../../tmp/servers/virsirnadb/1523574725
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi21441aatttgcaggcctatcagaaa21
NC_007377.1 Influenza A virus (A/Korea/426/68(H2N2)) segment 7, complete sequence731.....................751100
V01099.1 Influenza A virus (A/PR/8/1934(H1N1)) ORF1 and ORF2, genomic RNA 731.....................751100
NC_007367.1 Influenza A virus (A/New York/392/2004(H3N2)) segment 7, complete seq731.........a...........75195
NC_004907.1 Influenza A virus (A/Hong Kong/1073/99(H9N2)) segment 7, complete seq738...........t..c......75890
NC_007363.1 Influenza A virus (A/Goose/Guangdong/1/96(H5N1)) strain A/Goose/Guang731..............c..a...75190
NC_007371.1 Influenza A virus (A/New York/392/2004(H3N2)) segment 3, complete seq125.........caa...______13957
NC_007376.1 Influenza A virus (A/Korea/426/68(H2N2)) segment 3, complete sequence125.........caa...______13957
V01106.1 Influenza A virus (A/PR/8/1938(H1N1)) ORF1, genomic RNA 125.........caa...______13957
V01088.1 Influenza A virus (A/PR/8/34(HON1)) hemagglutinin gene 656___________........._66442