../../tmp/servers/virsirnadb/73407230
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi23041accttctgctgtcagtatccg21
AY847351.1 Lymphocytic choriomeningitis virus Armstrong 53b segment RNA L, compl255.....................275100
AY847351.1 Lymphocytic choriomeningitis virus Armstrong 53b segment RNA L, compl2432_____..........a.g.__241957
DQ361066.1 Lymphocytic choriomeningitis virus clone 13 segment L, complete seque256.....................276100
DQ361066.1 Lymphocytic choriomeningitis virus clone 13 segment L, complete seque2433_____..........a.g.__242057
AF004519.1 Lymphocytic choriomeningitis virus Z protein and L protein genes, com255.t..c...........t....27585
AF004519.1 Lymphocytic choriomeningitis virus Z protein and L protein genes, com2423_____..........______241447
EU480451.1 Lymphocytic choriomeningitis virus segment L, complete sequence 257.t..............c..t.27785
EU480453.1 Lymphocytic choriomeningitis virus segment L, complete sequence 257.t..............c..t.27785
NC_004291.1 Lymphocytic choriomeningitis virus segment L, complete sequence 4797_____..........a.g.__481057
NC_004294.1 Lymphocytic choriomeningitis virus segment S, complete sequence 3230_____.........t..____321952
AY847350.1 Lymphocytic choriomeningitis virus Armstrong 53b segment RNA S, compl3230_____.........t..____321952
DQ361065.2 Lymphocytic choriomeningitis virus clone 13 segment S, complete seque3231_____.........t..____322052
FJ895882.1 Lymphocytic choriomeningitis virus strain CABN segment S, complete se3206_____.........t..____319552
FJ895884.1 Lymphocytic choriomeningitis virus strain SN05 segment S, complete se3206_____.........t..____319552
EU195889.1 Lymphocytic choriomeningitis virus strain MX L protein gene, complete2690.a.........._________267952
EU195889.1 Lymphocytic choriomeningitis virus strain MX L protein gene, complete1302________.........____131042
DQ286931.1 Lymphocytic choriomeningitis virus isolate Marseille #12 segment S, c3230_____........._______322242
AB261990.1 Lymphocytic choriomeningitis virus genomic RNA, segment S, nearly com3234_____........._______322642
AB261991.1 Lymphocytic choriomeningitis virus genomic RNA, segment S, nearly com3234_____........._______322642
FJ895883.1 Lymphocytic choriomeningitis virus strain GR01 segment S, complete se3210_____........._______320242