../../tmp/servers/virsirnadb/1374150579
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi11311acacttccgaaactactgtt20
EU872012.1 Hepatitis B virus isolate 318-99-5, complete genome 2224____...g............223975
FJ151414.1 Hepatitis B virus strain FD18-3, complete genome 1844____.....g..........185975
AF143302.1 Hepatitis B virus clone HD1402, complete genome 425___..c.g............44175
AF143305.1 Hepatitis B virus clone RM501, complete genome 515___..c.g............53175
AF143306.1 Hepatitis B virus clone RM517, complete genome 515___..c.g............53175
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 2328___..c.g............234475
DQ788726.1 Hepatitis B virus clone S15, complete genome 2222___..c.g............223875
DQ788727.1 Hepatitis B virus clone S18, complete genome 2243___..c.g............225975
DQ788728.1 Hepatitis B virus clone S24, complete genome 2232___..c.g............224875
DQ788729.1 Hepatitis B virus clone L1, complete genome 2243___..c.g............225975
EF208114.1 Hepatitis B virus clone B-S7, complete genome 2269___..c.g............228575
EF208115.1 Hepatitis B virus clone B-S8, complete genome 2269___..c.g............228575
FJ899772.1 Hepatitis B virus isolate C113-3, complete genome 2217___..c.g............223375
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 2297....................2317100
X01587.1 Hepatitis B virus subtype adr4 (HBV) 2196....................2216100
X14193.1 Hepatitis B virus DNA for adr mutant 2322....................2342100
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 2324....................2344100
X02763.1 Hepatitis b virus genome (serotype adw2) 512....................532100
X69798.1 Hepatitis B virus, subtype adw4 genes 2324....................2344100
X68292.1 Hepatitis B Virus DNA 2326....................2346100
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 2324....................2344100
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 2198....................2218100
D00329.1HPBADW1 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl2324....................2344100
D00330.1HPBADW2 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl2324....................2344100
D00331.1HPBADW3 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl2324....................2344100
D12980.1HPBCG Hepatitis B virus subtype adr(SRADR) DNA, complete genome 2198....................2218100
S50225.1 {HBV variant} [hepatitis B virus HBV, surface antigen-negative patien2326....................2346100
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 2324....................2344100
L08805.1HPBETNC Hepatitis B virus envelope, surface and nucleocapsid protein g2323....................2343100
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 2326....................2346100
M38454.1HPBADR1CG Hepatitis B virus , complete genome 924....................944100
M54923.1HPBADWZ Hepatitis B virus (subtype adw), complete genome 2324....................2344100
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 2322....................2342100
X75665.1 Human hepatitis virus (genotype C, HMA) preS1, preS2, S, C, X, antige2324....................2344100
X75663.1 Human hepatitis virus (genotype F, 9203) preS1, preS2, S, C, X, and P2324....................2344100
X75658.1 Human hepatitis virus (genotype F, Fou) preS1, preS2, S, C, X, antige2324....................2344100
X75656.1 Human hepatitis virus (genotype C, Cha) preS1, preS2, S, C, X, antige2324....................2344100
X52939.1 Hepatitis B virus genome with a pre X orf 2197....................2217100
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot2326....................2346100
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 2319....................2339100
D23677.1HPBA1HKK2 Hepatitis B virus (A1-HBVKK2) complete genome sequence 2316....................2336100
D23678.1HPBA2HYS2 Hepatitis B virus (A2-HBVYS2) complete genome sequence 2324....................2344100
D23679.1HPBA3HMS2 Hepatitis B virus (A3-HBVMS2) complete genome sequence 2324....................2344100
D23680.1HPBB4HST1 Hepatitis B virus (B4-HBVST1) complete genome sequence 2303....................2323100
D23681.1HPBC4HST2 Hepatitis B virus (C4-HBVST2) complete genome sequence 2324....................2344100
D23682.1HPBB5HKO1 Hepatitis B virus (B5-HBVKO1) complete genome sequence 2324....................2344100
D23683.1HPBC5HKO2 Hepatitis B virus (C5-HBVKO2) complete genome sequence 2324....................2344100
D23684.1HPBC6T588 Hepatitis B virus (C6-TKB588) complete genome sequence 2324....................2344100
S75184.1 S...preS2 [hepatitis B virus HBV, host=human plasma Nis 0859434, Geno2324....................2344100
D50489.1HPBA11A Hepatitis B virus DNA, complete genome, isolate:A11 2318....................2338100
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete2318....................2338100
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete2318....................2338100
X80925.1 Hepatitis B virus (patient 6) complete genome 2326....................2346100
X51970.1 Hepatitis B virus (HBV 991) complete genome 2324....................2344100
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes2324....................2344100
X97849.1 Hepatitis B virus (patient 3) complete genome 2326....................2346100
X97851.1 Hepatitis B virus (patient 6) complete genome 2326....................2346100
U46935.1HBU46935 Hepatitis B virus complete genome 2324....................2344100
X98073.1 Hepatitis B virus complete genome with insertion in core promoter (no2335....................2355100
X98072.1 Hepatitis B virus complete genome with insertion in core promoter 2335....................2355100
X98077.1 Hepatitis B virus complete genome, wild type 2324....................2344100
X98074.1 Hepatitis B virus complete genome with insertion in core promoter, 762259....................2279100
X98075.1 Hepatitis B virus complete genome with insertion in core promoter, 192533....................2553100
X98076.1 Hepatitis B virus complete genome with insertion in core promoter, 331996....................2016100
D50521.1 Hepatitis B virus clone HBV-ASA-FH1 genomic DNA, complete sequence 2324....................2344100
D50522.1 Hepatitis B virus clone HBV-ASA-FH2 genomic DNA, complete sequence 2324....................2344100
U95551.1 Hepatitis B virus subtype ayw, complete genome 2326....................2346100
D28880.1 Hepatitis B virus DNA, complete genome, strain Fukuoka Red Cross HBV 2324....................2344100
D50517.1 Hepatitis B virus clone HBV-ASA-EX1 genomic DNA, complete sequence 2324....................2344100
D50518.1 Hepatitis B virus clone HBV-ASA-EX2 genomic DNA, complete sequence 2324....................2344100
D50519.1 Hepatitis B virus clone HBV-ASA-EX3 genomic DNA, complete sequence 2324....................2344100
D50520.1 Hepatitis B virus clone HBV-ASA-EX4 genomic DNA, complete sequence 2324....................2344100
AF046996.1 Woolly monkey hepatitis B Virus, complete genome 2326....................2346100
AB014360.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D01HCC 2324....................2344100
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 2276....................2296100
AB014362.1 Hepatitis B virus genomic DNA, complete sequence, isolate 03D03HCC 2324....................2344100
AB014363.1 Hepatitis B virus genomic DNA, complete sequence, isolate 04D04HCC 2324....................2344100
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 2324....................2344100
AB014365.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D06HCC 2324....................2344100
AB014366.1 Hepatitis B virus genomic DNA, complete sequence, isolate 07D07HCC 2336....................2356100
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 2324....................2344100
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 2276....................2296100
AB014369.1 Hepatitis B virus genomic DNA, complete sequence, isolate 10D10HCC 2324....................2344100
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 2324....................2344100
AB014372.1 Hepatitis B virus genomic DNA, complete sequence, isolate 13D13HCC 2324....................2344100
AB014373.1 Hepatitis B virus genomic DNA, complete sequence, isolate 14D14HCC 2288....................2308100
AB014374.1 Hepatitis B virus genomic DNA, complete sequence, isolate 15D15HCC 2324....................2344100
AB014375.1 Hepatitis B virus genomic DNA, complete sequence, isolate 16T01HCC 2279....................2299100
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 2324....................2344100
AB014377.1 Hepatitis B virus genomic DNA, complete sequence, isolate 18T03HCC 2324....................2344100
AB014378.1 Hepatitis B virus genomic DNA, complete sequence, isolate 19Y01HCC 2324....................2344100
AB014379.1 Hepatitis B virus genomic DNA, complete sequence, isolate 20Y02HCC 2324....................2344100
AB014380.1 Hepatitis B virus genomic DNA, complete sequence, isolate 21Y03HCC 2324....................2344100
AB014387.1 Hepatitis B virus genomic DNA, complete sequence, isolate 28Y10HCC 2279....................2299100
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 2277....................2297100
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 2285....................2305100
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 2324....................2344100
AB014394.1 Hepatitis B virus genomic DNA, complete sequence, isolate 35Y17HCC 2324....................2344100
AB014395.1 Hepatitis B virus genomic DNA, complete sequence, isolate 36Y18HCC 2311....................2331100
AB014371.1 Hepatitis B virus genomic DNA, complete sequence, isolate 12D12HCC 2330....................2350100
AB014381.1 Hepatitis B virus genomic DNA, complete sequence, isolate 22Y04HCC 2324....................2344100
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 2324....................2344100
AB014383.1 Hepatitis B virus genomic DNA, complete sequence, isolate 24Y06HCC 2324....................2344100
AB014384.1 Hepatitis B virus genomic DNA, complete sequence, isolate 25Y07HCC 2324....................2344100
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 2324....................2344100
AB014388.1 Hepatitis B virus genomic DNA, complete sequence, isolate 29Y11HCC 2270....................2290100
AB014392.1 Hepatitis B virus genomic DNA, complete sequence, isolate 33Y15HCC 2324....................2344100
AB014393.1 Hepatitis B virus genomic DNA, complete sequence, isolate 34Y16HCC 2324....................2344100
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 2324....................2344100
AB014397.1 Hepatitis B virus genomic DNA, complete sequence, isolate 38Y20HCC 2294....................2314100
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 2324....................2344100
AJ131569.1 Hepatitis B virus complete genome, isolate gib759 511....................531100
AJ131571.1 Hepatitis B virus complete genome, isolate gib645 511....................531100
AJ131572.1 Hepatitis B virus complete genome, isolate gib160 511....................531100
AJ131573.1 Hepatitis B virus complete genome, isolate gib153 511....................531100
AJ131575.1 Hepatitis B virus complete genome, isolate chimp82 511....................531100
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 2326....................2346100
AF068756.1 Hepatitis B virus, complete genome 2327....................2347100
AF100308.1 Hepatitis B virus strain 2-18, complete genome 2326....................2346100
AF100309.1 Hepatitis B virus strain 56, complete genome 2326....................2346100
AJ131133.1 Hepatitis B virus, complete genome, strain JL1 2323....................2343100
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 2321....................2341100
Y18856.1 Hepatitis B virus complete genome, isolate HBV-C5 2321....................2341100
Y18857.1 Hepatitis B virus complete genome, isolate HBV-C6 2321....................2341100
Y18858.1 Hepatitis B virus complete genome, isolate HBV-C7 2321....................2341100
AF143301.1 Hepatitis B virus clone BW1903, complete genome 511....................531100
AF143304.1 Hepatitis B virus clone HD319, complete genome 487....................507100
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 951....................971100
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 951....................971100
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 951....................971100
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 951....................971100
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 951....................971100
AB031262.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietA-32324....................2344100
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-22324....................2344100
AB031266.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-32324....................2344100
AB031267.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-62324....................2344100
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 2326....................2346100
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 2326....................2346100
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 2322....................2342100
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 2322....................2342100
AB026815.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 2:full 2322....................2342100
AB033550.1 Hepatitis B virus DNA, complete genome 2324....................2344100
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 2324....................2344100
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 2324....................2344100
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 2324....................2344100
AB033554.1 Hepatitis B virus DNA, complete genome, isolate:RTB299 2324....................2344100
AB033555.1 Hepatitis B virus DNA, complete genome, isolate:PAD744 2324....................2344100
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 2324....................2344100
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 2324....................2344100
AB010289.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-1 2324....................2344100
AB010290.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-2 2324....................2344100
AB010291.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-3 2324....................2344100
AB032432.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch2562324....................2344100
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch2582324....................2344100
AF121243.1 Hepatitis B virus isolate HBV/14611, complete genome 2324....................2344100
AF121244.1 Hepatitis B virus isolate HBV/15122, complete genome 2324....................2344100
AF121245.1 Hepatitis B virus isolate HBV/16091, complete genome 2324....................2344100
AF121246.1 Hepatitis B virus isolate HBV/IK29902, complete genome 2324....................2344100
AF121247.1 Hepatitis B virus isolate HBV/719, complete genome 2324....................2344100
AF121249.1 Hepatitis B virus isolate HBV/4014, complete genome 2324....................2344100
AF121250.1 Hepatitis B virus isolate HBV/6395, complete genome 2324....................2344100
AF121251.1 Hepatitis B virus isolate HBV/9873, complete genome 2324....................2344100
AF193863.1 Orangutan hepadnavirus strain Somad, complete genome 2324....................2344100
AF193864.1 Orangutan hepadnavirus strain Papa, complete genome 2324....................2344100
AF222323.1 Hepatitis B virus isolate CH926, complete genome 2326....................2346100
AF233236.1 Hepatitis B virus strain adw2 isolate HBV334, complete genome 365....................385100
AF242586.1 Hepatitis B virus isolate CHIMP_4, complete genome 2324....................2344100
AF282917.1 Hepatitis B virus isolate HBV-B1, complete genome 2324....................2344100
AF282918.1 Hepatitis B virus isolate HBV-B2, complete genome 2324....................2344100
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 2326....................2346100
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 2326....................2346100
AF182804.1 Hepatitis B virus strain WLAP10, complete genome 2326....................2346100
AF182805.1 Hepatitis B virus strain WLAID, complete genome 2293....................2313100
AF241407.1 Hepatitis B virus isolate 11141, complete genome 2324....................2344100
AF241408.1 Hepatitis B virus isolate 14118, complete genome 2324....................2344100
AF241409.1 Hepatitis B virus isolate 6871, complete genome 2324....................2344100
AF241410.1 Hepatitis B virus isolate 3270, complete genome 2324....................2344100
AF241411.1 Hepatitis B virus isolate 8290, complete genome 2324....................2344100
AB050018.1 Hepatitis B virus DNA, complete genome 2324....................2344100
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 2324....................2344100
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 2324....................2344100
AB042284.1 Hepatitis B virus DNA, complete genome, isolate:NSS-3 2324....................2344100
AB042285.1 Hepatitis B virus DNA, complete genome, isolate:NSS-4 2324....................2344100
AB036905.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-2324....................2344100
AB036906.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-2315....................2335100
AB036907.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-2315....................2335100
AB036908.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2315....................2335100
AB036909.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-2324....................2344100
AB036910.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036911.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036912.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036913.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036914.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036915.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036916.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036917.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036918.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2238....................2258100
AB036919.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB036920.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2324....................2344100
AB037927.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Makiko 2324....................2344100
AB037928.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Yohko 2324....................2344100
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 2324....................2344100
AB049610.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN29 2324....................2344100
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 2324....................2344100
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 2324....................2344100
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 2324....................2344100
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 2324....................2344100
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 2324....................2344100
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 2324....................2344100
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 2324....................2344100
AF223962.1 Hepatitis B virus strain C-1858 isolate sa4, complete genome 2324....................2344100
AF223963.1 Hepatitis B virus strain C-1858 isolate sa11, complete genome 2324....................2344100
AF223964.1 Hepatitis B virus strain C-1858 isolate sa14, complete genome 2324....................2344100
AF223965.1 Hepatitis B virus strain C-1858 isolate sa16, complete genome 2324....................2344100
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 2324....................2344100
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2324....................2344100
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2324....................2344100
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2324....................2344100
AB048704.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2324....................2344100
AB048705.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2324....................2344100
AF330110.1 Hepatitis B virus strain T-1858 genotype C, complete genome 2324....................2344100
AF363961.1 Hepatitis B virus strain G683-1, complete genome 504....................524100
AF363962.1 Hepatitis B virus strain G683-2, complete genome 504....................524100
AF363963.1 Hepatitis B virus strain G683-3, complete genome 504....................524100
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 504....................524100
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 504....................524100
AY040627.1 Hepatitis B virus genotype C, complete genome 2324....................2344100
AJ309369.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 102324....................2344100
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 112324....................2344100
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 112324....................2344100
AF297619.1 Hepatitis B virus adw2, complete genome 2324....................2344100
AF297620.1 Hepatitis B virus adw1, complete genome 2324....................2344100
AF297621.1 Hepatitis B virus isolate 78, complete genome 2324....................2344100
AF297623.1 Hepatitis B virus isolate 83, complete genome 2273....................2293100
AF297624.1 Hepatitis B virus isolate 80, complete genome 2324....................2344100
AF297625.1 Hepatitis B virus isolate 84, complete genome 2324....................2344100
AF411408.1 Hepatitis B virus strain FMU#14, complete genome 2326....................2346100
AF411410.1 Hepatitis B virus strain FMC#20, complete genome 2299....................2319100
AF411411.1 Hepatitis B virus strain FMC#97, complete genome 2326....................2346100
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 2324....................2344100
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 2324....................2344100
AY033072.1 Hepatitis B virus serotype ayw1, complete genome 504....................524100
AY033073.1 Hepatitis B virus serotype ayw1, complete genome 504....................524100
AY066028.1 Hepatitis B virus isolate FH4, complete genome 2326....................2346100
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 2324....................2344100
AB064316.1 Hepatitis B virus DNA, complete genome, clone:US2573 2324....................2344100
AF458665.1 Hepatitis B virus isolate C733, complete genome 2326....................2346100
AF461357.1 Hepatitis B virus isolate FH5, compete genome 2326....................2346100
AF461358.1 Hepatitis B virus isolate FH8, compete genome 2107....................2127100
AF461359.1 Hepatitis B virus isolate c16, compete genome 2107....................2127100
AF461361.1 Hepatitis B virus isolate FH3Q, compete genome 2320....................2340100
AF461362.1 Hepatitis B virus isolate FH10, compete genome 2366....................2386100
AF461363.1 Hepatitis B virus isolate C8, compete genome 2326....................2346100
AF461043.1 Hepatitis B virus, complete genome 2324....................2344100
AF462041.1 Hepatitis B virus clone pAM6, complete genome 2323....................2343100
AJ344117.1 Hepatitis B virus complete genome, genotype D 2324....................2344100
AF473543.1 Hepatitis B virus isolate 2e, complete genome 2324....................2344100
AF479684.1 Hepatitis B virus isolate 3c, complete genome 2324....................2344100
U87742.3 Hepatitis B virus isolate 7983, complete genome 2336....................2356100
U87746.3 Hepatitis B virus isolate 7782, complete genome 2359....................2379100
AB073821.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi20 2324....................2344100
AB073823.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi35 2324....................2344100
AB073824.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi4 2324....................2344100
AB073825.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi51 2324....................2344100
AB073826.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi89 2324....................2344100
AB073827.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK11 2324....................2344100
AB073828.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK37 2324....................2344100
AB073829.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK38 2324....................2344100
AB073831.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH61 2324....................2344100
AB073832.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th65 2324....................2344100
AB073833.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi59 2324....................2344100
AB073834.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi16 2324....................2344100
AB073835.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi29 2324....................2344100
AB073836.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw25 2324....................2344100
AB073837.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ku1 2324....................2344100
AB073840.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw36 2324....................2344100
AB073841.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw30 2324....................2344100
AB073842.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw11 2324....................2344100
AB073843.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw27 2324....................2344100
AB073844.1 Hepatitis B virus DNA, complete genome, isolate:HBV-T11 2324....................2344100
AB073845.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ya16 2324....................2344100
AB073846.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry565 2324....................2344100
AB073847.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Fu53 2324....................2344100
AB073848.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HUS 2324....................2344100
AB073850.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na102 2324....................2344100
AB073852.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry11 2324....................2344100
AB073853.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry24 2324....................2344100
AB073854.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry30 2324....................2344100
AB073855.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry34 2324....................2344100
AB073857.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry48 2324....................2344100
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 2324....................2344100
U87747.3 Hepatitis B virus isolate Wong, complete genome 2327....................2347100
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 2324....................2344100
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 2324....................2344100
AY090455.1 Hepatitis B virus strain 1889Nic, complete genome 2327....................2347100
AY090456.1 Hepatitis B virus strain 1980Nic, complete genome 2273....................2293100
AY090458.1 Hepatitis B virus strain 70H, complete genome 2327....................2347100
AY090459.1 Hepatitis B virus strain 7768H, complete genome 2327....................2347100
AY090461.1 Hepatitis B virus strain 1116Sal, complete genome 2327....................2347100
AY123424.1 Hepatitis B virus, complete genome 2326....................2346100
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro2324....................2344100
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro2324....................2344100
AY123041.1 Hepatitis B virus serotype adr, complete genome 2198....................2218100
AY128092.1 Hepatitis B virus clone pEco63, complete genome 2326....................2346100
AF286594.1 Hepatitis B virus subtype adr, complete genome 2324....................2344100
AF536524.1 Hepatitis B virus clone 2A, complete genome 2324....................2344100
AF533983.1 Hepatitis B virus genotype C, complete genome 2324....................2344100
AF418675.1 Hepatitis B virus patient 1185 clone 2, complete genome 2319....................2339100
AF418684.1 Hepatitis B virus patient 313 clone 1, complete genome 2324....................2344100
AF418685.1 Hepatitis B virus patient 313 clone 2, complete genome 2324....................2344100
AF418686.1 Hepatitis B virus patient 313 clone 3, complete genome 2320....................2340100
AF418687.1 Hepatitis B virus patient 313 clone 4, complete genome 2321....................2341100
AF418688.1 Hepatitis B virus patient 313 clone 5, complete genome 2322....................2342100
AF418689.1 Hepatitis B virus patient 313 clone 6, complete genome 2323....................2343100
AF418690.1 Hepatitis B virus patient 313 clone 7, complete genome 2324....................2344100
AF418691.1 Hepatitis B virus patient 313 clone 8, complete genome 2323....................2343100
AF418692.1 Hepatitis B virus patient 313 clone 9, complete genome 2325....................2345100
AB086397.1 Hepatitis B virus X, C genes for X protein, core protein, complete c2324....................2344100
AY163869.1 Hepatitis B virus isolate FMClx-1, complete genome 2326....................2346100
AY163870.1 Hepatitis B virus isolate FMU001, complete genome 2326....................2346100
AY161138.1 Hepatitis B virus clone S1.1 complete genome 2327....................2347100
AY161139.1 Hepatitis B virus clone S1.2 complete genome 2324....................2344100
AY161147.1 Hepatitis B virus clone S5.1 complete genome 2323....................2343100
AY161148.1 Hepatitis B virus clone S5.2 complete genome 2321....................2341100
AY161149.1 Hepatitis B virus clone S5.3 complete genome 2323....................2343100
AY161150.1 Hepatitis B virus clone S6.1 complete genome 2324....................2344100
AY161151.1 Hepatitis B virus clone S6.2, complete genome 2324....................2344100
AY161152.1 Hepatitis B virus clone S6.3, complete genome 2324....................2344100
AY161153.1 Hepatitis B virus clone S6.4 complete genome 2324....................2344100
AY161154.1 Hepatitis B virus clone S6.5, complete genome 2324....................2344100
AY161155.1 Hepatitis B virus clone S6.6, complete genome 2324....................2344100
AY161156.1 Hepatitis B virus clone S6.7, complete genome 2324....................2344100
AY148342.1 Hepatitis B virus, complete genome 504....................524100
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 2199....................2219100
AY217373.1 Hepatitis B virus isolate 594, complete genome 2328....................2348100
AY217374.1 Hepatitis B virus isolate 595, complete genome 2311....................2331100
AY217375.1 Hepatitis B virus isolate 599, complete genome 2344....................2364100
AY217376.1 Hepatitis B virus isolate Q1-1, complete genome 2315....................2335100
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 2114....................2134100
AY217378.1 Hepatitis B virus isolate Q3-2, complete genome 2313....................2333100
AY217355.1 Hepatitis B virus isolate A6-2, complete genome 2324....................2344100
AY217356.1 Hepatitis B virus isolate A9-2, complete genome 2324....................2344100
AY217357.1 Hepatitis B virus isolate B1r-4, complete genome 2324....................2344100
AY217358.1 Hepatitis B virus isolate B8r-4, complete genome 2324....................2344100
AY217359.1 Hepatitis B virus isolate Q6-5, complete genome 2324....................2344100
AY217360.1 Hepatitis B virus isolate 6-4, complete genome 2324....................2344100
AY217363.1 Hepatitis B virus isolate 582-1, complete genome 2325....................2345100
AY217364.1 Hepatitis B virus isolate 586, complete genome 2258....................2278100
AY217366.1 Hepatitis B virus isolate 17127, complete genome 2324....................2344100
AY217367.1 Hepatitis B virus isolate 17993, complete genome 2322....................2342100
AY217368.1 Hepatitis B virus isolate 21949, complete genome 2264....................2284100
AY217369.1 Hepatitis B virus isolate H2, complete genome 2322....................2342100
AY217370.1 Hepatitis B virus isolate 7-2, complete genome 2141....................2161100
AY238972.1 Hepatitis B virus defective isolate FMU023, complete genome 1477....................1497100
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 2324....................2344100
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 2324....................2344100
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 2324....................2344100
AY226578.1 Woolly monkey hepatitis B virus clone WMHBV-2, complete genome 2326....................2346100
AY206375.1 Hepatitis B virus strain FMU004 complete genome 2326....................2346100
AY206376.1 Hepatitis B virus strain FMU005 complete genome 2326....................2346100
AY206377.1 Hepatitis B virus strain FMU006 complete genome 2359....................2379100
AY206378.1 Hepatitis B virus strain FMU007 complete genome 2290....................2310100
AY206379.1 Hepatitis B virus strain FMU008 complete genome 2326....................2346100
AY206382.1 Hepatitis B virus strain FMU011 complete genome 2326....................2346100
AY206384.1 Hepatitis B virus strain FMU013 complete genome 2326....................2346100
AY206385.1 Hepatitis B virus strain FMU014 complete genome 2293....................2313100
AY206386.1 Hepatitis B virus strain FMU015 complete genome 2326....................2346100
AY206388.1 Hepatitis B virus strain FMU017 complete genome 2212....................2232100
AY206389.1 Hepatitis B virus strain FMU018 complete genome 2326....................2346100
AY206390.1 Hepatitis B virus strain FMU019 complete genome 2326....................2346100
AY206391.1 Hepatitis B virus strain FMU020 complete genome 2326....................2346100
AY206392.1 Hepatitis B virus strain FMU021 complete genome 2326....................2346100
AY220697.1 Hepatitis B virus strain GYF634, complete genome 2326....................2346100
AY220698.1 Hepatitis B virus strain 536207, complete genome 2326....................2346100
AY220700.1 Hepatitis B virus strain MH534978, complete genome 2326....................2346100
AY220703.1 Hepatitis B virus strain WZJ319, complete genome 2326....................2346100
AY220704.1 Hepatitis B virus strain WZJ942, complete genome 2326....................2346100
AY306136.1 Hepatitis B virus isolate H85, complete genome 2324....................2344100
AY233274.1 Hepatitis B virus isolate 0962 complete genome 2324....................2344100
AY233275.1 Hepatitis B virus isolate 163 complete genome 2324....................2344100
AY233276.1 Hepatitis B virus isolate 1839 complete genome 2324....................2344100
AY233277.1 Hepatitis B virus isolate 1848 complete genome 2324....................2344100
AY233278.1 Hepatitis B virus isolate 1 complete genome 2324....................2344100
AY233279.1 Hepatitis B virus isolate 28 complete genome 2324....................2344100
AY233280.1 Hepatitis B virus isolate 2 complete genome 2324....................2344100
AY233281.1 Hepatitis B virus isolate 303 complete genome 2324....................2344100
AY233282.1 Hepatitis B virus isolate 306 complete genome 2324....................2344100
AY233283.1 Hepatitis B virus isolate 4038 complete genome 2324....................2344100
AY233284.1 Hepatitis B virus isolate 5283 complete genome 2324....................2344100
AY233285.1 Hepatitis B virus isolate 795 complete genome 2324....................2344100
AY233286.1 Hepatitis B virus isolate 818 complete genome 2324....................2344100
AY233287.1 Hepatitis B virus isolate 8225 complete genome 2324....................2344100
AY233288.1 Hepatitis B virus isolate 823 complete genome 2324....................2344100
AY233289.1 Hepatitis B virus isolate 833 complete genome 2324....................2344100
AY233290.1 Hepatitis B virus isolate 85 complete genome 2324....................2344100
AY167089.1 Hepatitis B virus isolate Ia, complete genome 2324....................2344100
AY167090.1 Hepatitis B virus isolate Ib, complete genome 2324....................2344100
AY167091.1 Hepatitis B virus isolate Ic, complete genome 2339....................2359100
AY167092.1 Hepatitis B virus isolate Id, complete genome 2288....................2308100
AY167093.1 Hepatitis B virus isolate IIa, complete genome 2324....................2344100
AY167094.1 Hepatitis B virus isolate IIb, complete genome 2324....................2344100
AY167095.1 Hepatitis B virus isolate IIc, complete genome 2324....................2344100
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 2324....................2344100
AY167097.1 Hepatitis B virus isolate IIIb, complete genome 2324....................2344100
AY167099.1 Hepatitis B virus isolate IVb, complete genome 2324....................2344100
AY167101.1 Hepatitis B virus isolate Vb, complete genome 2324....................2344100
AY167102.1 Hepatitis B virus isolate Vc, complete genome 2324....................2344100
AY330916.1 Hepatitis B virus isolate Tbblack complete genome 2324....................2344100
AY330917.1 Hepatitis B virus isolate Crazywoman complete genome 2324....................2344100
AB115551.1 Hepatitis B virus DNA, complete genome, isolate:HBV-CB15 2324....................2344100
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co2322....................2342100
AB105172.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 2 2324....................2344100
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 162324....................2344100
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 602324....................2344100
AY179734.1 Hepatitis B virus genotype F isolate BA9, complete genome 2324....................2344100
AY179735.1 Hepatitis B virus genotype F isolate BA10, complete genome 2324....................2344100
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 2324....................2344100
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 2324....................2344100
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 2324....................2344100
AY311369.1 Hepatitis B virus isolate BD4139, complete genome 2324....................2344100
AY311370.1 Hepatitis B virus isolate BD14999, complete genome 2324....................2344100
AY293309.1 Hepatitis B virus strain Whutj-37, complete genome 951....................971100
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 2324....................2344100
AB111112.1 Hepatitis B virus DNA, complete genome, clone: HS-0 2324....................2344100
AB111113.1 Hepatitis B virus DNA, complete genome, clone: HS-6 2324....................2344100
AB111114.1 Hepatitis B virus DNA, complete genome, clone: HS-12 2324....................2344100
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 2263....................2283100
AB111117.1 Hepatitis B virus DNA, complete genome, clone: K5-13 2276....................2296100
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 2401....................2421100
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 2324....................2344100
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 2324....................2344100
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 2324....................2344100
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 2324....................2344100
AB111123.1 Hepatitis B virus DNA, complete genome, clone: KM4-12 2324....................2344100
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 2324....................2344100
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 2324....................2344100
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 2324....................2344100
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 2324....................2344100
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 2324....................2344100
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 2315....................2335100
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 2324....................2344100
AB112472.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH124 2324....................2344100
AY518556.1 Hepatitis B virus isolate 57-1 subtype adw, complete genome 2324....................2344100
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 2324....................2344100
AB117759.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB14 2324....................2344100
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 2324....................2344100
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 2324....................2344100
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 2324....................2344100
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 2324....................2344100
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 2324....................2344100
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 2324....................2344100
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 2324....................2344100
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 2324....................2344100
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 2324....................2344100
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 2324....................2344100
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 2324....................2344100
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 2324....................2344100
AB116089.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP39 2324....................2344100
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 2324....................2344100
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 2324....................2344100
AB116092.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH20 2324....................2344100
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 2324....................2344100
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 2324....................2344100
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 2324....................2344100
AB115417.1 Hepatitis B virus DNA, complete genome, isolate:HBV-O47 2324....................2344100
AB106895.1 Hepatitis B virus DNA, complete genome, isolate:pHB4-4 2324....................2344100
AB116549.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM5 2324....................2344100
AB116550.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM6 2324....................2344100
AB116551.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ2 2324....................2344100
AB116552.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ4 2324....................2344100
AY596102.1 Hepatitis B virus isolate Ia-1, complete genome 2324....................2344100
AY596103.1 Hepatitis B virus isolate Ia-2, complete genome 2324....................2344100
AY596104.1 Hepatitis B virus isolate Ia-4, complete genome 2324....................2344100
AY596106.1 Hepatitis B virus isolate Ia-6, complete genome 2324....................2344100
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 2324....................2344100
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 2324....................2344100
AY596109.1 Hepatitis B virus isolate II-1, complete genome 2324....................2344100
AY596110.1 Hepatitis B virus isolate II-2, complete genome 2324....................2344100
AY596112.1 Hepatitis B virus isolate Ia-7, complete genome 2324....................2344100
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 2326....................2346100
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 2324....................2344100
AB176643.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NK1 2280....................2300100
AY766463.1 Hepatitis B virus strain GDH1 from China, complete genome 2324....................2344100
AY781177.1 Hepatitis B virus strain BG21, complete genome 2324....................2344100
AY781178.1 Hepatitis B virus strain G12, complete genome 2324....................2344100
AY781179.1 Hepatitis B virus strain GIII_14, complete genome 2324....................2344100
AY781180.1 Hepatitis B virus strain GIII_15, complete genome 2324....................2344100
AY781181.1 Hepatitis B virus strain GIII_16, complete genome 2324....................2344100
AY781182.1 Hepatitis B virus strain GIII_17, complete genome 2324....................2344100
AY781183.1 Hepatitis B virus strain GII_11, complete genome 2324....................2344100
AY781184.1 Hepatitis B virus strain GII_8, complete genome 2324....................2344100
AY781185.1 Hepatitis B virus strain GI_19, complete genome 2324....................2344100
AY781187.1 Hepatitis B virus strain SG_III, complete genome 2324....................2344100
AY641558.1 Hepatitis B virus isolate He74, complete genome 2324....................2344100
AY641559.1 Hepatitis B virus isolate He53, complete genome 2324....................2344100
AY641560.1 Hepatitis B virus isolate He100, complete genome 2324....................2344100
AY641561.1 Hepatitis B virus isolate He127, complete genome 2324....................2344100
AY641562.1 Hepatitis B virus isolate He82, complete genome 2324....................2344100
AY641563.1 Hepatitis B virus isolate He52, complete genome 2324....................2344100
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 2315....................2335100
AY800391.1 Hepatitis B virus isolate ZY041026, complete genome 2324....................2344100
AY800392.1 Hepatitis B virus isolate ZY041027, complete genome 2324....................2344100
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 2326....................2346100
AB113875.1 Hepatitis B virus DNA, complete genome, strain:HCC-1-MC 2324....................2344100
AB113876.1 Hepatitis B virus DNA, complete genome, strain:HCC-2-NY 2324....................2344100
AB113878.1 Hepatitis B virus DNA, complete genome, strain:Ehime-Lam-MM1-001208 2324....................2344100
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 2324....................2344100
AB198077.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.2 2324....................2344100
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 2324....................2344100
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 2324....................2344100
AB198080.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.5 2324....................2344100
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 2324....................2344100
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 2324....................2344100
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 2324....................2344100
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 2324....................2344100
AY738139.1 Hepatitis B virus clone A1, complete genome 2324....................2344100
AY738140.1 Hepatitis B virus clone A2, complete genome 2324....................2344100
AY738141.1 Hepatitis B virus clone A3, complete genome 2324....................2344100
AY738142.1 Hepatitis B virus clone A4, complete genome 2324....................2344100
AY738143.1 Hepatitis B virus clone A11, complete genome 2324....................2344100
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 2324....................2344100
AJ748098.1 Hepatitis B virus complete genome, genotype C 2324....................2344100
AB205119.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-1 2324....................2344100
AB205120.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-2 2324....................2344100
AB205121.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF720-1 2327....................2347100
AB205122.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH69-1 2324....................2344100
AB205123.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CN578-1 2324....................2344100
AB205124.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ3-1-1 2324....................2344100
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 2324....................2344100
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 2324....................2344100
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 2324....................2344100
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 2324....................2344100
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 2324....................2344100
AY817511.1 Hepatitis B virus isolate CHN-L49 from China, complete genome 2324....................2344100
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 2324....................2344100
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 2324....................2344100
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 2324....................2344100
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 2324....................2344100
AY903452.1 Hepatitis B virus serotype adw2, complete genome 2324....................2344100
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 2324....................2344100
AY934764.1 Hepatitis B virus isolate 9210699, complete genome 2324....................2344100
AY934765.1 Hepatitis B virus isolate 24306, complete genome 2324....................2344100
AY934766.1 Hepatitis B virus isolate 24233, complete genome 2324....................2344100
AY934767.1 Hepatitis B virus isolate 27178, complete genome 2324....................2344100
AY934768.1 Hepatitis B virus isolate 25830, complete genome 2324....................2344100
AY934769.1 Hepatitis B virus isolate 23719, complete genome 2324....................2344100
AY934770.1 Hepatitis B virus isolate 953642, complete genome 2324....................2344100
AY934771.1 Hepatitis B virus isolate 27439, complete genome 2324....................2344100
AY934772.1 Hepatitis B virus isolate 1908, complete genome 2324....................2344100
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 2324....................2344100
AY934774.1 Hepatitis B virus isolate 9615549, complete genome 2324....................2344100
DQ020002.1 Hepatitis B virus isolate 380, complete genome 2324....................2344100
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 2324....................2344100
AB212625.1 Hepatitis B virus DNA, complete genome, isolateVT1026 2324....................2344100
AB212626.1 Hepatitis B virus DNA, complete genome, isolateVT1022 2324....................2344100
AB214516.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BL597 2324....................2344100
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 2324....................2344100
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 2324....................2344100
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 2324....................2344100
AB194952.1 Hepatitis B virus DNA, complete genome, isolate: CMR711 2324....................2344100
DQ078791.1 Hepatitis B virus from Thailand, complete genome 2325....................2345100
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 2291....................2311100
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 2324....................2344100
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 2324....................2344100
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 2324....................2344100
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 2324....................2344100
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 2324....................2344100
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 2324....................2344100
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 2324....................2344100
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 2324....................2344100
DQ089765.1 Hepatitis B virus isolate HK428, complete genome 2324....................2344100
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 2324....................2344100
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 2324....................2344100
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 2324....................2344100
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 2324....................2344100
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 2324....................2344100
DQ089771.1 Hepatitis B virus isolate HK1629, complete genome 2324....................2344100
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 2324....................2344100
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 2324....................2344100
DQ089774.1 Hepatitis B virus isolate HK858, complete genome 2325....................2345100
DQ089775.1 Hepatitis B virus isolate HK290, complete genome 2324....................2344100
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 2324....................2344100
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 2324....................2344100
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 2324....................2344100
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 2324....................2344100
DQ089780.1 Hepatitis B virus isolate HK947, complete genome 2324....................2344100
DQ089781.1 Hepatitis B virus isolate HK1476, complete genome 2324....................2344100
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 2324....................2344100
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 2324....................2344100
DQ089785.1 Hepatitis B virus isolate HK1386, complete genome 2324....................2344100
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 2324....................2344100
DQ089787.1 Hepatitis B virus isolate HK352, complete genome 2324....................2344100
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 2324....................2344100
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 2324....................2344100
DQ089790.1 Hepatitis B virus isolate HK1248, complete genome 2324....................2344100
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 2324....................2344100
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 2324....................2344100
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 2277....................2297100
DQ089795.1 Hepatitis B virus isolate HK1465, complete genome 2327....................2347100
DQ089797.1 Hepatitis B virus isolate HK1169, complete genome 2324....................2344100
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 2324....................2344100
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 2324....................2344100
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 2285....................2305100
DQ089801.1 Hepatitis B virus isolate HK2100, complete genome 2324....................2344100
DQ089802.1 Hepatitis B virus isolate HK1371, complete genome 2324....................2344100
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 2324....................2344100
DQ089804.1 Hepatitis B virus isolate HK262, complete genome 2324....................2344100
AY862860.1 Hepatitis B virus clone Q11, complete genome 2324....................2344100
AY862861.1 Hepatitis B virus clone Q17, complete genome 2324....................2344100
AY862862.1 Hepatitis B virus clone Q20, complete genome 2324....................2344100
AY862863.1 Hepatitis B virus clone Q23, complete genome 2324....................2344100
AY862864.1 Hepatitis B virus clone Q34, complete genome 2324....................2344100
AY862865.1 Hepatitis B virus clone Q311, complete genome 2324....................2344100
AY862866.1 Hepatitis B virus clone Q312, complete genome 2326....................2346100
AY862867.1 Hepatitis B virus clone Q42, complete genome 2324....................2344100
AY862868.1 Hepatitis B virus clone Q43, complete genome 2324....................2344100
AY862869.1 Hepatitis B virus clone Q80, complete genome 2324....................2344100
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 2324....................2344100
AB231909.1 Hepatitis B virus DNA, complete genome, isolate:VH10 2324....................2344100
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 925....................945100
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 4140....................4160100
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 907....................927100
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 4122....................4142100
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 504....................524100
DQ298162.1 Hepatitis B virus isolate LT3.12AM clone 2, complete genome 504....................524100
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 504....................524100
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 504....................524100
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 504....................524100
AB182589.1 Hepatitis B virus DNA, complete genome, isolate:CH:Mat-Ko 2324....................2344100
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 2303....................2323100
DQ361535.1 Hepatitis B virus isolate CRP-228, complete genome 2294....................2314100
DQ377158.1 Hepatitis B virus isolate WJT31, complete genome 2324....................2344100
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 2305....................2325100
DQ377160.1 Hepatitis B virus isolate WJT16, complete genome 2324....................2344100
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 2324....................2344100
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 2324....................2344100
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 2324....................2344100
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 2324....................2344100
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 2324....................2344100
AB247916.1 Hepatitis B virus DNA, complete genome, lamivudine resistance with in2324....................2344100
AJ627225.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 19749 2324....................2344100
AJ627226.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20952 2315....................2335100
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 2324....................2344100
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 2324....................2344100
DQ315782.1 Hepatitis B virus isolate EI0423, complete genome 2315....................2335100
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 2324....................2344100
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 2324....................2344100
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 2324....................2344100
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 2324....................2344100
AB250109.1 Hepatitis B virus DNA, complete genome, isolate: IH030213 2274....................2294100
AB205152.1 Hepatitis B virus DNA, complete genome, isolate: HB-JFH7-99 2324....................2344100
AB219426.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4014, PNN1 2324....................2344100
AB219427.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4075, PNN2 2324....................2344100
AB219428.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4076, PNN3 2324....................2344100
AB219429.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4101, PNN4 2324....................2344100
AB219430.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4148, PNN5 2324....................2344100
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 2324....................2344100
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 2324....................2344100
AB222714.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7 2324....................2344100
AB222715.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7M 2324....................2344100
DQ448619.1 Hepatitis B virus isolate GZ-DYH, complete genome 2324....................2344100
DQ448620.1 Hepatitis B virus isolate GZ-DYF, complete genome 2324....................2344100
DQ448621.1 Hepatitis B virus isolate GZ-HQY, complete genome 2324....................2344100
DQ448622.1 Hepatitis B virus isolate GZ-JSM, complete genome 2324....................2344100
DQ448623.1 Hepatitis B virus isolate GZ-LMX, complete genome 2324....................2344100
DQ448624.1 Hepatitis B virus isolate GZ-QSA, complete genome 2324....................2344100
DQ448625.1 Hepatitis B virus isolate GZ-TXB, complete genome 2324....................2344100
DQ448626.1 Hepatitis B virus isolate GZ-XLB, complete genome 2324....................2344100
DQ448627.1 Hepatitis B virus isolate GZ-ZFL, complete genome 2324....................2344100
DQ448628.1 Hepatitis B virus isolate GZ-ZX, complete genome 2324....................2344100
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 2324....................2344100
DQ463787.1 Hepatitis B virus isolate 928-9_1979, complete genome 2324....................2344100
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 2324....................2344100
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 2324....................2344100
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 2324....................2344100
DQ463791.1 Hepatitis B virus isolate 539-16_1979, complete genome 2324....................2344100
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 2324....................2344100
DQ463793.1 Hepatitis B virus isolate 462-4_1979, complete genome 2324....................2344100
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 2324....................2344100
DQ463795.1 Hepatitis B virus isolate 928-9_2004, complete genome 2324....................2344100
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 2324....................2344100
DQ463797.1 Hepatitis B virus isolate 650-15_2004, complete genome 2324....................2344100
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 2324....................2344100
DQ463799.1 Hepatitis B virus isolate 539-16_2004, complete genome 2324....................2344100
DQ463800.1 Hepatitis B virus isolate 524-3_2004, complete genome 2324....................2344100
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 2324....................2344100
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 2324....................2344100