepatitis B virus isolate FMClx-1, complete genome 257_________............24657
AY163870.1 Hepatitis B virus isolate FMU001, complete genome 237......a..............25795
AY163870.1 Hepatitis B virus isolate FMU001, complete genome 257_________............24657
AY161140.1 Hepatitis B virus clone S2.1 complete genome 235.............a.......25595
AY161141.1 Hepatitis B virus clone S2.2 complete genome 235.............a.......25595
AY148342.1 Hepatitis B virus, complete genome 1600......a..............162095
AY148342.1 Hepatitis B virus, complete genome 1620_________............160957
AB100695.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH133 235......a..............25595
AB100695.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH133 255_________............24457
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 218......a..............23895
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 238_________............22757
AY217373.1 Hepatitis B virus isolate 594, complete genome 235......a..............25595
AY217373.1 Hepatitis B virus isolate 594, complete genome 255_________............24457
AY217374.1 Hepatitis B virus isolate 595, complete genome 220......a..............24095
AY217374.1 Hepatitis B virus isolate 595, complete genome 240_________............22957
AY217375.1 Hepatitis B virus isolate 599, complete genome 235......a..............25595
AY217375.1 Hepatitis B virus isolate 599, complete genome 255_________............24457
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 235......a..............25595
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 255_________............24457
AY217355.1 Hepatitis B virus isolate A6-2, complete genome 235......a..............25595
AY217355.1 Hepatitis B virus isolate A6-2, complete genome 255_________............24457
AY217356.1 Hepatitis B virus isolate A9-2, complete genome 235......a..............25595
AY217356.1 Hepatitis B virus isolate A9-2, complete genome 255_________............24457
AY217357.1 Hepatitis B virus isolate B1r-4, complete genome 235......a..............25595
AY217357.1 Hepatitis B virus isolate B1r-4, complete genome 255_________............24457
AY217358.1 Hepatitis B virus isolate B8r-4, complete genome 235......a..............25595
AY217358.1 Hepatitis B virus isolate B8r-4, complete genome 255_________............24457
AY217359.1 Hepatitis B virus isolate Q6-5, complete genome 235......a..............25595
AY217359.1 Hepatitis B virus isolate Q6-5, complete genome 255_________............24457
AY217360.1 Hepatitis B virus isolate 6-4, complete genome 235......a..............25595
AY217360.1 Hepatitis B virus isolate 6-4, complete genome 255_________............24457
AY217361.1 Hepatitis B virus isolate 582-2, complete genome 235......a..............25595
AY217361.1 Hepatitis B virus isolate 582-2, complete genome 255_________............24457
AY217362.1 Hepatitis B virus isolate 582-4, complete genome 235......a..............25595
AY217362.1 Hepatitis B virus isolate 582-4, complete genome 255_________............24457
AY217363.1 Hepatitis B virus isolate 582-1, complete genome 237......a..............25795
AY217363.1 Hepatitis B virus isolate 582-1, complete genome 257_________............24657
AY217364.1 Hepatitis B virus isolate 586, complete genome 169......a..............18995
AY217364.1 Hepatitis B virus isolate 586, complete genome 189_________............17857
AY217365.1 Hepatitis B virus isolate Q7-1, complete genome 235......a..............25595
AY217365.1 Hepatitis B virus isolate Q7-1, complete genome 255_________............24457
AY217366.1 Hepatitis B virus isolate 17127, complete genome 234......a..............25495
AY217366.1 Hepatitis B virus isolate 17127, complete genome 254_________............24357
AY217367.1 Hepatitis B virus isolate 17993, complete genome 235......a..............25595
AY217367.1 Hepatitis B virus isolate 17993, complete genome 255_________............24457
AY217368.1 Hepatitis B virus isolate 21949, complete genome 235......a..............25595
AY217368.1 Hepatitis B virus isolate 21949, complete genome 255_________............24457
AY217369.1 Hepatitis B virus isolate H2, complete genome 235......a..............25595
AY217369.1 Hepatitis B virus isolate H2, complete genome 255_________............24457
AY217370.1 Hepatitis B virus isolate 7-2, complete genome 235......a..............25595
AY217370.1 Hepatitis B virus isolate 7-2, complete genome 255_________............24457
AY238972.1 Hepatitis B virus defective isolate FMU023, complete genome 237......a..............25795
AY238972.1 Hepatitis B virus defective isolate FMU023, complete genome 257_________............24657
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 235......a..............25595
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 255_________............24457
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 235......a..............25595
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 255_________............24457
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 235......a..............25595
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 255_________............24457
AY206373.1 Hepatitis B virus strain FMU002 complete genome 237......a..............25795
AY206373.1 Hepatitis B virus strain FMU002 complete genome 257_________............24657
AY206374.1 Hepatitis B virus strain FMU003 complete genome 237......a..............25795
AY206374.1 Hepatitis B virus strain FMU003 complete genome 257_________............24657
AY206375.1 Hepatitis B virus strain FMU004 complete genome 237......a..............25795
AY206375.1 Hepatitis B virus strain FMU004 complete genome 257_________............24657
AY206377.1 Hepatitis B virus strain FMU006 complete genome 237......a..............25795
AY206377.1 Hepatitis B virus strain FMU006 complete genome 257_________............24657
AY206378.1 Hepatitis B virus strain FMU007 complete genome 201......a..............22195
AY206378.1 Hepatitis B virus strain FMU007 complete genome 221_________............21057
AY206380.1 Hepatitis B virus strain FMU009 complete genome 237......a..............25795
AY206380.1 Hepatitis B virus strain FMU009 complete genome 257_________............24657
AY206382.1 Hepatitis B virus strain FMU011 complete genome 237......a..............25795
AY206382.1 Hepatitis B virus strain FMU011 complete genome 257_________............24657
AY206383.1 Hepatitis B virus strain FMU012 complete genome 237......a..............25795
AY206383.1 Hepatitis B virus strain FMU012 complete genome 257_________............24657
AY206384.1 Hepatitis B virus strain FMU013 complete genome 237......a..............25795
AY206384.1 Hepatitis B virus strain FMU013 complete genome 257_________............24657
AY206385.1 Hepatitis B virus strain FMU014 complete genome 204......a..............22495
AY206385.1 Hepatitis B virus strain FMU014 complete genome 224_________............21357
AY206386.1 Hepatitis B virus strain FMU015 complete genome 237......a..............25795
AY206386.1 Hepatitis B virus strain FMU015 complete genome 257_________............24657
AY206388.1 Hepatitis B virus strain FMU017 complete genome 237......a..............25795
AY206388.1 Hepatitis B virus strain FMU017 complete genome 257_________............24657
AY206389.1 Hepatitis B virus strain FMU018 complete genome 237......a..............25795
AY206389.1 Hepatitis B virus strain FMU018 complete genome 257_________............24657
AY206390.1 Hepatitis B virus strain FMU019 complete genome 237......a..............25795
AY206390.1 Hepatitis B virus strain FMU019 complete genome 257_________............24657
AY206391.1 Hepatitis B virus strain FMU020 complete genome 237......a..............25795
AY206391.1 Hepatitis B virus strain FMU020 complete genome 257_________............24657
AY206392.1 Hepatitis B virus strain FMU021 complete genome 237......a..............25795
AY206392.1 Hepatitis B virus strain FMU021 complete genome 257_________............24657
AY206393.1 Hepatitis B virus strain FMU022 complete genome 237......a..............25795
AY206393.1 Hepatitis B virus strain FMU022 complete genome 257_________............24657
AY220697.1 Hepatitis B virus strain GYF634, complete genome 237......a..............25795
AY220697.1 Hepatitis B virus strain GYF634, complete genome 257_________............24657
AY220698.1 Hepatitis B virus strain 536207, complete genome 237......a..............25795
AY220698.1 Hepatitis B virus strain 536207, complete genome 257_________............24657
AY220699.1 Hepatitis B virus strain MH15, complete genome 237......a..............25795
AY220699.1 Hepatitis B virus strain MH15, complete genome 257_________............24657
AY220700.1 Hepatitis B virus strain MH534978, complete genome 237......a..............25795
AY220700.1 Hepatitis B virus strain MH534978, complete genome 257_________............24657
AY220701.1 Hepatitis B virus strain WJQ310, complete genome 237......a..............25795
AY220701.1 Hepatitis B virus strain WJQ310, complete genome 257_________............24657
AY220702.1 Hepatitis B virus strain WJQ650, complete genome 237......a..............25795
AY220702.1 Hepatitis B virus strain WJQ650, complete genome 257_________............24657
AY220703.1 Hepatitis B virus strain WZJ319, complete genome 237......a..............25795
AY220703.1 Hepatitis B virus strain WZJ319, complete genome 257_________............24657
AY220704.1 Hepatitis B virus strain WZJ942, complete genome 237......a..............25795
AY220704.1 Hepatitis B virus strain WZJ942, complete genome 257_________............24657
AY306136.1 Hepatitis B virus isolate H85, complete genome 235......a..............25595
AY306136.1 Hepatitis B virus isolate H85, complete genome 255_________............24457
AY167089.1 Hepatitis B virus isolate Ia, complete genome 235......a..............25595
AY167089.1 Hepatitis B virus isolate Ia, complete genome 255_________............24457
AY167090.1 Hepatitis B virus isolate Ib, complete genome 235......a..............25595
AY167090.1 Hepatitis B virus isolate Ib, complete genome 255_________............24457
AY167091.1 Hepatitis B virus isolate Ic, complete genome 235......a..............25595
AY167091.1 Hepatitis B virus isolate Ic, complete genome 255_________............24457
AY167092.1 Hepatitis B virus isolate Id, complete genome 199......a..............21995
AY167092.1 Hepatitis B virus isolate Id, complete genome 219_________............20857
AY167093.1 Hepatitis B virus isolate IIa, complete genome 235......a..............25595
AY167093.1 Hepatitis B virus isolate IIa, complete genome 255_________............24457
AY167094.1 Hepatitis B virus isolate IIb, complete genome 235......a..............25595
AY167094.1 Hepatitis B virus isolate IIb, complete genome 255_________............24457
AY167095.1 Hepatitis B virus isolate IIc, complete genome 235......a..............25595
AY167095.1 Hepatitis B virus isolate IIc, complete genome 255_________............24457
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 235......a..............25595
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 255_________............24457
AY167097.1 Hepatitis B virus isolate IIIb, complete genome 235......a..............25595
AY167097.1 Hepatitis B virus isolate IIIb, complete genome 255_________............24457
AY167098.1 Hepatitis B virus isolate IVa, complete genome 235......a..............25595
AY167098.1 Hepatitis B virus isolate IVa, complete genome 255_________............24457
AY167100.1 Hepatitis B virus isolate Va, complete genome 235......a..............25595
AY167100.1 Hepatitis B virus isolate Va, complete genome 255_________............24457
AY167101.1 Hepatitis B virus isolate Vb, complete genome 235......a..............25595
AY167101.1 Hepatitis B virus isolate Vb, complete genome 255_________............24457
AY167102.1 Hepatitis B virus isolate Vc, complete genome 235......a..............25595
AY167102.1 Hepatitis B virus isolate Vc, complete genome 255_________............24457
AY330913.1 Hepatitis B virus isolate Tamang complete genome 235......a..............25595
AY330913.1 Hepatitis B virus isolate Tamang complete genome 255_________............24457
AY330915.1 Hepatitis B virus isolate Happy complete genome 235......a..............25595
AY330915.1 Hepatitis B virus isolate Happy complete genome 255_________............24457
AY330917.1 Hepatitis B virus isolate Crazywoman complete genome 235...t.................25595
AY330917.1 Hepatitis B virus isolate Crazywoman complete genome 255_________............24457
AB115551.1 Hepatitis B virus DNA, complete genome, isolate:HBV-CB15 235......a..............25595
AB115551.1 Hepatitis B virus DNA, complete genome, isolate:HBV-CB15 255_________............24457
AB105172.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 2 235......a..............25595
AB105172.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 2 255_________............24457
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 16235......a..............25595
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 16255_________............24457
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 60235......a..............25595
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 60255_________............24457
AY179734.1 Hepatitis B virus genotype F isolate BA9, complete genome 235......a..............25595
AY179734.1 Hepatitis B virus genotype F isolate BA9, complete genome 255_________............24457
AY179735.1 Hepatitis B virus genotype F isolate BA10, complete genome 235......a..............25595
AY179735.1 Hepatitis B virus genotype F isolate BA10, complete genome 255_________............24457
AY373431.1 Hepatitis B virus clone SWT.4 complete genome 235..a..................25595
AY373431.1 Hepatitis B virus clone SWT.4 complete genome 255_________............24457
AB106884.1 Hepatitis B virus DNA, complete genome, strain:HBV-Ya14 235......a..............25595
AB106884.1 Hepatitis B virus DNA, complete genome, strain:HBV-Ya14 255_________............24457
AB106885.1 Hepatitis B virus DNA, complete genome, strain:HBV-YA34 235......a..............25595
AB106885.1 Hepatitis B virus DNA, complete genome, strain:HBV-YA34 255_________............24457
AY311369.1 Hepatitis B virus isolate BD4139, complete genome 235......a..............25595
AY311369.1 Hepatitis B virus isolate BD4139, complete genome 255_________............24457
AY311370.1 Hepatitis B virus isolate BD14999, complete genome 235......a..............25595
AY311370.1 Hepatitis B virus isolate BD14999, complete genome 255_________............24457
AY293309.1 Hepatitis B virus strain Whutj-37, complete genome 2077......a..............209795
AY293309.1 Hepatitis B virus strain Whutj-37, complete genome 2097_________............208657
AY236161.1 Hepatitis B virus isolate 12A, complete genome 1597..................t..161795
AB111112.1 Hepatitis B virus DNA, complete genome, clone: HS-0 235......a..............25595
AB111112.1 Hepatitis B virus DNA, complete genome, clone: HS-0 255_________............24457
AB111113.1 Hepatitis B virus DNA, complete genome, clone: HS-6 235......a..............25595
AB111113.1 Hepatitis B virus DNA, complete genome, clone: HS-6 255_________............24457
AB111115.1 Hepatitis B virus DNA, complete genome, clone: K5-0 174......a..............19495
AB111115.1 Hepatitis B virus DNA, complete genome, clone: K5-0 194_________............18357
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 174......a..............19495
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 194_________............18357
AB111117.1 Hepatitis B virus DNA, complete genome, clone: K5-13 187......a..............20795
AB111117.1 Hepatitis B virus DNA, complete genome, clone: K5-13 207_________............19657
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 312......a..............33295
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 332_________............32157
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 235......a..............25595
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 255_________............24457
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 235......a..............25595
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 255_________............24457
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 235......a..............25595
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 255_________............24457
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 235......a..............25595
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 255_________............24457
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 235......a..............25595
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 255_________............24457
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 235......a..............25595
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 255_________............24457
AB115418.1 Hepatitis B virus DNA, complete genome, with deletion in Pre-S2 190......a..............21095
AB115418.1 Hepatitis B virus DNA, complete genome, with deletion in Pre-S2 210_________............19957
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 235......a..............25595
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 255_________............24457
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 235......a..............25595
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 255_________............24457
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 235......a..............25595
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 255_________............24457
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 226......a..............24695
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 246_________............23557
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 235......a..............25595
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 255_________............24457
AB112472.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH124 235......a..............25595
AB112472.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH124 255_________............24457
AY518556.1 Hepatitis B virus isolate 57-1 subtype adw, complete genome 235......a..............25595
AY518556.1 Hepatitis B virus isolate 57-1 subtype adw, complete genome 255_________............24457
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 235......a..............25595
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 255_________............24457
AB117759.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB14 235......a..............25595
AB117759.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB14 255_________............24457
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 235......a..............25595
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 255_________............24457
AB106895.1 Hepatitis B virus DNA, complete genome, isolate:pHB4-4 235......a..............25595
AB106895.1 Hepatitis B virus DNA, complete genome, isolate:pHB4-4 255_________............24457
AB116549.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM5 235......a..............25595
AB116549.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM5 255_________............24457
AB116550.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM6 235......a..............25595
AB116550.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM6 255_________............24457
AB116551.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ2 235......a..............25595
AB116551.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ2 255_________............24457
AB116552.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ4 235......a..............25595
AB116552.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ4 255_________............24457
AB116654.1 Hepatitis B virus DNA, complete genome, clone:JPNTAKA 235......a..............25595
AB116654.1 Hepatitis B virus DNA, complete genome, clone:JPNTAKA 255_________............24457
AY596102.1 Hepatitis B virus isolate Ia-1, complete genome 235......a..............25595
AY596102.1 Hepatitis B virus isolate Ia-1, complete genome 255_________............24457
AY596103.1 Hepatitis B virus isolate Ia-2, complete genome 235......a..............25595
AY596103.1 Hepatitis B virus isolate Ia-2, complete genome 255_________............24457
AY596104.1 Hepatitis B virus isolate Ia-4, complete genome 235......a..............25595
AY596104.1 Hepatitis B virus isolate Ia-4, complete genome 255_________............24457
AY596105.1 Hepatitis B virus isolate Ia-5, complete genome 235......a..............25595
AY596105.1 Hepatitis B virus isolate Ia-5, complete genome 255_________............24457
AY596106.1 Hepatitis B virus isolate Ia-6, complete genome 235......a..............25595
AY596106.1 Hepatitis B virus isolate Ia-6, complete genome 255_________............24457
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 235......a..............25595
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 255_________............24457
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 235......a..............25595
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 255_________............24457
AY596109.1 Hepatitis B virus isolate II-1, complete genome 235......a..............25595
AY596109.1 Hepatitis B virus isolate II-1, complete genome 255_________............24457
AY596110.1 Hepatitis B virus isolate II-2, complete genome 235......a..............25595
AY596110.1 Hepatitis B virus isolate II-2, complete genome 255_________............24457
AY596111.1 Hepatitis B virus isolate Ia-3, complete genome 235......a..............25595
AY596111.1 Hepatitis B virus isolate Ia-3, complete genome 255_________............24457
AY596112.1 Hepatitis B virus isolate Ia-7, complete genome 235......a..............25595
AY596112.1 Hepatitis B virus isolate Ia-7, complete genome 255_________............24457
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 235......a..............25595
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 255_________............24457
AB176643.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NK1 179......a..............19995
AB176643.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NK1 199_________............18857
AY741798.1 Hepatitis B virus isolate IR-IPI-P4, complete genome 237......a..............25795
AY741798.1 Hepatitis B virus isolate IR-IPI-P4, complete genome 257_________............24657
AY766463.1 Hepatitis B virus strain GDH1 from China, complete genome 235......a..............25595
AY766463.1 Hepatitis B virus strain GDH1 from China, complete genome 255_________............24457
AY781177.1 Hepatitis B virus strain BG21, complete genome 235......a..............25595
AY781177.1 Hepatitis B virus strain BG21, complete genome 255_________............24457
AY781178.1 Hepatitis B virus strain G12, complete genome 235......a..............25595
AY781178.1 Hepatitis B virus strain G12, complete genome 255_________............24457
AY781179.1 Hepatitis B virus strain GIII_14, complete genome 235......a..............25595
AY781179.1 Hepatitis B virus strain GIII_14, complete genome 255_________............24457
AY781181.1 Hepatitis B virus strain GIII_16, complete genome 235......a..............25595
AY781181.1 Hepatitis B virus strain GIII_16, complete genome 255_________............24457
AY781182.1 Hepatitis B virus strain GIII_17, complete genome 235......a..............25595
AY781182.1 Hepatitis B virus strain GIII_17, complete genome 255_________............24457
AY781183.1 Hepatitis B virus strain GII_11, complete genome 235......a..............25595
AY781183.1 Hepatitis B virus strain GII_11, complete genome 255_________............24457
AY781187.1 Hepatitis B virus strain SG_III, complete genome 235......a..............25595
AY781187.1 Hepatitis B virus strain SG_III, complete genome 255_________............24457
AY641558.1 Hepatitis B virus isolate He74, complete genome 235......a..............25595
AY641558.1 Hepatitis B virus isolate He74, complete genome 255_________............24457
AY641559.1 Hepatitis B virus isolate He53, complete genome 235......a..............25595
AY641559.1 Hepatitis B virus isolate He53, complete genome 255_________............24457
AY641560.1 Hepatitis B virus isolate He100, complete genome 235......a..............25595
AY641560.1 Hepatitis B virus isolate He100, complete genome 255_________............24457
AY641561.1 Hepatitis B virus isolate He127, complete genome 235......a..............25595
AY641561.1 Hepatitis B virus isolate He127, complete genome 255_________............24457
AY641562.1 Hepatitis B virus isolate He82, complete genome 235......a..............25595
AY641562.1 Hepatitis B virus isolate He82, complete genome 255_________............24457
AY641563.1 Hepatitis B virus isolate He52, complete genome 235......a..............25595
AY641563.1 Hepatitis B virus isolate He52, complete genome 255_________............24457
AY800389.1 Hepatitis B virus isolate ZY041024, complete genome 235......a..............25595
AY800389.1 Hepatitis B virus isolate ZY041024, complete genome 255_________............24457
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 235......a..............25595
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 255_________............24457
AY800391.1 Hepatitis B virus isolate ZY041026, complete genome 235......a..............25595
AY800391.1 Hepatitis B virus isolate ZY041026, complete genome 255_________............24457
AY800392.1 Hepatitis B virus isolate ZY041027, complete genome 235......a..............25595
AY800392.1 Hepatitis B virus isolate ZY041027, complete genome 255_________............24457
AB113875.1 Hepatitis B virus DNA, complete genome, strain:HCC-1-MC 235......a..............25595
AB113875.1 Hepatitis B virus DNA, complete genome, strain:HCC-1-MC 255_________............24457
AB113876.1 Hepatitis B virus DNA, complete genome, strain:HCC-2-NY 235......a..............25595
AB113876.1 Hepatitis B virus DNA, complete genome, strain:HCC-2-NY 255_________............24457
AB113877.1 Hepatitis B virus DNA, complete genome, strain:HCC-3-TT 235......a..............25595
AB113877.1 Hepatitis B virus DNA, complete genome, strain:HCC-3-TT 255_________............24457
AB113878.1 Hepatitis B virus DNA, complete genome, strain:Ehime-Lam-MM1-001208 235......a..............25595
AB113878.1 Hepatitis B virus DNA, complete genome, strain:Ehime-Lam-MM1-001208 255_________............24457
AB113879.1 Hepatitis B virus DNA, complete genome, strain:AH-1-ON980424 235......a..............25595
AB113879.1 Hepatitis B virus DNA, complete genome, strain:AH-1-ON980424 255_________............24457
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 235......a..............25595
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 255_________............24457
AB198077.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.2 235......a..............25595
AB198077.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.2 255_________............24457
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 235......a..............25595
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 255_________............24457
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 235......a..............25595
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 255_________............24457
AB198080.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.5 235......a..............25595
AB198080.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.5 255_________............24457
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 235......a..............25595
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 255_________............24457
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 235......a..............25595
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 255_________............24457
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 235......a..............25595
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 255_________............24457
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 235......a..............25595
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 255_________............24457
AY738139.1 Hepatitis B virus clone A1, complete genome 235......a..............25595
AY738139.1 Hepatitis B virus clone A1, complete genome 255_________............24457
AY738140.1 Hepatitis B virus clone A2, complete genome 235......a..............25595
AY738140.1 Hepatitis B virus clone A2, complete genome 255_________............24457
AY738141.1 Hepatitis B virus clone A3, complete genome 235......a..............25595
AY738141.1 Hepatitis B virus clone A3, complete genome 255_________............24457
AY738142.1 Hepatitis B virus clone A4, complete genome 235......a..............25595
AY738142.1 Hepatitis B virus clone A4, complete genome 255_________............24457
AY738143.1 Hepatitis B virus clone A11, complete genome 235......a..............25595
AY738143.1 Hepatitis B virus clone A11, complete genome 255_________............24457
AB188244.1 Hepatitis B virus DNA, complete genome, isolate:UZ24 235.......a.............25595
AB188244.1 Hepatitis B virus DNA, complete genome, isolate:UZ24 255_________............24457
AJ748098.1 Hepatitis B virus complete genome, genotype C 235......a..............25595
AJ748098.1 Hepatitis B virus complete genome, genotype C 255_________............24457
AB205119.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-1 235......a..............25595
AB205119.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-1 255_________............24457
AB205120.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-2 235......a..............25595
AB205120.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-2 255_________............24457
AB205121.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF720-1 235..........c..........25595
AB205122.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH69-1 235......a..............25595
AB205122.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH69-1 255_________............24457
AB205123.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CN578-1 235......a..............25595
AB205123.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CN578-1 255_________............24457
AB205124.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ3-1-1 235......a..............25595
AB205124.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ3-1-1 255_________............24457
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 235......a..............25595
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 255_________............24457
AY934771.1 Hepatitis B virus isolate 27439, complete genome 235......t..............25595
AY934771.1 Hepatitis B virus isolate 27439, complete genome 255_________............24457
AB212625.1 Hepatitis B virus DNA, complete genome, isolateVT1026 235......a..............25595
AB212625.1 Hepatitis B virus DNA, complete genome, isolateVT1026 255_________............24457
AB212626.1 Hepatitis B virus DNA, complete genome, isolateVT1022 235......a..............25595
AB212626.1 Hepatitis B virus DNA, complete genome, isolateVT1022 255_________............24457
AB214516.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BL597 235......a..............25595
AB214516.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BL597 255_________............24457
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 202......a..............22295
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 222_________............21157
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 235......a..............25595
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 255_________............24457
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 235......a..............25595
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 255_________............24457
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 235......a..............25595
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 255_________............24457
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 235......a..............25595
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 255_________............24457
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 235......a..............25595
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 255_________............24457
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 235......a..............25595
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 255_________............24457
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 235......a..............25595
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 255_________............24457
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 235......a..............25595
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 255_________............24457
DQ089765.1 Hepatitis B virus isolate HK428, complete genome 235......a..............25595
DQ089765.1 Hepatitis B virus isolate HK428, complete genome 255_________............24457
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 235......a..............25595
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 255_________............24457
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 235......a..............25595
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 255_________............24457
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 235......a..............25595
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 255_________............24457
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 235......a..............25595
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 255_________............24457
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 235......a..............25595
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 255_________............24457
DQ089771.1 Hepatitis B virus isolate HK1629, complete genome 235......a..............25595
DQ089771.1 Hepatitis B virus isolate HK1629, complete genome 255_________............24457
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 235......a..............25595
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 255_________............24457
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 235......a..............25595
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 255_________............24457
DQ089774.1 Hepatitis B virus isolate HK858, complete genome 235......a..............25595
DQ089774.1 Hepatitis B virus isolate HK858, complete genome 255_________............24457
DQ089775.1 Hepatitis B virus isolate HK290, complete genome 235......a..............25595
DQ089775.1 Hepatitis B virus isolate HK290, complete genome 255_________............24457
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 235......a..............25595
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 255_________............24457
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 235......a..............25595
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 255_________............24457
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 235......a..............25595
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 255_________............24457
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 235......a..............25595
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 255_________............24457
DQ089780.1 Hepatitis B virus isolate HK947, complete genome 235......a..............25595
DQ089780.1 Hepatitis B virus isolate HK947, complete genome 255_________............24457
DQ089781.1 Hepatitis B virus isolate HK1476, complete genome 235......a..............25595
DQ089781.1 Hepatitis B virus isolate HK1476, complete genome 255_________............24457
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 235......a..............25595
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 255_________............24457
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 235......a..............25595
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 255_________............24457
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 235......a..............25595
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 255_________............24457
DQ089785.1 Hepatitis B virus isolate HK1386, complete genome 235......a..............25595
DQ089785.1 Hepatitis B virus isolate HK1386, complete genome 255_________............24457
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 235......a..............25595
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 255_________............24457
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 235......a..............25595
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 255_________............24457
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 235......a..............25595
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 255_________............24457
DQ089790.1 Hepatitis B virus isolate HK1248, complete genome 235......a..............25595
DQ089790.1 Hepatitis B virus isolate HK1248, complete genome 255_________............24457
DQ089791.1 Hepatitis B virus isolate HK1205, complete genome 235......a..............25595
DQ089791.1 Hepatitis B virus isolate HK1205, complete genome 255_________............24457
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 235......a..............25595
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 255_________............24457
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 235......a..............25595
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 255_________............24457
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 188......a..............20895
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 208_________............19757
DQ089795.1 Hepatitis B virus isolate HK1465, complete genome 235......a..............25595
DQ089795.1 Hepatitis B virus isolate HK1465, complete genome 255_________............24457
DQ089796.1 Hepatitis B virus isolate HK751, complete genome 235......a..............25595
DQ089796.1 Hepatitis B virus isolate HK751, complete genome 255_________............24457
DQ089797.1 Hepatitis B virus isolate HK1169, complete genome 235......a..............25595
DQ089797.1 Hepatitis B virus isolate HK1169, complete genome 255_________............24457
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 235......a..............25595
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 255_________............24457
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 235......a..............25595
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 255_________............24457
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 196......a..............21695
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 216_________............20557
DQ089801.1 Hepatitis B virus isolate HK2100, complete genome 235......a..............25595
DQ089801.1 Hepatitis B virus isolate HK2100, complete genome 255_________............24457
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 235......a..............25595
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 255_________............24457
DQ089804.1 Hepatitis B virus isolate HK262, complete genome 235......a..............25595
DQ089804.1 Hepatitis B virus isolate HK262, complete genome 255_________............24457
DQ111986.1 Hepatitis B virus isolate MBT181, complete genome 235.......a.............25595
DQ111986.1 Hepatitis B virus isolate MBT181, complete genome 255_________............24457
AY862869.1 Hepatitis B virus clone Q80, complete genome 235......a..............25595
AY862869.1 Hepatitis B virus clone Q80, complete genome 255_________............24457
AB231909.1 Hepatitis B virus DNA, complete genome, isolate:VH10 235......a..............25595
AB231909.1 Hepatitis B virus DNA, complete genome, isolate:VH10 255_________............24457
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 2051......a..............207195
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 2071_________............206057
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 2033......a..............205395
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 2053_________............204257
AB188243.2 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA27 235...........a.........25595
DQ246215.1 Hepatitis B virus isolate GZ-DYH, complete genome 235......a..............25595
DQ246215.1 Hepatitis B virus isolate GZ-DYH, complete genome 255_________............24457
AB182589.1 Hepatitis B virus DNA, complete genome, isolate:CH:Mat-Ko 235......a..............25595
AB182589.1 Hepatitis B virus DNA, complete genome, isolate:CH:Mat-Ko 255_________............24457
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 214......a..............23495
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 234_________............22357
DQ361535.1 Hepatitis B virus isolate CRP-228, complete genome 205......a..............22595
DQ361535.1 Hepatitis B virus isolate CRP-228, complete genome 225_________............21457
DQ377158.1 Hepatitis B virus isolate WJT31, complete genome 235......a..............25595
DQ377158.1 Hepatitis B virus isolate WJT31, complete genome 255_________............24457
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 235......a..............25595
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 255_________............24457
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 235......a..............25595
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 255_________............24457
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 235......a..............25595
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 255_________............24457
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 235......a..............25595
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 255_________............24457
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 235......a..............25595
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 255_________............24457
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 235......a..............25595
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 255_________............24457
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 235......a..............25595
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 255_________............24457
DQ315782.1 Hepatitis B virus isolate EI0423, complete genome 226......a..............24695
DQ315782.1 Hepatitis B virus isolate EI0423, complete genome 246_________............23557
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 235......a..............25595
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 255_________............24457
AB250109.1 Hepatitis B virus DNA, complete genome, isolate: IH030213 185......a..............20595
AB250109.1 Hepatitis B virus DNA, complete genome, isolate: IH030213 205_________............19457
AB205152.1 Hepatitis B virus DNA, complete genome, isolate: HB-JFH7-99 235......a..............25595
AB205152.1 Hepatitis B virus DNA, complete genome, isolate: HB-JFH7-99 255_________............24457
AB219426.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4014, PNN1 235......a..............25595
AB219426.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4014, PNN1 255_________............24457
AB219427.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4075, PNN2 235......a..............25595
AB219427.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4075, PNN2 255_________............24457
AB219428.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4076, PNN3 235......a..............25595
AB219428.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4076, PNN3 255_________............24457
AB219429.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4101, PNN4 235......a..............25595
AB219429.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4101, PNN4 255_________............24457
AB219430.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4148, PNN5 235......a..............25595
AB219430.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4148, PNN5 255_________............24457
AB222714.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7 235......a..............25595
AB222714.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7 255_________............24457
AB222715.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7M 235......a..............25595
AB222715.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7M 255_________............24457
DQ448619.1 Hepatitis B virus isolate GZ-DYH, complete genome 235......a..............25595
DQ448619.1 Hepatitis B virus isolate GZ-DYH, complete genome 255_________............24457
DQ448620.1 Hepatitis B virus isolate GZ-DYF, complete genome 235......a..............25595
DQ448620.1 Hepatitis B virus isolate GZ-DYF, complete genome 255_________............24457
DQ448621.1 Hepatitis B virus isolate GZ-HQY, complete genome 235......a..............25595
DQ448621.1 Hepatitis B virus isolate GZ-HQY, complete genome 255_________............24457
DQ448622.1 Hepatitis B virus isolate GZ-JSM, complete genome 235......a..............25595
DQ448622.1 Hepatitis B virus isolate GZ-JSM, complete genome 255_________............24457
DQ448623.1 Hepatitis B virus isolate GZ-LMX, complete genome 235......a..............25595
DQ448623.1 Hepatitis B virus isolate GZ-LMX, complete genome 255_________............24457
DQ448624.1 Hepatitis B virus isolate GZ-QSA, complete genome 235......a..............25595
DQ448624.1 Hepatitis B virus isolate GZ-QSA, complete genome 255_________............24457
DQ448625.1 Hepatitis B virus isolate GZ-TXB, complete genome 235......a..............25595
DQ448625.1 Hepatitis B virus isolate GZ-TXB, complete genome 255_________............24457
DQ448626.1 Hepatitis B virus isolate GZ-XLB, complete genome 235......a..............25595
DQ448626.1 Hepatitis B virus isolate GZ-XLB, complete genome 255_________............24457
DQ448627.1 Hepatitis B virus isolate GZ-ZFL, complete genome 235......a..............25595
DQ448627.1 Hepatitis B virus isolate GZ-ZFL, complete genome 255_________............24457
DQ448628.1 Hepatitis B virus isolate GZ-ZX, complete genome 235......a..............25595
DQ448628.1 Hepatitis B virus isolate GZ-ZX, complete genome 255_________............24457
DQ463795.1 Hepatitis B virus isolate 928-9_2004, complete genome 235..c..................25595
DQ463795.1 Hepatitis B virus isolate 928-9_2004, complete genome 255_________............24457
DQ463799.1 Hepatitis B virus isolate 539-16_2004, complete genome 235......a..............25595
DQ463799.1 Hepatitis B virus isolate 539-16_2004, complete genome 255_________............24457
DQ478885.1 Hepatitis B virus isolate CHN-D12, complete genome 235......a..............25595
DQ478885.1 Hepatitis B virus isolate CHN-D12, complete genome 255_________............24457
DQ478899.1 Hepatitis B virus isolate CHN-D20, complete genome 235......a..............25595
DQ478899.1 Hepatitis B virus isolate CHN-D20, complete genome 255_________............24457
DQ478900.1 Hepatitis B virus isolate CHN-H172, complete genome 235......a..............25595
DQ478900.1 Hepatitis B virus isolate CHN-H172, complete genome 255_________............24457
DQ478901.1 Hepatitis B virus isolate CHN-H155, complete genome 235......a..............25595
DQ478901.1 Hepatitis B virus isolate CHN-H155, complete genome 255_________............24457
DQ486021.1 Hepatitis B virus isolate LT13, complete genome 1597..........t..........161795
DQ486024.1 Hepatitis B virus isolate LT9, complete genome 1597..........t..........161795
AB241109.1 Hepatitis B virus DNA, complete genome, isolate:PhCH24 235......a..............25595
AB241109.1 Hepatitis B virus DNA, complete genome, isolate:PhCH24 255_________............24457
AB241110.1 Hepatitis B virus DNA, complete genome, isolate:PhLC03 235......a..............25595
AB241110.1 Hepatitis B virus DNA, complete genome, isolate:PhLC03 255_________............24457
AB241111.1 Hepatitis B virus DNA, complete genome, isolate:PhLC14 235......a..............25595
AB241111.1 Hepatitis B virus DNA, complete genome, isolate:PhLC14 255_________............24457
AB241112.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC15 181......a..............20195
AB241112.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC15 201_________............19057
AB241113.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC13 181......a..............20195
AB241113.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC13 201_________............19057
AB241116.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC03 200......a..............22095
AB241116.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC03 220_________............20957
AB241117.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC05 235......a..............25595
AB241117.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC05 255_________............24457
DQ536410.1 Hepatitis B virus isolate JeF339 clone JeF339U-3, complete genome 235......a..............25595
DQ536410.1 Hepatitis B virus isolate JeF339 clone JeF339U-3, complete genome 255_________............24457
DQ536411.1 Hepatitis B virus isolate JeF339 clone JeF339U-1, complete genome 235......a..............25595
DQ536411.1 Hepatitis B virus isolate JeF339 clone JeF339U-1, complete genome 255_________............24457
DQ536412.1 Hepatitis B virus isolate JeF339 clone JeF339U-2, complete genome 235......a..............25595
DQ536412.1 Hepatitis B virus isolate JeF339 clone JeF339U-2, complete genome 255_________............24457
DQ683578.1 Hepatitis B virus from South Korea, complete genome 235......a..............25595
DQ683578.1 Hepatitis B virus from South Korea, complete genome 255_________............24457
AM184125.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate O64 235......a..............25595
AM184125.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate O64 255_________............24457
DQ904357.1 Hepatitis B virus strain A0004 from China, complete genome 237......a..............25795
DQ904357.1 Hepatitis B virus strain A0004 from China, complete genome 257_________............24657
DQ922649.1 Hepatitis B virus strain B0024, complete genome 237......a..............25795
DQ922649.1 Hepatitis B virus strain B0024, complete genome 257_________............24657
DQ922650.1 Hepatitis B virus strain C0955, complete genome 237......a..............25795
DQ922650.1 Hepatitis B virus strain C0955, complete genome 257_________............24657
DQ922651.1 Hepatitis B virus strain F0691, complete genome 237......a..............25795
DQ922651.1 Hepatitis B virus strain F0691, complete genome 257_________............24657
DQ975271.1 Hepatitis B virus strain B0641, complete genome 237......a..............25795
DQ975271.1 Hepatitis B virus strain B0641, complete genome 257_________............24657
DQ975272.1 Hepatitis B virus strain C1248, complete genome 237......a..............25795
DQ975272.1 Hepatitis B virus strain C1248, complete genome 257_________............24657
DQ975273.1 Hepatitis B virus strain e1013, complete genome 237......a..............25795
DQ975273.1 Hepatitis B virus strain e1013, complete genome 257_________............24657
DQ975274.1 Hepatitis B virus strain F0885, complete genome 237......a..............25795
DQ975274.1 Hepatitis B virus strain F0885, complete genome 257_________............24657
DQ993181.1 Hepatitis B virus strain A0583, complete genome 237......a..............25795
DQ993181.1 Hepatitis B virus strain A0583, complete genome 257_________............24657
DQ980547.1 Hepatitis B virus strain E0113, complete genome 237......a..............25795
DQ980547.1 Hepatitis B virus strain E0113, complete genome 257_________............24657
DQ980548.1 Hepatitis B virus strain C1198, complete genome 237......a..............25795
DQ980548.1 Hepatitis B virus strain C1198, complete genome 257_________............24657
DQ980549.1 Hepatitis B virus strain B0949, complete genome 204......a..............22495
DQ980549.1 Hepatitis B virus strain B0949, complete genome 224_________............21357
DQ980550.1 Hepatitis B virus strain B0206, complete genome 180......a..............20095
DQ980550.1 Hepatitis B virus strain B0206, complete genome 200_________............18957
DQ980551.1 Hepatitis B virus strain A0712, complete genome 204......a..............22495
DQ980551.1 Hepatitis B virus strain A0712, complete genome 224_________............21357
DQ899142.1 Hepatitis B virus isolate Warao152, complete genome 235......a..............25595
DQ899142.1 Hepatitis B virus isolate Warao152, complete genome 255_________............24457
DQ899143.1 Hepatitis B virus isolate Warao189, complete genome 235......a..............25595
DQ899143.1 Hepatitis B virus isolate Warao189, complete genome 255_________............24457
DQ899144.1 Hepatitis B virus isolate Japreira75, complete genome 235......a..............25595
DQ899144.1 Hepatitis B virus isolate Japreira75, complete genome 255_________............24457
DQ899145.1 Hepatitis B virus isolate Japreira76, complete genome 235......a..............25595
DQ899145.1 Hepatitis B virus isolate Japreira76, complete genome 255_________............24457
DQ899146.1 Hepatitis B virus isolate Japreira80, complete genome 235......a..............25595
DQ899146.1 Hepatitis B virus isolate Japreira80, complete genome 255_________............24457
DQ899147.1 Hepatitis B virus isolate Japreira116, complete genome 235......a..............25595
DQ899147.1 Hepatitis B virus isolate Japreira116, complete genome 255_________............24457
DQ899148.1 Hepatitis B virus isolate Yanomami114, complete genome 235......a..............25595
DQ899148.1 Hepatitis B virus isolate Yanomami114, complete genome 255_________............24457
DQ899149.1 Hepatitis B virus isolate Piaroa3019, complete genome 235......a..............25595
DQ899149.1 Hepatitis B virus isolate Piaroa3019, complete genome 255_________............24457
DQ899150.1 Hepatitis B virus isolate Colombia8, complete genome 235......a..............25595
DQ899150.1 Hepatitis B virus isolate Colombia8, complete genome 255_________............24457
DQ986375.1 Hepatitis B virus strain 616-93, complete genome 237......a..............25795
DQ986375.1 Hepatitis B virus strain 616-93, complete genome 257_________............24657
AB246339.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN51 235......a..............25595
AB246339.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN51 255_________............24457
AB246340.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN58 235......a..............25595
AB246340.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN58 255_________............24457
AB246341.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN35 235......a..............25595
AB246341.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN35 255_________............24457
AB246342.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN56 235......a..............25595
AB246342.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN56 255_________............24457
AB246343.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN57 235......a..............25595
AB246343.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN57 255_________............24457
AB246344.1 Hepatitis B virus DNA, complete genome, clone: C_JPN22 235......a..............25595
AB246344.1 Hepatitis B virus DNA, complete genome, clone: C_JPN22 255_________............24457
AB246345.1 Hepatitis B virus DNA, complete genome, clone: C_JPNAT 235......a..............25595
AB246345.1 Hepatitis B virus DNA, complete genome, clone: C_JPNAT 255_________............24457
AB246346.1 Hepatitis B virus DNA, complete genome, clone: C_HK74 235......a..............25595
AB246346.1 Hepatitis B virus DNA, complete genome, clone: C_HK74 255_________............24457
DQ995801.1 Hepatitis B virus isolate H60-6, complete genome 235......a..............25595
DQ995801.1 Hepatitis B virus isolate H60-6, complete genome 255_________............24457
DQ995802.1 Hepatitis B virus isolate H293-16, complete genome 235......a..............25595
DQ995802.1 Hepatitis B virus isolate H293-16, complete genome 255_________............24457
DQ995803.1 Hepatitis B virus isolate C265-15, complete genome 235......a..............25595
DQ995803.1 Hepatitis B virus isolate C265-15, complete genome 255_________............24457
DQ995804.1 Hepatitis B virus isolate C1691-11, complete genome 235......a..............25595
DQ995804.1 Hepatitis B virus isolate C1691-11, complete genome 255_________............24457
DQ995805.1 Hepatitis B virus isolate H60-2.5KB, complete genome 182......a..............20295
DQ995805.1 Hepatitis B virus isolate H60-2.5KB, complete genome 202_________............19157
AB288026.1 Hepatitis B virus DNA, complete genome, genotype: C, country: Japan, 235......a..............25595
AB288026.1 Hepatitis B virus DNA, complete genome, genotype: C, country: Japan, 255_________............24457
EF134945.1 Hepatitis B virus isolate G247-B3, complete genome 1630......a..............165095
EF134945.1 Hepatitis B virus isolate G247-B3, complete genome 1650_________............163957
EF134946.1 Hepatitis B virus isolate G247-B5, complete genome 1630......a..............165095
EF134946.1 Hepatitis B virus isolate G247-B5, complete genome 1650_________............163957
AB270548.1 Hepatitis B virus DNA, complete genome, isolate: MGL207F 235...............c.....25595
AB270550.1 Hepatitis B virus DNA, complete genome, isolate: MGL247F 235.......a.............25595
AB270550.1 Hepatitis B virus DNA, complete genome, isolate: MGL247F 255_________............24457
DQ890381.1 Hepatitis B virus strain S40U, complete genome 235......a..............25595
DQ890381.1 Hepatitis B virus strain S40U, complete genome 255_________............24457
EF536065.1 Hepatitis B virus strain XZK pre-t, complete genome 237......a..............25795
EF536065.1 Hepatitis B virus strain XZK pre-t, complete genome 257_________............24657
EF536066.1 Mutant Hepatitis B virus strain XZK t-w128, complete genome 237......a..............25795
EF536066.1 Mutant Hepatitis B virus strain XZK t-w128, complete genome 257_________............24657
AB195930.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-1 235......a..............25595
AB195930.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-1 255_________............24457
AB195931.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-2 235......a..............25595
AB195931.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-2 255_________............24457
AB195932.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-3 235......a..............25595
AB195932.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-3 255_________............24457
AB195933.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-1 235......a..............25595
AB195933.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-1 255_________............24457
AB195934.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-2 235......a..............25595
AB195934.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-2 255_________............24457
AB195935.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-3 235......a..............25595
AB195935.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-3 255_________............24457
AB195936.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-1 235......a..............25595
AB195936.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-1 255_________............24457
AB195937.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-2 235......a..............25595
AB195937.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-2 255_________............24457
AB195938.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-3 235......a..............25595
AB195938.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-3 255_________............24457
AB195939.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-1 235......a..............25595
AB195939.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-1 255_________............24457
AB195940.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-2 235......a..............25595
AB195940.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-2 255_________............24457
AB195941.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-3 235......a..............25595
AB195941.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-3 255_________............24457
AB195942.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-1 235......a..............25595
AB195942.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-1 255_________............24457
AB195943.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-2 235......a..............25595
AB195943.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-2 255_________............24457
AB195944.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-3 235......a..............25595
AB195944.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-3 255_________............24457
AB195945.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-1 235......a..............25595
AB195945.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-1 255_________............24457
AB195946.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-2 190......a..............21095
AB195946.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-2 210_________............19957
AB195947.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-1 235......a..............25595
AB195947.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-1 255_________............24457
AB195948.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-2 235......a..............25595
AB195948.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-2 255_________............24457
AB195949.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-1 235......a..............25595
AB195949.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-1 255_________............24457
AB195950.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-2 235......a..............25595
AB195950.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-2 255_________............24457
AB195951.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-3 235......a..............25595
AB195951.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-3 255_________............24457
AB195952.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-1 235......a..............25595
AB195952.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-1 255_________............24457
AB195953.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-2 235......a..............25595
AB195953.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-2 255_________............24457
AB195954.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-3 235......a..............25595
AB195954.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-3 255_________............24457
AB195955.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-1 235......a..............25595
AB195955.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-1 255_________............24457
AB195956.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-2 235......a..............25595
AB195956.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-2 255_________............24457
AB195957.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-3 235......a..............25595
AB195957.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-3 255_________............24457
DQ993680.1 Hepatitis B virus isolate patient 268, complete genome 235......a..............25595
DQ993680.1 Hepatitis B virus isolate patient 268, complete genome 255_________............24457
DQ993681.1 Hepatitis B virus isolate patient 290, complete genome 235......a..............25595
DQ993681.1 Hepatitis B virus isolate patient 290, complete genome 255_________............24457
DQ993682.1 Hepatitis B virus isolate patient 479, complete genome 235......a..............25595
DQ993682.1 Hepatitis B virus isolate patient 479, complete genome 255_________............24457
DQ993683.1 Hepatitis B virus isolate patient 82, complete genome 235......a..............25595
DQ993683.1 Hepatitis B virus isolate patient 82, complete genome 255_________............24457
DQ993684.1 Hepatitis B virus isolate patient 336, complete genome 235......a..............25595
DQ993684.1 Hepatitis B virus isolate patient 336, complete genome 255_________............24457
DQ993685.1 Hepatitis B virus isolate patient 554, complete genome 235......a..............25595
DQ993685.1 Hepatitis B virus isolate patient 554, complete genome 255_________............24457
DQ993686.1 Hepatitis B virus isolate patient 342, complete genome 235......a..............25595
DQ993686.1 Hepatitis B virus isolate patient 342, complete genome 255_________............24457
DQ993688.1 Hepatitis B virus isolate 209-0519-Nature1.2-unSero, complete genome 235......a..............25595
DQ993688.1 Hepatitis B virus isolate 209-0519-Nature1.2-unSero, complete genome 255_________............24457
DQ993689.1 Hepatitis B virus isolate 209-1119-Nature1.1-unSero, complete genome 235......a..............25595
DQ993689.1 Hepatitis B virus isolate 209-1119-Nature1.1-unSero, complete genome 255_________............24457
DQ993690.1 Hepatitis B virus isolate 204-1113-Nature1.1-unSero, complete genome 235......a..............25595
DQ993690.1 Hepatitis B virus isolate 204-1113-Nature1.1-unSero, complete genome 255_________............24457
DQ993691.1 Hepatitis B virus isolate 4007-0803-Nature2.2-unSero, complete genome235......a..............25595
DQ993691.1 Hepatitis B virus isolate 4007-0803-Nature2.2-unSero, complete genome255_________............24457
DQ993692.1 Hepatitis B virus isolate 4007-0810-Nature2.1-unSero, complete genome235......a..............25595
DQ993692.1 Hepatitis B virus isolate 4007-0810-Nature2.1-unSero, complete genome255_________............24457
DQ993693.1 Hepatitis B virus isolate 232-1125-Nature1.1-unSero, complete genome 235......a..............25595
DQ993693.1 Hepatitis B virus isolate 232-1125-Nature1.1-unSero, complete genome 255_________............24457
DQ993696.1 Hepatitis B virus isolate patient 452b1, complete genome 235......a..............25595
DQ993696.1 Hepatitis B virus isolate patient 452b1, complete genome 255_________............24457
DQ993697.1 Hepatitis B virus isolate patient 940b1, complete genome 235......a..............25595
DQ993697.1 Hepatitis B virus isolate patient 940b1, complete genome 255_________............24457
DQ993698.1 Hepatitis B virus isolate 6144-0327-ETCvs3TC-Naive, complete genome 235......a..............25595
DQ993698.1 Hepatitis B virus isolate 6144-0327-ETCvs3TC-Naive, complete genome 255_________............24457
DQ993699.1 Hepatitis B virus isolate 6144-0226-ETCvs3TC-Break, complete genome 235......a..............25595
DQ993699.1 Hepatitis B virus isolate 6144-0226-ETCvs3TC-Break, complete genome 255_________............24457
DQ993700.1 Hepatitis B virus isolate JMY-0725-ETC, complete genome 235......a..............25595
DQ993700.1 Hepatitis B virus isolate JMY-0725-ETC, complete genome 255_________............24457
DQ993701.1 Hepatitis B virus isolate JMY-0210-ETCvs3TC-Brack, complete genome 235......a..............25595
DQ993701.1 Hepatitis B virus isolate JMY-0210-ETCvs3TC-Brack, complete genome 255_________............24457
DQ993702.1 Hepatitis B virus isolate JMY-0919-ETCvs3TC-Naive, complete genome 235......a..............25595
DQ993702.1 Hepatitis B virus isolate JMY-0919-ETCvs3TC-Naive, complete genome 255_________............24457
DQ993703.1 Hepatitis B virus isolate 236-0526-Nature1.2-Sero, complete genome 235......a..............25595
DQ993703.1 Hepatitis B virus isolate 236-0526-Nature1.2-Sero, complete genome 255_________............24457
DQ993704.1 Hepatitis B virus isolate 239-1127-Nature3.1-unSero, complete genome 235......a..............25595
DQ993704.1 Hepatitis B virus isolate 239-1127-Nature3.1-unSero, complete genome 255_________............24457
DQ993705.1 Hepatitis B virus isolate 239-0625-Nature3.4-unSero, complete genome 235......a..............25595
DQ993705.1 Hepatitis B virus isolate 239-0625-Nature3.4-unSero, complete genome 255_________............24457
DQ993706.1 Hepatitis B virus isolate 239-0402-Nature3.3-unSero, complete genome 235......a..............25595
DQ993706.1 Hepatitis B virus isolate 239-0402-Nature3.3-unSero, complete genome 255_________............24457
DQ993707.1 Hepatitis B virus isolate 239-O218-Nature3.2-unSero, complete genome 235......a..............25595
DQ993707.1 Hepatitis B virus isolate 239-O218-Nature3.2-unSero, complete genome 255_________............24457
DQ993708.1 Hepatitis B virus isolate 6136-1228-Naive, complete genome 235......a..............25595
DQ993708.1 Hepatitis B virus isolate 6136-1228-Naive, complete genome 255_________............24457
DQ993709.1 Hepatitis B virus isolate 6136-0127-ETCvs3TC-Break, complete genome 235......a..............25595
DQ993709.1 Hepatitis B virus isolate 6136-0127-ETCvs3TC-Break, complete genome 255_________............24457
DQ993710.1 Hepatitis B virus isolate 6144-0718-ETC, complete genome 235......a..............25595
DQ993710.1 Hepatitis B virus isolate 6144-0718-ETC, complete genome 255_________............24457
DQ993711.1 Hepatitis B virus isolate 221-1120-Nature1.1-unSero, complete genome 235......a..............25595
DQ993711.1 Hepatitis B virus isolate 221-1120-Nature1.1-unSero, complete genome 255_________............24457
EF688062.1 Hepatitis B virus isolate GZ28-1, complete genome 235......a..............25595
EF688062.1 Hepatitis B virus isolate GZ28-1, complete genome 255_________............24457
EF473973.1 Hepatitis B virus isolate EIH45AChinese, complete genome 235......a..............25595
EF473973.1 Hepatitis B virus isolate EIH45AChinese, complete genome 255_________............24457
EF473974.1 Hepatitis B virus isolate EIH21AChinese, complete genome 235......a..............25595
EF473974.1 Hepatitis B virus isolate EIH21AChinese, complete genome 255_________............24457
EF473975.1 Hepatitis B virus isolate 2061Chinese, complete genome 235......a..............25595
EF473975.1 Hepatitis B virus isolate 2061Chinese, complete genome 255_________............24457
EF473977.1 Hepatitis B virus isolate KD048East, complete genome 235......a..............25595
EF473977.1 Hepatitis B virus isolate KD048East, complete genome 255_________............24457
AB202071.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-1 235......a..............25595
AB202071.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-1 255_________............24457
AB202072.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-2 211......a..............23195
AB202072.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-2 231_________............22057
AB302095.1 Hepatitis B virus DNA, complete genome, clone: Bj_39 235......a..............25595
AB302095.1 Hepatitis B virus DNA, complete genome, clone: Bj_39 255_________............24457
EF494376.1 Hepatitis B virus isolate TW706 genotype C, complete genome 235......a..............25595
EF494376.1 Hepatitis B virus isolate TW706 genotype C, complete genome 255_________............24457
EF494379.1 Hepatitis B virus isolate TW8585 genotype C, complete genome 235......a..............25595
EF494379.1 Hepatitis B virus isolate TW8585 genotype C, complete genome 255_________............24457
EF494380.1 Hepatitis B virus isolate TW836 genotype B, complete genome 235......a..............25595
EF494380.1 Hepatitis B virus isolate TW836 genotype B, complete genome 255_________............24457
EF494381.1 Hepatitis B virus isolate TW936 genotype B, complete genome 235......a..............25595
EF494381.1 Hepatitis B virus isolate TW936 genotype B, complete genome 255_________............24457
EF494382.1 Hepatitis B virus isolate TWD347 genotype B, complete genome 228......a..............24895
EF494382.1 Hepatitis B virus isolate TWD347 genotype B, complete genome 248_________............23757
EU139543.1 Hepatitis B virus strain NDJ, complete genome 235......a..............25595
EU139543.1 Hepatitis B virus strain NDJ, complete genome 255_________............24457
AB298720.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1S 235......a..............25595
AB298720.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1S 255_________............24457
AB298721.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1C 235......a..............25595
AB298721.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1C 255_________............24457
AB300359.1 Hepatitis B virus DNA, complete genome, isolate: patient1 235......a..............25595
AB300359.1 Hepatitis B virus DNA, complete genome, isolate: patient1 255_________............24457
AB300360.1 Hepatitis B virus DNA, complete genome, isolate: patient2 235......a..............25595
AB300360.1 Hepatitis B virus DNA, complete genome, isolate: patient2 255_________............24457
AB300361.1 Hepatitis B virus DNA, complete genome, isolate: patient3 235......a..............25595
AB300361.1 Hepatitis B virus DNA, complete genome, isolate: patient3 255_________............24457
AB300362.1 Hepatitis B virus DNA, complete genome, isolate: patient4 235......a..............25595
AB300362.1 Hepatitis B virus DNA, complete genome, isolate: patient4 255_________............24457
AB300363.1 Hepatitis B virus DNA, complete genome, isolate: patient5 235......a..............25595
AB300363.1 Hepatitis B virus DNA, complete genome, isolate: patient5 255_________............24457
AB300364.1 Hepatitis B virus DNA, complete genome, isolate: patient6 235......a..............25595
AB300364.1 Hepatitis B virus DNA, complete genome, isolate: patient6 255_________............24457
AB300365.1 Hepatitis B virus DNA, complete genome, isolate: patient7 235......a..............25595
AB300365.1 Hepatitis B virus DNA, complete genome, isolate: patient7 255_________............24457
AB300368.1 Hepatitis B virus DNA, complete genome, isolate: patient10 235......a..............25595
AB300368.1 Hepatitis B virus DNA, complete genome, isolate: patient10 255_________............24457
AB300369.1 Hepatitis B virus DNA, complete genome, isolate: patient11 235......a..............25595
AB300369.1 Hepatitis B virus DNA, complete genome, isolate: patient11 255_________............24457
AB300370.1 Hepatitis B virus DNA, complete genome, isolate: patient12 178......a..............19895
AB300370.1 Hepatitis B virus DNA, complete genome, isolate: patient12 198_________............18757
AB300371.1 Hepatitis B virus DNA, complete genome, isolate: patient13 235......a..............25595
AB300371.1 Hepatitis B virus DNA, complete genome, isolate: patient13 255_________............24457
AB300372.1 Hepatitis B virus DNA, complete genome, isolate: patient14 235......a..............25595
AB300372.1 Hepatitis B virus DNA, complete genome, isolate: patient14 255_________............24457
AB300373.1 Hepatitis B virus DNA, complete genome, isolate: patient15 211......a..............23195
AB300373.1 Hepatitis B virus DNA, complete genome, isolate: patient15 231_________............22057
EF473971.1 Hepatitis B virus isolate 2059Java, complete genome 235......a..............25595
EF473971.1 Hepatitis B virus isolate 2059Java, complete genome 255_________............24457
EF473972.1 Hepatitis B virus isolate 1839Java, complete genome 235......a..............25595
EF473972.1 Hepatitis B virus isolate 1839Java, complete genome 255_________............24457
AB368295.1 Hepatitis B virus DNA, complete genome, Genotype B, Subgenotype B4, c235......a..............25595
AB368295.1 Hepatitis B virus DNA, complete genome, Genotype B, Subgenotype B4, c255_________............24457
AB368297.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c235......a..............25595
AB368297.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c255_________............24457
EU239220.1 Hepatitis B virus isolate PW5, complete genome 235...........a.........25595
AB287319.1 Hepatitis B virus DNA, complete genome, isolate: AlaskaG23 235......a..............25595
AB287319.1 Hepatitis B virus DNA, complete genome, isolate: AlaskaG23 255_________............24457
AB287323.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-4 235......a..............25595
AB287323.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-4 255_________............24457
AB287326.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A44 235......a..............25595
AB287326.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A44 255_________............24457
AB287327.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A53 235......a..............25595
AB287327.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A53 255_________............24457
AB287328.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba 51 235......a..............25595
AB287328.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba 51 255_________............24457
AB287329.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba A55 235......a..............25595
AB287329.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba A55 255_________............24457
EU155893.1 Hepatitis B virus isolate 4, complete genome 235.........a...........25595
AB330366.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ2HB235.......a.............25595
AB330366.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ2HB255_________............24457
EU158262.1 Hepatitis B virus isolate G116, complete genome 235......a..............25595
EU158262.1 Hepatitis B virus isolate G116, complete genome 255_________............24457
EU158263.1 Hepatitis B virus isolate G108, complete genome 235......a..............25595
EU158263.1 Hepatitis B virus isolate G108, complete genome 255_________............24457
EU305540.1 Hepatitis B virus isolate G67-123, complete genome 235......a..............25595
EU305540.1 Hepatitis B virus isolate G67-123, complete genome 255_________............24457
EU305542.1 Hepatitis B virus isolate G67-1251, complete genome 235......a..............25595
EU305542.1 Hepatitis B virus isolate G67-1251, complete genome 255_________............24457
EU305543.1 Hepatitis B virus isolate L15-57, complete genome 235......a..............25595
EU305543.1 Hepatitis B virus isolate L15-57, complete genome 255_________............24457
EU305544.1 Hepatitis B virus isolate L15-129, complete genome 235......a..............25595
EU305544.1 Hepatitis B virus isolate L15-129, complete genome 255_________............24457
EU305545.1 Hepatitis B virus isolate L15-196, complete genome 235......a..............25595
EU305545.1 Hepatitis B virus isolate L15-196, complete genome 255_________............24457
EU305546.1 Hepatitis B virus isolate M118-153, complete genome 235......a..............25595
EU305546.1 Hepatitis B virus isolate M118-153, complete genome 255_________............24457
EU305547.1 Hepatitis B virus isolate M118-481, complete genome 235......a..............25595
EU305547.1 Hepatitis B virus isolate M118-481, complete genome 255_________............24457
EU305548.1 Hepatitis B virus isolate M118-673, complete genome 235......a..............25595
EU305548.1 Hepatitis B virus isolate M118-673, complete genome 255_________............24457
AM494703.1 Hepatitis B virus complete genome, isolate CAR107 235...........a.........25595
EU306670.1 Hepatitis B virus clone 110-33, complete genome 209......a..............22995
EU306670.1 Hepatitis B virus clone 110-33, complete genome 229_________............21857
EU306671.1 Hepatitis B virus clone 626-49, complete genome 235......a..............25595
EU306671.1 Hepatitis B virus clone 626-49, complete genome 255_________............24457
EU306672.1 Hepatitis B virus clone 626-20, complete genome 235......a..............25595
EU306672.1 Hepatitis B virus clone 626-20, complete genome 255_________............24457
EU306673.1 Hepatitis B virus clone 213-10, complete genome 235......a..............25595
EU306673.1 Hepatitis B virus clone 213-10, complete genome 255_________............24457
EU306674.1 Hepatitis B virus clone 213-6, complete genome 235......a..............25595
EU306674.1 Hepatitis B virus clone 213-6, complete genome 255_________............24457
EU306675.1 Hepatitis B virus clone 213-21, complete genome 235......a..............25595
EU306675.1 Hepatitis B virus clone 213-21, complete genome 255_________............24457
EU306677.1 Hepatitis B virus clone 220-14, complete genome 235......a..............25595
EU306677.1 Hepatitis B virus clone 220-14, complete genome 255_________............24457
EU306678.1 Hepatitis B virus clone 220-36, complete genome 235......a..............25595
EU306678.1 Hepatitis B virus clone 220-36, complete genome 255_________............24457
EU306679.1 Hepatitis B virus clone 220-26, complete genome 235......a..............25595
EU306679.1 Hepatitis B virus clone 220-26, complete genome 255_________............24457
EU306680.1 Hepatitis B virus clone 220-27, complete genome 235......a..............25595
EU306680.1 Hepatitis B virus clone 220-27, complete genome 255_________............24457
EU306681.1 Hepatitis B virus clone 220-44, complete genome 235......a..............25595
EU306681.1 Hepatitis B virus clone 220-44, complete genome 255_________............24457
EU306682.1 Hepatitis B virus clone 220-8, complete genome 235......a..............25595
EU306682.1 Hepatitis B virus clone 220-8, complete genome 255_________............24457
EU306683.1 Hepatitis B virus clone 220-30, complete genome 235......a..............25595
EU306683.1 Hepatitis B virus clone 220-30, complete genome 255_________............24457
EU306684.1 Hepatitis B virus clone 220-43, complete genome 235......a..............25595
EU306684.1 Hepatitis B virus clone 220-43, complete genome 255_________............24457
EU306685.1 Hepatitis B virus clone 327-4, complete genome 235......a..............25595
EU306685.1 Hepatitis B virus clone 327-4, complete genome 255_________............24457
EU306686.1 Hepatitis B virus clone 327-28, complete genome 235......a..............25595
EU306686.1 Hepatitis B virus clone 327-28, complete genome 255_________............24457
EU306687.1 Hepatitis B virus clone 327-6, complete genome 235......a..............25595
EU306687.1 Hepatitis B virus clone 327-6, complete genome 255_________............24457
EU306688.1 Hepatitis B virus clone 327-54, complete genome 235......a..............25595
EU306688.1 Hepatitis B virus clone 327-54, complete genome 255_________............24457
EU306689.1 Hepatitis B virus clone 327-27, complete genome 235......a..............25595
EU306689.1 Hepatitis B virus clone 327-27, complete genome 255_________............24457
EU306690.1 Hepatitis B virus clone 327-71, complete genome 235......a..............25595
EU306690.1 Hepatitis B virus clone 327-71, complete genome 255_________............24457
EU306691.1 Hepatitis B virus clone 327-57, complete genome 235......a..............25595
EU306691.1 Hepatitis B virus clone 327-57, complete genome 255_________............24457
EU306692.1 Hepatitis B virus clone 327-73, complete genome 235......a..............25595
EU306692.1 Hepatitis B virus clone 327-73, complete genome 255_________............24457
EU306693.1 Hepatitis B virus clone 327-67, complete genome 235......a..............25595
EU306693.1 Hepatitis B virus clone 327-67, complete genome 255_________............24457
EU306694.1 Hepatitis B virus clone 327-46, complete genome 235......a..............25595
EU306694.1 Hepatitis B virus clone 327-46, complete genome 255_________............24457
EU306695.1 Hepatitis B virus clone 712-64, complete genome 235......a..............25595
EU306695.1 Hepatitis B virus clone 712-64, complete genome 255_________............24457
EU306696.1 Hepatitis B virus clone 712-47, complete genome 235......a..............25595
EU306696.1 Hepatitis B virus clone 712-47, complete genome 255_________............24457
EU306697.1 Hepatitis B virus clone 712-99, complete genome 235......a..............25595
EU306697.1 Hepatitis B virus clone 712-99, complete genome 255_________............24457
EU306698.1 Hepatitis B virus clone 712-105, complete genome 235......a..............25595
EU306698.1 Hepatitis B virus clone 712-105, complete genome 255_________............24457
EU306699.1 Hepatitis B virus clone 807-13, complete genome 235......a..............25595
EU306699.1 Hepatitis B virus clone 807-13, complete genome 255_________............24457
EU306700.1 Hepatitis B virus clone 221-2, complete genome 235......a..............25595
EU306700.1 Hepatitis B virus clone 221-2, complete genome 255_________............24457
EU306701.1 Hepatitis B virus clone 221-10, complete genome 235......a..............25595
EU306701.1 Hepatitis B virus clone 221-10, complete genome 255_________............24457
EU306702.1 Hepatitis B virus clone 221-11, complete genome 235......a..............25595
EU306702.1 Hepatitis B virus clone 221-11, complete genome 255_________............24457
EU306703.1 Hepatitis B virus clone 221-13, complete genome 235......a..............25595
EU306703.1 Hepatitis B virus clone 221-13, complete genome 255_________............24457
EU306704.1 Hepatitis B virus clone 221-29, complete genome 235......a..............25595
EU306704.1 Hepatitis B virus clone 221-29, complete genome 255_________............24457
EU306705.1 Hepatitis B virus clone 221-31, complete genome 235......a..............25595
EU306705.1 Hepatitis B virus clone 221-31, complete genome 255_________............24457
EU306706.1 Hepatitis B virus clone 221-33, complete genome 235......a..............25595
EU306706.1 Hepatitis B virus clone 221-33, complete genome 255_________............24457
EU306707.1 Hepatitis B virus clone 221-36, complete genome 235......a..............25595
EU306707.1 Hepatitis B virus clone 221-36, complete genome 255_________............24457
EU306708.1 Hepatitis B virus clone 221-37, complete genome 235......a..............25595
EU306708.1 Hepatitis B virus clone 221-37, complete genome 255_________............24457
EU306709.1 Hepatitis B virus clone 221-42, complete genome 235......a..............25595
EU306709.1 Hepatitis B virus clone 221-42, complete genome 255_________............24457
EU306710.1 Hepatitis B virus clone 221-14, complete genome 235......a..............25595
EU306710.1 Hepatitis B virus clone 221-14, complete genome 255_________............24457
EU306711.1 Hepatitis B virus clone 221-50, complete genome 235......a..............25595
EU306711.1 Hepatitis B virus clone 221-50, complete genome 255_________............24457
EU306712.1 Hepatitis B virus clone 221-15, complete genome 235......a..............25595
EU306712.1 Hepatitis B virus clone 221-15, complete genome 255_________............24457
EU306713.1 Hepatitis B virus clone 602-27, complete genome 235......a..............25595
EU306713.1 Hepatitis B virus clone 602-27, complete genome 255_________............24457
EU306714.1 Hepatitis B virus clone 602-77, complete genome 235......a..............25595
EU306714.1 Hepatitis B virus clone 602-77, complete genome 255_________............24457
EU306715.1 Hepatitis B virus clone 602(son)-17, complete genome 235......a..............25595
EU306715.1 Hepatitis B virus clone 602(son)-17, complete genome 255_________............24457
EU306716.1 Hepatitis B virus clone 602(son)-18, complete genome 235......a..............25595
EU306716.1 Hepatitis B virus clone 602(son)-18, complete genome 255_________............24457
EU306717.1 Hepatitis B virus clone 602(son)-22, complete genome 235......a..............25595
EU306717.1 Hepatitis B virus clone 602(son)-22, complete genome 255_________............24457
EU306718.1 Hepatitis B virus clone 602(son)-24, complete genome 235......a..............25595
EU306718.1 Hepatitis B virus clone 602(son)-24, complete genome 255_________............24457
EU306719.1 Hepatitis B virus clone 602(son)-23, complete genome 235......a..............25595
EU306719.1 Hepatitis B virus clone 602(son)-23, complete genome 255_________............24457
EU306720.1 Hepatitis B virus clone 602(son)-68, complete genome 235......a..............25595
EU306720.1 Hepatitis B virus clone 602(son)-68, complete genome 255_________............24457
EU306722.1 Hepatitis B virus clone 6022-28-, complete genome 235......a..............25595
EU306722.1 Hepatitis B virus clone 6022-28-, complete genome 255_________............24457
EU306723.1 Hepatitis B virus clone 6022-19, complete genome 235......a..............25595
EU306723.1 Hepatitis B virus clone 6022-19, complete genome 255_________............24457
EU306724.1 Hepatitis B virus clone 6022-2-, complete genome 235......a..............25595
EU306724.1 Hepatitis B virus clone 6022-2-, complete genome 255_________............24457
EU306725.1 Hepatitis B virus clone 6022-17, complete genome 235......a..............25595
EU306725.1 Hepatitis B virus clone 6022-17, complete genome 255_________............24457
EU306726.1 Hepatitis B virus clone 6022-12-, complete genome 235......a..............25595
EU306726.1 Hepatitis B virus clone 6022-12-, complete genome 255_________............24457
EU306727.1 Hepatitis B virus clone 6022-5-, complete genome 235......a..............25595
EU306727.1 Hepatitis B virus clone 6022-5-, complete genome 255_________............24457
EU306728.1 Hepatitis B virus clone 6022-43, complete genome 235......a..............25595
EU306728.1 Hepatitis B virus clone 6022-43, complete genome 255_________............24457
EU306729.1 Hepatitis B virus clone 6022-33, complete genome 235......a..............25595
EU306729.1 Hepatitis B virus clone 6022-33, complete genome 255_________............24457
EU350409.1 Hepatitis B virus isolate BTO5856, complete genome 235......a..............25595
EU350409.1 Hepatitis B virus isolate BTO5856, complete genome 255_________............24457
EU410079.1 Hepatitis B virus isolate ph109, complete genome 235......a..............25595
EU410079.1 Hepatitis B virus isolate ph109, complete genome 255_________............24457
EU410080.1 Hepatitis B virus isolate ph76, complete genome 235......a..............25595
EU410080.1 Hepatitis B virus isolate ph76, complete genome 255_________............24457
EU410081.1 Hepatitis B virus isolate ph80, complete genome 235......a..............25595
EU410081.1 Hepatitis B virus isolate ph80, complete genome 255_________............24457
EU439005.1 Hepatitis B virus clone 6022-35 from China, complete genome 235......a..............25595
EU439005.1 Hepatitis B virus clone 6022-35 from China, complete genome 255_________............24457
EU439006.1 Hepatitis B virus clone 602(S)-3 from China, complete genome 235......a..............25595
EU439006.1 Hepatitis B virus clone 602(S)-3 from China, complete genome 255_________............24457
EU439007.1 Hepatitis B virus clone 602(S)-39 from China, complete genome 235......a..............25595
EU439007.1 Hepatitis B virus clone 602(S)-39 from China, complete genome 255_________............24457
EU439008.1 Hepatitis B virus clone 6023-27 from China, complete genome 235......a..............25595
EU439008.1 Hepatitis B virus clone 6023-27 from China, complete genome 255_________............24457
EU439010.1 Hepatitis B virus clone 6023-38 from China, complete genome 235......a..............25595
EU439010.1 Hepatitis B virus clone 6023-38 from China, complete genome 255_________............24457
EU439015.1 Hepatitis B virus clone zgh-26 from China, complete genome 235......a..............25595
EU439015.1 Hepatitis B virus clone zgh-26 from China, complete genome 255_________............24457
EU439016.1 Hepatitis B virus clone zgh-9 from China, complete genome 235......a..............25595
EU439016.1 Hepatitis B virus clone zgh-9 from China, complete genome 255_________............24457
EU439018.1 Hepatitis B virus clone dzc-5 from China, complete genome 235......a..............25595
EU439018.1 Hepatitis B virus clone dzc-5 from China, complete genome 255_________............24457
EU439019.1 Hepatitis B virus clone dzc-6 from China, complete genome 235......a..............25595
EU439019.1 Hepatitis B virus clone dzc-6 from China, complete genome 255_________............24457
EU439020.1 Hepatitis B virus clone dzc-12 from China, complete genome 235......a..............25595
EU439020.1 Hepatitis B virus clone dzc-12 from China, complete genome 255_________............24457
EU439021.1 Hepatitis B virus clone dzc-14 from China, complete genome 235......a..............25595
EU439021.1 Hepatitis B virus clone dzc-14 from China, complete genome 255_________............24457
EU439022.1 Hepatitis B virus clone dzc-19 from China, complete genome 235......a..............25595
EU439022.1 Hepatitis B virus clone dzc-19 from China, complete genome 255_________............24457
EU439023.1 Hepatitis B virus clone dzc-22 from China, complete genome 235......a..............25595
EU439023.1 Hepatitis B virus clone dzc-22 from China, complete genome 255_________............24457
EU439024.1 Hepatitis B virus clone 220-42 from China, complete genome 235......a..............25595
EU439024.1 Hepatitis B virus clone 220-42 from China, complete genome 255_________............24457
AB365445.1 Hepatitis B virus DNA, complete genome, isolate: BOL1 235......a..............25595
AB365445.1 Hepatitis B virus DNA, complete genome, isolate: BOL1 255_________............24457
AB365446.1 Hepatitis B virus DNA, complete genome, isolate: BOL3 235......a..............25595
AB365446.1 Hepatitis B virus DNA, complete genome, isolate: BOL3 255_________............24457
AB365448.1 Hepatitis B virus DNA, complete genome, isolate: BOL71 235......a..............25595
AB365448.1 Hepatitis B virus DNA, complete genome, isolate: BOL71 255_________............24457
AB365450.1 Hepatitis B virus DNA, complete genome, isolate: BOL102 235......a..............25595
AB365450.1 Hepatitis B virus DNA, complete genome, isolate: BOL102 255_________............24457
AB365451.1 Hepatitis B virus DNA, complete genome, isolate: BOL196 235......a..............25595
AB365451.1 Hepatitis B virus DNA, complete genome, isolate: BOL196 255_________............24457
AB365453.1 Hepatitis B virus DNA, complete genome, isolate: BOL584 235......a..............25595
AB365453.1 Hepatitis B virus DNA, complete genome, isolate: BOL584 255_________............24457
AB426467.1 Hepatitis B virus DNA, complete genome, clone: HBVFH0204 235......a..............25595
AB426467.1 Hepatitis B virus DNA, complete genome, clone: HBVFH0204 255_________............24457
EU547558.1 Hepatitis B virus isolate MC01, complete genome 235......a..............25595
EU547558.1 Hepatitis B virus isolate MC01, complete genome 255_________............24457
EU547559.1 Hepatitis B virus isolate MC02, complete genome 202......a..............22295
EU547559.1 Hepatitis B virus isolate MC02, complete genome 222_________............21157
EU547561.1 Hepatitis B virus isolate MC04, complete genome 235......a..............25595
EU547561.1 Hepatitis B virus isolate MC04, complete genome 255_________............24457
EU547563.1 Hepatitis B virus isolate MC06, complete genome 235......a..............25595
EU547563.1 Hepatitis B virus isolate MC06, complete genome 255_________............24457
EU439009.1 Hepatitis B virus clone 6023-33 from China, complete genome 188......a..............20895
EU439009.1 Hepatitis B virus clone 6023-33 from China, complete genome 208_________............19757
AB299858.1 Hepatitis B virus subtype adr DNA, complete genome, clone: HBVFH0204 235......a..............25595
AB299858.1 Hepatitis B virus subtype adr DNA, complete genome, clone: HBVFH0204 255_________............24457
EU554535.1 Hepatitis B virus isolate S472-20, complete genome 235......a..............25595
EU554535.1 Hepatitis B virus isolate S472-20, complete genome 255_________............24457
EU554537.1 Hepatitis B virus isolate S541-13, complete genome 235......a..............25595
EU554537.1 Hepatitis B virus isolate S541-13, complete genome 255_________............24457
EU554538.1 Hepatitis B virus isolate S541-15, complete genome 235......a..............25595
EU554538.1 Hepatitis B virus isolate S541-15, complete genome 255_________............24457
EU554539.1 Hepatitis B virus isolate S541-21, complete genome 235......a..............25595
EU554539.1 Hepatitis B virus isolate S541-21, complete genome 255_________............24457
EU554540.1 Hepatitis B virus isolate S304-10, complete genome 235......a..............25595
EU554540.1 Hepatitis B virus isolate S304-10, complete genome 255_________............24457
EU554541.1 Hepatitis B virus isolate S696-1, complete genome 235......a..............25595
EU554541.1 Hepatitis B virus isolate S696-1, complete genome 255_________............24457
EU554542.1 Hepatitis B virus isolate S696-4, complete genome 235......a..............25595
EU554542.1 Hepatitis B virus isolate S696-4, complete genome 255_________............24457
EU562215.1 Hepatitis B virus isolate 11, complete genome 235......a..............25595
EU562215.1 Hepatitis B virus isolate 11, complete genome 255_________............24457
EU562216.1 Hepatitis B virus isolate 13, complete genome 235......a..............25595
EU562216.1 Hepatitis B virus isolate 13, complete genome 255_________............24457
EU562217.1 Hepatitis B virus isolate 16, complete genome 235......a..............25595
EU562217.1 Hepatitis B virus isolate 16, complete genome 255_________............24457
EU562218.1 Hepatitis B virus isolate 7, complete genome 235......a..............25595
EU562218.1 Hepatitis B virus isolate 7, complete genome 255_________............24457
EU562219.1 Hepatitis B virus isolate 5, complete genome 235......a..............25595
EU562219.1 Hepatitis B virus isolate 5, complete genome 255_________............24457
EU560438.1 Hepatitis B virus isolate 2-B74, complete genome 235......a..............25595
EU560438.1 Hepatitis B virus isolate 2-B74, complete genome 255_________............24457
EU560439.1 Hepatitis B virus isolate 7-B74, complete genome 235......a..............25595
EU560439.1 Hepatitis B virus isolate 7-B74, complete genome 255_________............24457
EU560440.1 Hepatitis B virus isolate 1-S869, complete genome 235......a..............25595
EU560440.1 Hepatitis B virus isolate 1-S869, complete genome 255_________............24457
EU560441.1 Hepatitis B virus isolate 4-S869, complete genome 235......a..............25595
EU560441.1 Hepatitis B virus isolate 4-S869, complete genome 255_________............24457
EU570067.1 Hepatitis B virus isolate 18-S541, complete genome 235......a..............25595
EU570067.1 Hepatitis B virus isolate 18-S541, complete genome 255_________............24457
EU570068.1 Hepatitis B virus isolate 26-S541, complete genome 235......a..............25595
EU570068.1 Hepatitis B virus isolate 26-S541, complete genome 255_________............24457
EU570069.1 Hepatitis B virus isolate 1-B24, complete genome 235......a..............25595
EU570069.1 Hepatitis B virus isolate 1-B24, complete genome 255_________............24457
EU570070.1 Hepatitis B virus isolate 2-B24, complete genome 235......a..............25595
EU570070.1 Hepatitis B virus isolate 2-B24, complete genome 255_________............24457
EU570071.1 Hepatitis B virus isolate 4-B24, complete genome 235......a..............25595
EU570071.1 Hepatitis B virus isolate 4-B24, complete genome 255_________............24457
EU570072.1 Hepatitis B virus isolate 1-B74, complete genome 235......a..............25595
EU570072.1 Hepatitis B virus isolate 1-B74, complete genome 255_________............24457
EU570073.1 Hepatitis B virus isolate 8-S698, complete genome 235......a..............25595
EU570073.1 Hepatitis B virus isolate 8-S698, complete genome 255_________............24457
EU570074.1 Hepatitis B virus isolate 11-S698, complete genome 235......a..............25595
EU570074.1 Hepatitis B virus isolate 11-S698, complete genome 255_________............24457
EU570075.1 Hepatitis B virus isolate 11-S142, complete genome 235......a..............25595
EU570075.1 Hepatitis B virus isolate 11-S142, complete genome 255_________............24457
EU579441.1 Hepatitis B virus isolate 12 genotype B, complete genome 235......a..............25595
EU579441.1 Hepatitis B virus isolate 12 genotype B, complete genome 255_________............24457
EU579443.1 Hepatitis B virus isolate 2 genotype C, complete genome 235......a..............25595
EU579443.1 Hepatitis B virus isolate 2 genotype C, complete genome 255_________............24457
EU595030.1 Hepatitis B virus isolate 6, complete genome 235......a..............25595
EU595030.1 Hepatitis B virus isolate 6, complete genome 255_________............24457
EU595031.1 Hepatitis B virus isolate 7, complete genome 235......a..............25595
EU595031.1 Hepatitis B virus isolate 7, complete genome 255_________............24457
EU589335.1 Hepatitis B virus isolate S142-5, complete genome 235......a..............25595
EU589335.1 Hepatitis B virus isolate S142-5, complete genome 255_________............24457
EU589336.1 Hepatitis B virus isolate S1175-1, complete genome 235......a..............25595
EU589336.1 Hepatitis B virus isolate S1175-1, complete genome 255_________............24457
EU589337.1 Hepatitis B virus isolate S710-2, complete genome 229......a..............24995
EU589337.1 Hepatitis B virus isolate S710-2, complete genome 249_________............23857
EU589340.1 Hepatitis B virus isolate S852-7, complete genome 190......a..............21095
EU589340.1 Hepatitis B virus isolate S852-7, complete genome 210_________............19957
EU589341.1 Hepatitis B virus isolate S852-10, complete genome 190......a..............21095
EU589341.1 Hepatitis B virus isolate S852-10, complete genome 210_________............19957
EU589342.1 Hepatitis B virus isolate S852-13, complete genome 190......a..............21095
EU589342.1 Hepatitis B virus isolate S852-13, complete genome 210_________............19957
EU589343.1 Hepatitis B virus isolate S852-15, complete genome 190......a..............21095
EU589343.1 Hepatitis B virus isolate S852-15, complete genome 210_________............19957
EU589345.1 Hepatitis B virus isolate S624-2, complete genome 220......a..............24095
EU589345.1 Hepatitis B virus isolate S624-2, complete genome 240_________............22957
AB302942.1 Hepatitis B virus DNA, complte genome, isolate: GRE3837NN 235......a..............25595
AB302942.1 Hepatitis B virus DNA, complte genome, isolate: GRE3837NN 255_________............24457
AB302943.1 Hepatitis B virus DNA, complte genome, isolate: GRE3639NN 235......a..............25595
AB302943.1 Hepatitis B virus DNA, complte genome, isolate: GRE3639NN 255_________............24457
AB302944.1 Hepatitis B virus DNA, complte genome, isolate: GRE3641NN 235......a..............25595
AB302944.1 Hepatitis B virus DNA, complte genome, isolate: GRE3641NN 255_________............24457
AB302945.1 Hepatitis B virus DNA, complte genome, isolate: GRE3643NN 235......a..............25595
AB302945.1 Hepatitis B virus DNA, complte genome, isolate: GRE3643NN 255_________............24457
EU487256.1 Hepatitis B virus isolate patient12, complete genome 235......a..............25595
EU487256.1 Hepatitis B virus isolate patient12, complete genome 255_________............24457
EU487257.1 Hepatitis B virus isolate patient14, complete genome 235......a..............25595
EU487257.1 Hepatitis B virus isolate patient14, complete genome 255_________............24457
EU747320.1 Hepatitis B virus isolate V51, complete genome 235...........t.........25595
EU670262.1 Hepatitis B virus isolate 549, complete genome 235......a..............25595
EU670262.1 Hepatitis B virus isolate 549, complete genome 255_________............24457
EU670263.1 Hepatitis B virus isolate ph105, complete genome 235......a..............25595
EU670263.1 Hepatitis B virus isolate ph105, complete genome 255_________............24457
EU717211.1 Hepatitis B virus isolate D23K-6, complete genome 237......a..............25795
EU717211.1 Hepatitis B virus isolate D23K-6, complete genome 257_________............24657
EU717212.1 Hepatitis B virus isolate D26K-7, complete genome 237......a..............25795
EU717212.1 Hepatitis B virus isolate D26K-7, complete genome 257_________............24657
AB375159.1 Hepatitis B virus DNA, complete genome, strain: MEX8-H 235......a..............25595
AB375159.1 Hepatitis B virus DNA, complete genome, strain: MEX8-H 255_________............24457
AB375160.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-H 235......a..............25595
AB375160.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-H 255_________............24457
AB375161.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32 235......a..............25595
AB375161.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32 255_________............24457
AB375162.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-H 235......a..............25595
AB375162.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-H 255_________............24457
AB375163.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-H 235......a..............25595
AB375163.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-H 255_________............24457
AB375164.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-H 235......a..............25595
AB375164.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-H 255_________............24457
EU330989.1 Hepatitis B virus isolate M84-74, complete genome 235......a..............25595
EU330989.1 Hepatitis B virus isolate M84-74, complete genome 255_________............24457
EU330990.1 Hepatitis B virus isolate M84-146, complete genome 235......a..............25595
EU330990.1 Hepatitis B virus isolate M84-146, complete genome 255_________............24457
EU330992.1 Hepatitis B virus isolate M85-6, complete genome 235......a..............25595
EU330992.1 Hepatitis B virus isolate M85-6, complete genome 255_________............24457
EU330993.1 Hepatitis B virus isolate M85-8, complete genome 235......a..............25595
EU330993.1 Hepatitis B virus isolate M85-8, complete genome 255_________............24457
EU330994.1 Hepatitis B virus isolate M85-10, complete genome 235......a..............25595
EU330994.1 Hepatitis B virus isolate M85-10, complete genome 255_________............24457
EU330996.1 Hepatitis B virus isolate M85-81, complete genome 235......a..............25595
EU330996.1 Hepatitis B virus isolate M85-81, complete genome 255_________............24457
EU330997.1 Hepatitis B virus isolate M85-216, complete genome 235......a..............25595
EU330997.1 Hepatitis B virus isolate M85-216, complete genome 255_________............24457
EU330998.1 Hepatitis B virus isolate M85-1043, complete genome 235......a..............25595
EU330998.1 Hepatitis B virus isolate M85-1043, complete genome 255_________............24457
EU330999.1 Hepatitis B virus isolate M85-1044, complete genome 235......a..............25595
EU330999.1 Hepatitis B virus isolate M85-1044, complete genome 255_________............24457
EU331000.1 Hepatitis B virus isolate M85-1045, complete genome 235......a..............25595
EU331000.1 Hepatitis B virus isolate M85-1045, complete genome 255_________............24457
EU331001.1 Hepatitis B virus isolate M85-1046, complete genome 235......a..............25595
EU331001.1 Hepatitis B virus isolate M85-1046, complete genome 255_________............24457
EU796066.1 Hepatitis B virus strain 0477, complete genome 235......a..............25595
EU796066.1 Hepatitis B virus strain 0477, complete genome 255_________............24457
EU796067.1 Hepatitis B virus strain 2164, complete genome 235......a..............25595
EU796067.1 Hepatitis B virus strain 2164, complete genome 255_________............24457
EU796068.1 Hepatitis B virus strain 3831, complete genome 235......a..............25595
EU796068.1 Hepatitis B virus strain 3831, complete genome 255_________............24457
EU796069.1 Hepatitis B virus strain 4364, complete genome 235......a..............25595
EU796069.1 Hepatitis B virus strain 4364, complete genome 255_________............24457
EU796070.1 Hepatitis B virus strain 4460, complete genome 235......a..............25595
EU796070.1 Hepatitis B virus strain 4460, complete genome 255_________............24457
EU796071.1 Hepatitis B virus strain 5051, complete genome 235......a..............25595
EU796071.1 Hepatitis B virus strain 5051, complete genome 255_________............24457
EU796072.1 Hepatitis B virus strain 5131, complete genome 235......a..............25595
EU796072.1 Hepatitis B virus strain 5131, complete genome 255_________............24457
EU871969.1 Hepatitis B virus isolate 6-024-1, complete genome 235......a..............25595
EU871969.1 Hepatitis B virus isolate 6-024-1, complete genome 255_________............24457
EU871970.1 Hepatitis B virus isolate 6-024-3, complete genome 235......a..............25595
EU871970.1 Hepatitis B virus isolate 6-024-3, complete genome 255_________............24457
EU871972.1 Hepatitis B virus isolate 6-024-8, complete genome 235......a..............25595
EU871972.1 Hepatitis B virus isolate 6-024-8, complete genome 255_________............24457
EU871973.1 Hepatitis B virus isolate 6-024-99-5, complete genome 235......a..............25595
EU871973.1 Hepatitis B virus isolate 6-024-99-5, complete genome 255_________............24457
EU871974.1 Hepatitis B virus isolate 6-024A-1, complete genome 235......a..............25595
EU871974.1 Hepatitis B virus isolate 6-024A-1, complete genome 255_________............24457
EU871976.1 Hepatitis B virus isolate 179-04-3, complete genome 235......a..............25595
EU871976.1 Hepatitis B virus isolate 179-04-3, complete genome 255_________............24457
EU871978.1 Hepatitis B virus isolate 252-95-2, complete genome 235......a..............25595
EU871978.1 Hepatitis B virus isolate 252-95-2, complete genome 255_________............24457
EU871979.1 Hepatitis B virus isolate 252-95-4, complete genome 235......a..............25595
EU871979.1 Hepatitis B virus isolate 252-95-4, complete genome 255_________............24457
EU871981.1 Hepatitis B virus isolate 318-95-3, complete genome 235......a..............25595
EU871981.1 Hepatitis B virus isolate 318-95-3, complete genome 255_________............24457
EU871982.1 Hepatitis B virus isolate 318-96-2, complete genome 235......a..............25595
EU871982.1 Hepatitis B virus isolate 318-96-2, complete genome 255_________............24457
EU871983.1 Hepatitis B virus isolate 318-97-2, complete genome 235......a..............25595
EU871983.1 Hepatitis B virus isolate 318-97-2, complete genome 255_________............24457
EU871984.1 Hepatitis B virus isolate 490-00-1, complete genome 235......a..............25595
EU871984.1 Hepatitis B virus isolate 490-00-1, complete genome 255_________............24457
EU871985.1 Hepatitis B virus isolate 490-00-3, complete genome 235......a..............25595
EU871985.1 Hepatitis B virus isolate 490-00-3, complete genome 255_________............24457
EU871986.1 Hepatitis B virus isolate 490-1, complete genome 235......a..............25595
EU871986.1 Hepatitis B virus isolate 490-1, complete genome 255_________............24457
EU871987.1 Hepatitis B virus isolate 490-01-1, complete genome 235......a..............25595
EU871987.1 Hepatitis B virus isolate 490-01-1, complete genome 255_________............24457
EU871988.1 Hepatitis B virus isolate 490-01-3, complete genome 235......a..............25595
EU871988.1 Hepatitis B virus isolate 490-01-3, complete genome 255_________............24457
EU871989.1 Hepatitis B virus isolate 490-03-3, complete genome 235......a..............25595
EU871989.1 Hepatitis B virus isolate 490-03-3, complete genome 255_________............24457
EU871990.1 Hepatitis B virus isolate 490-04-1, complete genome 235......a..............25595
EU871990.1 Hepatitis B virus isolate 490-04-1, complete genome 255_________............24457
EU871991.1 Hepatitis B virus isolate 490-04-3, complete genome 235......a..............25595
EU871991.1 Hepatitis B virus isolate 490-04-3, complete genome 255_________............24457
EU871992.1 Hepatitis B virus isolate 490-99-1, complete genome 235......a..............25595
EU871992.1 Hepatitis B virus isolate 490-99-1, complete genome 255_________............24457
EU871993.1 Hepatitis B virus isolate 490-99-2, complete genome 235......a..............25595
EU871993.1 Hepatitis B virus isolate 490-99-2, complete genome 255_________............24457
EU871994.1 Hepatitis B virus isolate 490A-3, complete genome 235......a..............25595
EU871994.1 Hepatitis B virus isolate 490A-3, complete genome 255_________............24457
EU871995.1 Hepatitis B virus isolate 490A-4, complete genome 235......a..............25595
EU871995.1 Hepatitis B virus isolate 490A-4, complete genome 255_________............24457
EU871996.1 Hepatitis B virus isolate 490A-6, complete genome 235......a..............25595
EU871996.1 Hepatitis B virus isolate 490A-6, complete genome 255_________............24457
EU871997.1 Hepatitis B virus isolate 530-00-3, complete genome 235......a..............25595
EU871997.1 Hepatitis B virus isolate 530-00-3, complete genome 255_________............24457
EU871999.1 Hepatitis B virus isolate 530-00-7, complete genome 235......a..............25595
EU871999.1 Hepatitis B virus isolate 530-00-7, complete genome 255_________............24457
EU872000.1 Hepatitis B virus isolate 530-92-2, complete genome 235......a..............25595
EU872000.1 Hepatitis B virus isolate 530-92-2, complete genome 255_________............24457
EU872001.1 Hepatitis B virus isolate 530-92-8, complete genome 235......a..............25595
EU872001.1 Hepatitis B virus isolate 530-92-8, complete genome 255_________............24457
EU872002.1 Hepatitis B virus isolate 530-97-1, complete genome 235......a..............25595
EU872002.1 Hepatitis B virus isolate 530-97-1, complete genome 255_________............24457
EU872003.1 Hepatitis B virus isolate 530-97-2, complete genome 235......a..............25595
EU872003.1 Hepatitis B virus isolate 530-97-2, complete genome 255_________............24457
EU872004.1 Hepatitis B virus isolate 530-97-3, complete genome 235......a..............25595
EU872004.1 Hepatitis B virus isolate 530-97-3, complete genome 255_________............24457
EU872005.1 Hepatitis B virus isolate 179-96-1, complete genome 177......a..............19795
EU872005.1 Hepatitis B virus isolate 179-96-1, complete genome 197_________............18657
EU872006.1 Hepatitis B virus isolate 318-92-1, complete genome 235......a..............25595
EU872006.1 Hepatitis B virus isolate 318-92-1, complete genome 255_________............24457
EU872007.1 Hepatitis B virus isolate 252-92-6, complete genome 235......a..............25595
EU872007.1 Hepatitis B virus isolate 252-92-6, complete genome 255_________............24457
EU872008.1 Hepatitis B virus isolate 252A-8, complete genome 235......a..............25595
EU872008.1 Hepatitis B virus isolate 252A-8, complete genome 255_________............24457
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 220......a..............24095
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 240_________............22957
EU872010.1 Hepatitis B virus isolate 252-92-3, complete genome 235......a..............25595
EU872010.1 Hepatitis B virus isolate 252-92-3, complete genome 255_________............24457
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 220......a..............24095
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 240_________............22957
EU872012.1 Hepatitis B virus isolate 318-99-5, complete genome 235......a..............25595
EU872012.1 Hepatitis B virus isolate 318-99-5, complete genome 255_________............24457
EU872013.1 Hepatitis B virus isolate 318-99-6, complete genome 220......a..............24095
EU872013.1 Hepatitis B virus isolate 318-99-6, complete genome 240_________............22957
EU872014.1 Hepatitis B virus isolate 490-96-3, complete genome 180......a..............20095
EU872014.1 Hepatitis B virus isolate 490-96-3, complete genome 200_________............18957
EU872015.1 Hepatitis B virus isolate 490-96-1, complete genome 180......a..............20095
EU872015.1 Hepatitis B virus isolate 490-96-1, complete genome 200_________............18957
EU872016.1 Hepatitis B virus isolate 490A-1, complete genome 235......a..............25595
EU872016.1 Hepatitis B virus isolate 490A-1, complete genome 255_________............24457
EU872017.1 Hepatitis B virus isolate 530-00-6, complete genome 235......a..............25595
EU872017.1 Hepatitis B virus isolate 530-00-6, complete genome 255_________............24457
EU594404.1 Hepatitis B virus strain 1901-98, complete genome 235.......a.............25595
EU594404.1 Hepatitis B virus strain 1901-98, complete genome 255_________............24457
EU787444.1 Hepatitis B virus isolate W41, complete genome 235......a..............25595
EU787444.1 Hepatitis B virus isolate W41, complete genome 255_________............24457
EU939536.1 Hepatitis B virus isolate C3, complete genome 235......a..............25595
EU939536.1 Hepatitis B virus isolate C3, complete genome 255_________............24457
EU939537.1 Hepatitis B virus isolate C8, complete genome 181......a..............20195
EU939537.1 Hepatitis B virus isolate C8, complete genome 201_________............19057
EU939538.1 Hepatitis B virus isolate C9, complete genome 235......a..............25595
EU939538.1 Hepatitis B virus isolate C9, complete genome 255_________............24457
EU939540.1 Hepatitis B virus isolate C24, complete genome 235......a..............25595
EU939540.1 Hepatitis B virus isolate C24, complete genome 255_________............24457
EU939541.1 Hepatitis B virus isolate C25, complete genome 235......a..............25595
EU939541.1 Hepatitis B virus isolate C25, complete genome 255_________............24457
EU939543.1 Hepatitis B virus isolate C38, complete genome 235......a..............25595
EU939543.1 Hepatitis B virus isolate C38, complete genome 255_________............24457
EU939544.1 Hepatitis B virus isolate C39, complete genome 235......a..............25595
EU939544.1 Hepatitis B virus isolate C39, complete genome 255_________............24457
EU939545.1 Hepatitis B virus isolate C41, complete genome 235......a..............25595
EU939545.1 Hepatitis B virus isolate C41, complete genome 255_________............24457
EU939546.1 Hepatitis B virus isolate C44, complete genome 235......a..............25595
EU939546.1 Hepatitis B virus isolate C44, complete genome 255_________............24457
EU939547.1 Hepatitis B virus isolate C45, complete genome 235......a..............25595
EU939547.1 Hepatitis B virus isolate C45, complete genome 255_________............24457
EU939548.1 Hepatitis B virus isolate C46, complete genome 235......a..............25595
EU939548.1 Hepatitis B virus isolate C46, complete genome 255_________............24457
EU939549.1 Hepatitis B virus isolate C49, complete genome 235......a..............25595
EU939549.1 Hepatitis B virus isolate C49, complete genome 255_________............24457
EU939550.1 Hepatitis B virus isolate C55, complete genome 235......a..............25595
EU939550.1 Hepatitis B virus isolate C55, complete genome 255_________............24457
EU939551.1 Hepatitis B virus isolate C56, complete genome 235......a..............25595
EU939551.1 Hepatitis B virus isolate C56, complete genome 255_________............24457
EU939552.1 Hepatitis B virus isolate C57, complete genome 235......a..............25595
EU939552.1 Hepatitis B virus isolate C57, complete genome 255_________............24457
EU939553.1 Hepatitis B virus isolate C60, complete genome 235......a..............25595
EU939553.1 Hepatitis B virus isolate C60, complete genome 255_________............24457
EU939554.1 Hepatitis B virus isolate C61, complete genome 235......a..............25595
EU939554.1 Hepatitis B virus isolate C61, complete genome 255_________............24457
EU939555.1 Hepatitis B virus isolate C63, complete genome 235......a..............25595
EU939555.1 Hepatitis B virus isolate C63, complete genome 255_________............24457
EU939556.1 Hepatitis B virus isolate C64, complete genome 226......a..............24695
EU939556.1 Hepatitis B virus isolate C64, complete genome 246_________............23557
EU939557.1 Hepatitis B virus isolate C65, complete genome 223......a..............24395
EU939557.1 Hepatitis B virus isolate C65, complete genome 243_________............23257
EU939559.1 Hepatitis B virus isolate C67, complete genome 235......a..............25595
EU939559.1 Hepatitis B virus isolate C67, complete genome 255_________............24457
EU939560.1 Hepatitis B virus isolate C69, complete genome 202......a..............22295
EU939560.1 Hepatitis B virus isolate C69, complete genome 222_________............21157
EU939561.1 Hepatitis B virus isolate C70, complete genome 235......a..............25595
EU939561.1 Hepatitis B virus isolate C70, complete genome 255_________............24457
EU939562.1 Hepatitis B virus isolate C75, complete genome 235......a..............25595
EU939562.1 Hepatitis B virus isolate C75, complete genome 255_________............24457
EU939563.1 Hepatitis B virus isolate C76, complete genome 235......a..............25595
EU939563.1 Hepatitis B virus isolate C76, complete genome 255_________............24457
EU939564.1 Hepatitis B virus isolate C77, complete genome 235......a..............25595
EU939564.1 Hepatitis B virus isolate C77, complete genome