../../tmp/servers/virsirnadb/972116027
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi17751agaaattggctcgaattgttttaatatta29
AF316321.2 Enterovirus 5865/sin/000009, complete genome 7305.............................7333100
AF352027.1 Enterovirus 5666/sin/002209, complete genome 7305.............................7333100
AJ586873.1 Human enterovirus 71 gene for polyprotein, isolate EV71/9/97/SHA89 7305.............................7333100
DQ341365.1 Human enterovirus 71 isolate PP37-MAL-01, complete genome 7305.............................7333100
DQ341366.1 Human enterovirus 71 isolate SB2864-SAR-00, complete genome 7305.............................7333100
AM396587.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate UH1/P7305.............................7333100
EF373575.1 Human enterovirus 71 strain E2002042-TW-CDC polyprotein gene, complet7307.............................7335100
AB550336.1 Human enterovirus 71 genomic RNA, complete genome, strain: C7/Osaka-o7306.............................7334100
AB550337.1 Human enterovirus 71 genomic RNA, complete genome, strain: C7/Osaka-L7306.............................7334100
AM396584.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate ENT/P7302.........................t...733096
FJ461781.1 Human enterovirus 71 isolate NUH0083/SIN/08, complete genome 7270.................a...........729896
AB550332.1 Human enterovirus 71 genomic RNA, complete genome, strain: 1095-org 7303........................a....733196
AB550333.1 Human enterovirus 71 genomic RNA, complete genome, strain: 1095-LPS1 7303........................a....733196
AF136379.1 Enterovirus 71 isolate NCKU9822 polyprotein mRNA, complete cds 7304........................at...733293
AF119796.3 Enterovirus 71 strain TW/2086/98 polyprotein gene, complete cds 7302........................at...733093
AF176044.1 Enterovirus 71 polyprotein gene, complete cds 7305........................at...733393
AF304457.1 Enterovirus 71 strain Tainan/5746/98 polyprotein mRNA, complete cds 7304........................at...733293
AF304458.1 Enterovirus 71 strain Tainan/4643/98 polyprotein mRNA, complete cds 7304........................at...733293
AF304459.1 Enterovirus 71 strain Tainan/6092/98 polyprotein mRNA, complete cds 7304........................at...733293
AY421767.1 Human coxsackievirus A10 strain Kowalik, complete genome 7303........................ac...733193
AY421767.1 Human coxsackievirus A10 strain Kowalik, complete genome 6203__________..t.g..........____618944
DQ060149.1 Human enterovirus 71 strain pinf7-54A from Taiwan, complete genome 7304........................at...733293
DQ341357.1 Human enterovirus 71 isolate 7F-AUS-6-99, complete genome 7303........................at...733193
DQ341358.1 Human enterovirus 71 isolate S40221-SAR-00, complete genome 7303........................at...733193
DQ341359.1 Human enterovirus 71 isolate S10862-SAR-98, complete genome 7303........................at...733193
DQ341362.1 Human enterovirus 71 isolate SB12736-SAR-03, complete genome 7306.................a......c....733493
DQ341363.1 Human enterovirus 71 isolate S19841-SAR-03, complete genome 7306.................a......c....733493
DQ341364.1 Human enterovirus 71 isolate 5511-SIN-00, complete genome 7306.................a......c....733493
DQ381846.1 Human enterovirus 71 strain 6F/AUS/6/99, complete genome 7303........................at...733193
AM396585.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate ENT/P7302........................at...733093
EU414334.1 Human enterovirus 71 strain PLday4-CH-06, complete genome 7302......................g.a....733093
EU414335.1 Human enterovirus 71 strain PLday1-CH-06, complete genome 7302......................g.a....733093
AB550340.1 Human enterovirus 71 genomic RNA, complete genome, strain: KED005-org7303........................at...733193
AB550341.1 Human enterovirus 71 genomic RNA, complete genome, strain: KED005-LPS7303........................at...733193
AB575935.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 4807247........................at...727593
AB575938.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1007276...........t.............t...730493
AB575939.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 3657234........................at...726293
HQ423141.1 Human coxsackievirus A16 strain KMM/08, complete genome 7304.................a.........__733089
U22522.1ETU22522 Human enterovirus 71 polyprotein gene, complete cds 7305........................at.._733289
AB482183.1 Human enterovirus 71 genomic RNA, complete genome, strain: Nagoya 7306........................at.._733389
HQ189392.1 Human enterovirus 71 isolate HUN/1978, complete genome 7306........................at.._733389
AB575913.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1197231........................at.._725889
AB575914.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1707240........................at.._726789
AB575918.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 2057242........................ac.._726989
AB575923.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 2027248........................at.._727589
AB575936.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 9617242........................at.._726989
AF119795.2 Enterovirus 71 strain TW/2272/98 polyprotein gene, complete cds 7302........................_____732582
AY421760.1 Human coxsackievirus A2 strain Fleetwood, complete genome 7292..g.....................ac...732089
AY421761.1 Human coxsackievirus A3 strain Olson, complete genome 7289.................a......ac...731789
DQ341355.1 Human enterovirus 71 isolate 06-KOR-00, complete genome 7303.................a......at...733189
DQ341356.1 Human enterovirus 71 isolate 03-KOR-00, complete genome 7303.................a......at...733189
DQ341361.1 Human enterovirus 71 isolate 1M-AUS-12-00, complete genome 7303...........t............at...733189
FJ172159.1 Human enterovirus 71 isolate NUH0075/SIN/08, complete genome 7264..g.....................ac...729289
AB575937.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1417215...........t............at...724389
AF177911.1 Coxsackievirus A16 polyprotein gene, complete cds 7304..g..............a.........__733086
EU262658.1 Human coxsackievirus A16 strain shzh05-1, complete genome 7304.................a.....g...__733086
FJ198212.1 Human coxsackievirus A16 strain GZ08, complete genome 7304..............g..a.........__733086
GQ279371.1 Human coxsackievirus A16 strain SZ/HK08-7, complete genome 7304..............g..a.........__733086
HQ269389.1 Human coxsackievirus A16 isolate XM-CA16-3560, complete genome 7305..............g..a.........__733186
AB575915.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 9447251...............c........at.._727886
AB575916.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1617242...............c........at.._726986
AB575927.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1137241.................a......at.._726886
AB575928.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1157242.................a......at.._726986
AB575941.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 2487242..g.....................ac.._726986
AB575942.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 3697237..g.....................ac.._726486
AB575948.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1017260..g.....................ac.._728786
AY421768.1 Human coxsackievirus A12 strain Texas-12, complete genome 7298.................a......_____732179
U22521.1ETU22521 Human enterovirus 71 polyprotein gene, complete cds 7302..............g..a......ac...733086
AY421763.1 Human coxsackievirus A5 strain Swartz, complete genome 7294..g..............a......at...732286
AY421764.1 Human coxsackievirus A6 strain Gdula, complete genome 7328...............c.a......ac...735686
AY421766.1 Human coxsackievirus A8 strain Donovan, complete genome 7290...............c.a......ac...731886
AB204852.1 Human enterovirus 71 genomic RNA, complete genome, sub_strain:BrCr-TR7302..............g..a......ac...733086
AB204853.1 Human enterovirus 71 genomic RNA, complete genome, sub_strain:BrCr-ts7302..............g..a......ac...733086
DQ341360.1 Human enterovirus 71 isolate J115-MAL-01, complete genome 7302...........t...........gat...733086
DQ452074.1 Human enterovirus 71 strain 804/NO/03, complete genome 7304..g........t............at...733286
EF063152.1 Human enterovirus 71 strain E2005125-TW polyprotein gene, complete cd7303....................c.g.ac...733186
GU434678.1 Human enterovirus 71 strain EV71-Hubei-09-China, complete genome 7302..............g..a......ac...733086
AY790926.1 Human coxsackievirus A16 strain shzh00-1, complete genome 7304..g........t.....a.........__733082
GQ279368.1 Human coxsackievirus A16 strain SZ/HK08-3, complete genome 7304...........t.....a.......g.__733082
AB575917.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1017257...........t...c........at.._728482
AY421765.1 Human coxsackievirus A7 strain Parker, complete genome 7298...........t.....a......_____732175
AY773285.1 Human enterovirus 90 isolate F950027, complete genome 7307...........t...c........_____733075
AY697460.1 Human enterovirus 90 polyprotein gene, complete cds 7308...........t...c........_____733175
FJ606450.1 Human enterovirus 71 strain BJ08-Z025-5, complete genome 7302_.t....................______732372
FJ607337.1 Human enterovirus 71 strain 121/SHENZHEN/08/China/HFMD Fatal/2008, co7301_.t....................______732272
HQ423142.1 Human enterovirus 71 strain KMM/09, complete genome 7302_.c....................______732372
HQ423142.1 Human enterovirus 71 strain KMM/09, complete genome 6877_____________..a..........___686541
HQ423143.1 Human enterovirus 71 strain KM186/09, complete genome 7302_.c....................______732372
HQ423143.1 Human enterovirus 71 strain KM186/09, complete genome 6877_____________..a..........___686541
AY697461.1 Human enterovirus 91 polyprotein gene, complete cds 7310...........t...c......g._____733372
AY421769.1 Human coxsackievirus A14 strain G-14, complete genome 7312_.t..............a.....______733368
AY421769.1 Human coxsackievirus A14 strain G-14, complete genome 1845.....cctt..........__________186351
AY697458.1 Human enterovirus 76 polyprotein gene, complete cds 7321..r..c.....y...c........_____734468
EU131776.1 Human enterovirus 71 strain N3340-TW-02, complete genome 7302_.c..............a.....______732368
EU812514.1 Human coxsackievirus A16 strain FY18 from China, complete genome 7311_.c..............a.....______733268
FJ360545.1 Human enterovirus 71 isolate GZ-08-02, complete genome 7302_.c..............a.....______732368
FJ439769.1 Human enterovirus 71 strain Fuyang-0805, complete genome 7302_.c..............a.....______732368
FJ606448.1 Human enterovirus 71 strain BJ08-Z011-4, complete genome 7302_.c..............a.....______732368
GQ994989.1 Human enterovirus 71 strain Chongqing1-09-China, complete genome 7303_.c...........g........______732468
HQ407557.1 Human enterovirus 71 strain LN009, complete genome 7302_.c..............a.....______732368
HQ325852.1 Human enterovirus 71 strain EV71/HENAN/DC/2010, complete genome 7303_.c..............a.....______732468
HQ891925.1 Human enterovirus 71 strain Shanghai 36-2009, complete genome 7304_.c..............a.....______732568
HQ891926.1 Human enterovirus 71 strain Shanghai 51-2009, complete genome 7304_.c..............a.....______732568
HQ456306.1 Human enterovirus A strain GZ2010-134, complete genome 7302_.c..............a.....______732368
HQ456307.1 Human enterovirus A strain GZ2010-120, complete genome 7302_.c..............a.....______732368
HQ456308.1 Human enterovirus A strain GZ2010-118, complete genome 7302_.c..............a.....______732368
HQ456313.1 Human enterovirus A strain GZ2010-95, complete genome 7302_.c..............a.....______732368
AY697459.1 Human enterovirus 89 polyprotein gene, complete cds 7312...........t...c.a....g._____733568
AF302996.1 Enterovirus 71 strain SHZH98 polyprotein gene, complete cds 7303_.c...........g..a.....______732465
AY465356.1 Human enterovirus 71 strain SHZH03, complete genome 7302_.c...........g..a.....______732365
AY421762.1 Human coxsackievirus A4 strain High Point, complete genome 7331_.c............c.a.....______735265
DQ133458.1 Human enterovirus 71 strain 984 polyprotein gene, complete cds 7302_.t...........g..a.....______732365
DQ133459.1 Human enterovirus 71 strain 1235 polyprotein gene, complete cds 7302_.c...........g..a.....______732365
EF373576.1 Human enterovirus 71 strain E2004104-TW-CDC polyprotein gene, complet7302_.c...........g..a.....______732365
EU703812.1 Human enterovirus 71 strain EV71/Fuyang.Anhui.P.R.C/17.08/1, complete7302_.c...........g..a.....______732365
EU703813.1 Human enterovirus 71 strain EV71/Fuyang.Anhui.P.R.C/17.08/2, complete7302_.c...........g..a.....______732365
EU703814.1 Human enterovirus 71 strain EV71/Fuyang.Anhui.P.R.C/17.08/3, complete7302_.c...........g..a.....______732365
EU812515.1 Human enterovirus 71 strain FY23 from China, complete genome 7305_.c...........g..a.....______732665
EU864507.1 Human enterovirus 71 isolate EV71/Zhejiang08, complete genome 7303_.c...........g..a.....______732465
FJ158600.1 Human enterovirus 71 isolate DTID/ZJU-62, complete genome 7302_.c...........g..a.....______732365
FJ158601.1 Human enterovirus 71 isolate DTID/ZJU-74, complete genome 7302_.c...........g..a.....______732365
FJ194964.1 Human enterovirus 71 strain EV71/GDFS/3/2008, complete genome 7302_.c...........g..a.....______732365
FJ194965.1 Human enterovirus 71 strain EV71/GDSG/17/2008, complete genome 7302_.c...........g..a.....______732365
FJ360544.1 Human enterovirus 71 isolate GZ-08-01, complete genome 7301_.c...........g..a.....______732265
FJ606447.1 Human enterovirus 71 strain BJ08-Z004-3, complete genome 7302_.t...........g..a.....______732365
FJ606449.1 Human enterovirus 71 strain BJ08-Z020-1, complete genome 7302_.c...........g..a.....______732365
FJ713137.1 Human enterovirus 71 strain Shanghai 036-2009, complete genome 7304_.c...........g..a.....______732565
FJ607334.1 Human enterovirus 71 strain 1/SHENZHEN/08/China/HFMD/2008, complete g7301_.c...........g..a.....______732265
FJ607335.1 Human enterovirus 71 strain 4/SHENZHEN/08/China/HFMD/2008, complete g7301_.c...........g..a.....______732265
FJ607336.1 Human enterovirus 71 strain 28/SHENZHEN/08/China/HFMD/2008, complete 7300_.c..c...........a.....______732165
FJ607338.1 Human enterovirus 71 strain 605/SHENZHEN/08/China/HFMD Severe/2008, c7301_.c...........g..a.....______732265
GQ892830.1 Human enterovirus 71 strain GX/LZ 08-04/08/CHN, complete genome 7302_.c...........g..a.....______732365
GQ994988.1 Human enterovirus 71 strain Anhui1-09-China, complete genome 7302_.c...........g..a.....______732365
GQ994990.1 Human enterovirus 71 strain Chongqing2-09-China, complete genome 7302_.c...........g..a.....______732365
GQ994991.1 Human enterovirus 71 strain Chongqing3-09-China, complete genome 7302_.c...........g..a.....______732365
GQ994992.1 Human enterovirus 71 strain Henan2-09-China, complete genome 7294_.c...........g..a.....______731565
GU196833.1 Human enterovirus 71 strain Henan1-09-China polyprotein gene, complet7114_.c...........g..a.....______713565
GU366191.1 Human enterovirus 71 strain Henan10-08-China, complete genome 7302_.c...........g..a.....______732365
GU396280.1 Human enterovirus 71 isolate EV71/Lanzhou01, complete genome 7302_.c...........g..a.....______732365
GU459070.1 Human enterovirus 71 isolate FY23-K12, complete genome 7305_.c...........g..a.....______732665
GU459071.1 Human enterovirus 71 isolate FY23-K14, complete genome 7302_.c...........g..a.....______732365
HM003207.1 Human enterovirus 71 strain 87-2008 Xi'an Shaanxi, complete genome 7302_.c...........g..a.....______732365
GQ279369.1 Human enterovirus 71 strain SZ/HK08-5, complete genome 7302_.t...........g..a.....______732365
GQ279370.1 Human enterovirus 71 strain SZ/HK08-6, complete genome 7302_.c...........g..a.....______732365
HM002484.1 Human enterovirus 71 strain BJ67, complete genome 7302_.c...........g..a.....______732365
HM002485.1 Human enterovirus 71 strain BJ97, complete genome 7302_.c...........g..a.....______732365
HM002486.1 Human enterovirus 71 strain BJ110, complete genome 7303_.c...........g..a.....______732465
HM002487.1 Human enterovirus 71 strain BJ303, complete genome 7303_.c...........g..a.....______732465
HM002488.1 Human enterovirus 71 strain BJ366, complete genome 7302_.c...........g..a.....______732365
HM002489.1 Human enterovirus 71 strain BJ398, complete genome 7303_.c...........g..a.....______732465
HM053669.1 Human enterovirus 71 strain BJ293, complete genome 7302_.c...........g..a.....______732365
HM053670.1 Human enterovirus 71 strain BJ393, complete genome 7302_.c...........g..a.....______732365
AB550338.1 Human enterovirus 71 genomic RNA, complete genome, strain: 75-Yamagat7301_.c...........g..a.....______732265
AB550339.1 Human enterovirus 71 genomic RNA, complete genome, strain: 75-Yamagat7301_.c...........g..a.....______732265
HQ188292.1 Human enterovirus 71 strain Fuyang-0805a, complete genome 7305_.c...........g..a.....______732665
HQ426649.1 Human enterovirus 71 strain 2010FJLY008, complete genome 7300_.c............c.a.....______732165
HQ891923.1 Human enterovirus 71 strain Shanghai 27-2009, complete genome 7303_.c...........g..a.....______732465
HQ891924.1 Human enterovirus 71 strain Shanghai 28-2009, complete genome 7303_.c...........g..a.....______732465
HQ891927.1 Human enterovirus 71 strain Shanghai 64-2009, complete genome 7303_.c...........g..a.....______732465
HQ891928.1 Human enterovirus 71 strain Shanghai 117-2009, complete genome 7303_.c...........g..a.....______732465
HQ891929.1 Human enterovirus 71 strain Shanghai 118-2009, complete genome 7303_.c...........g..a.....______732465
HQ400942.1 Human enterovirus 71 HZ08/Hangzhou/2008, complete genome 7302_.c...........g..a.....______732365
HQ456305.1 Human enterovirus A strain GZ2010-156, complete genome 7302_.c...........g..a.....______732365
HQ456309.1 Human enterovirus A strain GZ08-831, complete genome 7302_.c...........g..a.....______732365
HQ456310.1 Human enterovirus A strain GZ08-530, complete genome 7302_.c...........g..a.....______732365
HQ456311.1 Human enterovirus A strain GZ08-522, complete genome 7302_.c...........g..a.....______732365
HQ456312.1 Human enterovirus A strain GZ08-520, complete genome 7302_.c...........g..a.....______732365
HQ611148.1 Human enterovirus 71 strain AH08/06, complete genome 7302_.c...........g..a.....______732365
JN001860.1 Human enterovirus 71 strain NB/2010/01, complete genome 7303_.c...........g..a.....______732465
EF174469.1 Human coxsackievirus B2 isolate KOR 04-279, complete genome 7283..g..a.....g..t.cc.........__730972
AY560657.1 Human poliovirus 1 strain Brunhilde, complete genome 7354_..cg.........c.c......g..___737868
AF448782.1 Human poliovirus 2 strain EGY88-074, complete genome 7353_____.........c.c......g..___737362
AF448782.1 Human poliovirus 2 strain EGY88-074, complete genome 4283__________..c.g..........t.__426748
AF499637.1 Human coxsackievirus A13 strain Flores, complete genome 7372_____.........c.c......g..___739262
AF465511.1 Human coxsackievirus A13 strain Flores, complete genome 7372_____.........c.c......g..___739262
AF111966.2 Human poliovirus 1 isolate CHN-Hainan/93-2, complete genome 7358_____.........c..a.....g..___737862
AF111966.2 Human poliovirus 1 isolate CHN-Hainan/93-2, complete genome 4248...g..aa.........____________426448
DQ341354.1 Human enterovirus 71 isolate 3799-SIN-98, complete genome 7307_.c............c.a..c..______732862
DQ341367.1 Human enterovirus 71 isolate MY821-3-SAR-97, complete genome 7306_.c............c.a..c..______732762
DQ341368.1 Human enterovirus 71 isolate MY104-9-SAR-97, complete genome 7306_.c............c.a..c..______732762
AM396586.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate EV71/7306_.c............c.a..c..______732762
AM396588.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate EV71/7297_.c............c.a..c..______731862
EU364841.1 Human enterovirus 71 strain 26M/AUS/4/99, complete genome 7307_.c............c.a..c..______732862
EU376004.1 Human enterovirus 71 26M/AUS/4/99 CHO cell-adapted, complete genome 7307_.c............c.a..c..______732862
EU376005.1 Human enterovirus 71 26M/AUS/4/99 mouse-adapted, complete genome 7307_.c............c.a..c..______732862
AB469182.1 Human enterovirus 71 gene for polyprotein, complete cds, strain: SK-E7305_.c............c.a..c..______732662
AB469183.1 Human enterovirus 71 gene for polyprotein, complete cds, strain: EV718040_.c............c.a..c..______806162
AB550334.1 Human enterovirus 71 genomic RNA, complete genome, strain: SK-EV006-o7305_.c............c.a..c..______732662
AB550335.1 Human enterovirus 71 genomic RNA, complete genome, strain: SK-EV006-L7305_.c............c.a..c..______732662
AB205396.1 Human coxsackievirus A18 genomic RNA, complete genome, strain: CAM1977374_____.........c.c......______739155
X00595.1 Poliovirus type 2 genome (strain Sabin 2 (P712, Ch, 2ab)) 7353_____.........c.ct.....g..___737358
D00625.1POL2CG1 Human poliovirus 2 genomic RNA, complete genome 7347_____.........c.ca.....g..___736758
M12197.1POL2LAN Poliovirus type 2 (Lansing strain), complete genome 7353_____.........c.ca.....g..___737358
AF405666.1 Human poliovirus 1 isolate HAI01007, complete genome 7354_____.........c.ct.....g..___737458
AF405669.1 Human poliovirus 1 isolate HAI00003, complete genome 7355_____.........c.ca.....g..___737558
AF405682.1 Human poliovirus 1 isolate DOR00041C1, complete genome 7354_____.........c.ca.....g..___737458
AF405690.1 Human poliovirus 1 isolate DOR00013, complete genome 7354_____.........c.ca.....g..___737458
AY184220.1 Human poliovirus 2 strain Sabin 2, complete genome 7353_____.........c.ct.....g..___737358
AY238473.1 Human poliovirus 2 strain MEF-1 polyprotein gene, complete cds 7353_____.........c.ca.....g..___737358
AY177685.1 Human poliovirus 2, complete genome 7353_____.........c.ct.....g..___737358
AY278549.1 Human poliovirus 2 isolate P2S/Mog65-3 (20120), complete genome 7353_____.........c.ct.....g..___737358
AY278553.1 Human poliovirus 1 isolate P1W/Bar65 (19276), complete genome 7350_____.........t.ct.....g..___737058
AY278553.1 Human poliovirus 1 isolate P1W/Bar65 (19276), complete genome 4281_________...c.g..........t.__426451
AF448783.1 Human poliovirus 2 strain EGY93-034, complete genome 7355_____.........c.ca.....g..___737558
AF416342.1 Human poliovirus 1 isolate HAI01-013, complete genome 7354_____.........c.ca.....g..___737458
AF458333.1 Human poliovirus 1 isolate HAI01015, complete genome 7354_____.........t.ca.....g..___737458
AF465513.1 Human coxsackievirus A18 strain G-13, complete genome 7371_____.........c.ca.....g..___739158
AF111953.2 Human poliovirus 1 isolate CHN-Hebei/91-2, complete genome 7358_____.........c.ca.....g..___737858
AF111953.2 Human poliovirus 1 isolate CHN-Hebei/91-2, complete genome 4248...g..aa.........____________426448
AF111981.2 Human poliovirus 1 isolate CHN-Fujian/93-8, complete genome 7358_____.........c.ct.....g..___737858
AF111981.2 Human poliovirus 1 isolate CHN-Fujian/93-8, complete genome 4248...g..aa.........____________426448
AY876912.1 Human enterovirus Ningbo3-02, complete genome 7372_____.........c.ca.....g..___739258
AY876912.1 Human enterovirus Ningbo3-02, complete genome 657_____________............____64641
AY876913.1 Human enterovirus Hangzhou13-02, complete genome 7372_____.........c.ca.....g..___739258
AY876913.1 Human enterovirus Hangzhou13-02, complete genome 657_____________............____64641
DQ205099.1 Human poliovirus 2 clone S2R9, complete genome 7353_____.........c.ct.....g..___737358
DQ443001.1 Human coxsackievirus A24 isolate DSO-52/2005, complete genome 7377_____.........c.ct.....g..___739758
DQ443001.1 Human coxsackievirus A24 isolate DSO-52/2005, complete genome 662_____________............____65141
DQ443002.1 Human coxsackievirus A24 isolate DSO-26/2005, complete genome 7377_____.........c.ct.....g..___739758
DQ443002.1 Human coxsackievirus A24 isolate DSO-26/2005, complete genome 662_____________............____65141
AM084223.1 Human poliovirus 2 RNA for polyprotein, complete genome, genomic RNA,7353_____.........c.ca.....g..___737358
AM084224.1 Human poliovirus 2 RNA for polyprotein, complete genome, genomic RNA,7353_____.........c.ca.....g..___737358
DQ890385.1 Human poliovirus 2 strain NIE0210766, complete genome 7353_____.........c.ct.....g..___737358
DQ890386.1 Human poliovirus 2 strain NIE0110767, complete genome 7355_____.........t.ct.....g..___737558
EF026081.1 Human coxsackievirus A24 strain Joseph, complete genome 7372_____.........c.ca.....g..___739258
EF456707.1 Human poliovirus 3 isolate K/2002 polyprotein gene, complete cds 7305_____.........c.ct.....g..___732558
AM884184.1 Human poliovirus 2, complete genome, genomic RNA, isolate VDPV MAD0057353_____.........c.ca.....g..___737358
AM884185.1 Human poliovirus 2, complete genome, genomic RNA, isolate VDPV MAD0067353_____.........c.ca.....g..___737358
FM955278.1 Human coxsackievirus A17, complete genome, genomic RNA, isolate cCA177371_____.........c.ca.....g..___739158
FJ914252.2 Human poliovirus 3 strain SWI10947, complete genome 7349_____.........c.ca.....g..___736958
HM107835.1 Human poliovirus 2 isolate CHN8316, complete genome 7353_____.........c.ct.....g..___737358
EF107098.1 Human enterovirus 68 isolate 37-99 from France, complete genome 2700....gaaa...a.........ac...___272565
AM084225.1 Human poliovirus 2 RNA for polyprotein, complete genome, genomic RNA,4283__________....g..........t.__426751
AY673831.1 Human coxsackievirus B3 strain GA, complete genome 7324___....act.........c.ct.a....729965
AJ293918.1 Human poliovirus type 3 complete genome, live-attenuated strain USOL-7350_____.........c.ct.....g.____736955
AF111961.2 Human poliovirus 1 isolate CHN-Guangdong/92-2, complete genome 7358_____.........c.ca.....g.____737755
AF111961.2 Human poliovirus 1 isolate CHN-Guangdong/92-2, complete genome 4248...g..aa.........____________426448
AJ544513.1 Human poliovirus 2 gene for polyprotein, genomic RNA, isolate 102050 7353_____.........c.ct.....g.____737255
AB601882.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC2199....gaaa.t.a.........ac....__222565
AB601883.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC2198....gaaa.t.a.........ac....__222465
AB601884.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC2199....gaaa.t.a.........ac....__222565
X04468.1 Poliovirus type 3 strain 23127 complete genome 7349_____.........c.ct.....______736651
D90457.1CXA24CG Human coxsackievirus A24 DNA, complete genome 7377_____.........c.ca.....______739451
AM040036.1 Human poliovirus 2 complete virion genome, isolate PV2/5021-1/ISR99 7257_____.........c.ca.....______727451
AM040038.1 Human poliovirus 2 complete virion genome, isolate PV2/5104-1/ISR99 7257_____.........c.ca.....______727451
S76772.1 polyprotein [Coxsackie B4 virus CB4, host=mice, E2, originally derive1427_.c.t..t.t..a.........gc.g.._140165
AF039205.1 Coxsackievirus B6 strain Schmitt, complete genome 7322__.....tta.........c.ct.at...729665
AF105342.1 Coxsackievirus B6 strain Schmitt, complete genome 7322__.....tta.........c.ct.at...729665
AF114384.1 Coxsackievirus B6 strain Schmitt, complete genome 7321__.....tta.........c.ct.at...729565
AF311939.1 Human coxsackievirus B4 strain E2 variant, complete genome 1427_.c.t..t.t..a.........gc.g.._140165
AF328683.1 Human coxsackievirus B4 polyprotein-like gene, complete sequence 1421_____..t.t...........________140648
DQ358078.1 Human coxsackievirus A20 serotype CAV20a, complete genome 4289_________...c..........______427644
AF162711.1 Echovirus 30 strain Bastianni, complete genome 4235_____________............c.__422244
AF162711.1 Echovirus 30 strain Bastianni, complete genome 4084___.........a..aa..._________410048
AF311938.1 Human echovirus 30 strain Bastianni, complete genome 4240_____________............c.__422744
AF311938.1 Human echovirus 30 strain Bastianni, complete genome 4089___.........a..aa..._________410548
AY302552.1 Human echovirus 29 strain JV-10 complete genome 7353__________..a..........._____734044
AB501329.1 Human echovirus 13 gene for polyprotein, complete cds, strain: 2002-24210_____________............c.__419744
AB501330.1 Human echovirus 13 gene for polyprotein, complete cds, strain: 2002-24210_____________............c.__419744
AB501331.1 Human echovirus 13 gene for polyprotein, complete cds, strain: I5(1)-4210_____________............c.__419744
AB501332.1 Human echovirus 13 gene for polyprotein, complete cds, strain: S3(1)-4210_____________............c.__419744
AB601885.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC2199....gaaa.t.a.........ac...___222462
AF499636.1 Human coxsackievirus A11 strain Belgium-1, complete genome 5174_______..g.g.tg..........g.c.515355
AY302540.1 Human echovirus 14 strain Tow complete genome 7374_..........t.._______________738641
EF174468.1 Human coxsackievirus B2 isolate KOR 04-243, complete genome 6078__..........t..______________606641
AJ276224.1 Human echovirus 11 genomic RNA for polyprotein 7026______________...........____703637
AY843297.1 Human enterovirus 79 strain USA/CA79-10384, complete genome 7356___..........._______________736637
EF634316.1 Human echovirus 11 strain D207, complete genome 7359___..........._______________736937