../../tmp/servers/virsirnadb/64861875
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi17071aatgtgtgtactgcaagcaac21
NC_001526.2 Human papillomavirus type 16, complete genome 189.....................209100
NC_010739.1 Ursus maritimus papillomavirus 1, complete genome 104.t...............a.._12385
NC_001676.1 Human papillomavirus 54, complete genome 724_.........ta...c...__74171
NC_001676.1 Human papillomavirus 54, complete genome 600______.........g.g.g.61457
NC_001690.1 Human papillomavirus type 48, complete genome 329__...c.........._____34261
NC_010817.1 Bandicoot papillomatosis carcinomatosis virus type 2, complete genome572.........gt.c....t.t.55276
NC_014952.1 Human papillomavirus type 128, complete genome 2422______............___241157
NC_014952.1 Human papillomavirus type 128, complete genome 4681______.........c..g..466761
NC_014952.1 Human papillomavirus type 128, complete genome 6287______.a..........g._630057
NC_001586.1 Human papillomavirus type 32, complete genome 7267_.a..t.t..........___728366
NC_001586.1 Human papillomavirus type 32, complete genome 1436___________..........144547
NC_001541.1 Cottontail rabbit papillomavirus, complete genome 4866.........t...g.______485261
NC_006564.1 Canine papillomavirus 2, complete genome 5704_..........c..t._____569061
NC_006564.1 Canine papillomavirus 2, complete genome 2586______...........a.__259857
NC_001691.1 Human papillomavirus type 50, complete genome 135________..t..........14757
NC_004195.1 Bovine papillomavirus type 5, complete genome 55______..c..........__4357
NC_004195.1 Bovine papillomavirus type 5, complete genome 4178____.........._______416947
NC_013117.1 Francolinus leucoscepus papillomavirus 1, complete genome 6304______.........g...__631657
NC_001354.1 Human papillomavirus type 41, complete genome 7445___...........c._____745757
NC_001354.1 Human papillomavirus type 41, complete genome 856__...a..cgta.........87466
NC_001694.1 Human papillomavirus - 61, complete genome 7933..........aaa..t..___791666
NC_015325.1 Zalophus californianus papillomavirus 1, complete genome 582.t..c.g.........a.___59966
NC_008032.1 Capra hircus papillomavirus type 1, complete genome 592_.c.........a.t..____60761
NC_001356.1 Human papillomavirus - 1, complete genome 3235___.a..........g.____322257
NC_011051.1 Capreolus capreolus papillomavirus 1, complete genome 1434____...ac.........___144757
NC_001605.1 Mastomys natalensis papillomavirus, complete genome 1271_________..a.........126052
NC_002232.1 Rabbit oral papillomavirus, complete genome 617________.t.........._60652
NC_002232.1 Rabbit oral papillomavirus, complete genome 2193__________.........._218447
NC_004104.1 Human papillomavirus type 90, complete genome 1440___.c..........______145152
NC_001587.1 Human papillomavirus type 34, complete genome 3895_________.........g..388452
NC_001587.1 Human papillomavirus type 34, complete genome 83_____..........______7447
NC_015268.1 Camelus dromedarius papillomavirus type 2, complete genome 5684___..........a.______569552
NC_011109.1 Tursiops truncatus papillomavirus type 1, complete genome 3965_____.g..........____395452
NC_011109.1 Tursiops truncatus papillomavirus type 1, complete genome 5222____.........t.._____521152
NC_011109.1 Tursiops truncatus papillomavirus type 1, complete genome 220_______.a.g........._23252
NC_011109.1 Tursiops truncatus papillomavirus type 1, complete genome 3141.........ca..________315352
NC_001693.1 Human papillomavirus type 60, complete genome 4027_______..........____403647
NC_011765.1 Erinaceus europaeus papillomavirus, complete genome 2604_________..........__261347
NC_012213.1 Human papillomavirus type 108, complete genome 639__.........._________64847
NC_007150.1 Procyon lotor papillomavirus 1, complete genome 2945____.........._______293647
NC_013035.1 Human papillomavirus 116, complete genome 2198..........___________220747
NC_014835.1 Human papillomavirus type 148, complete genome 1775______.........._____176647
NC_001576.1 Human papillomavirus type 10, complete genome 4070__.........._________407947
NC_001583.1 Human papillomavirus type 26, complete genome 7157_..........__________716647
NC_001583.1 Human papillomavirus type 26, complete genome 2508________.........tt..252052
NC_008184.1 Tursiops truncatus papillomavirus 2, complete genome 6230..........___________623947
NC_011531.1 Chelonia mydas papillomavirus 1, complete genome 1696___..ac.c.g........._168061
NC_008297.1 Canine papillomavirus 3, complete genome 4273______..c.aa.........428757
NC_011530.1 Caretta caretta papillomavirus 1, complete genome 2031______.a..ag.........204557
NC_001355.1 Human papillomavirus type 6b, complete genome 7486_.........ag.._______747452
NC_001357.1 Human papillomavirus - 18, complete genome 7654_______..ta........._764252
NC_001522.1 Bovine papillomavirus - 1, complete genome 2975_______.a.a........._298752
NC_001838.1 Common chimpanzee papillomavirus 1, complete genome 4350.g.t.........________436252
NC_004068.1 Fringilla coelebs papillomavirus, complete genome 3104.g.a.........________311652