../../tmp/servers/virsirnadb/850891514
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi21761agtatggtatggatctctag20
V01109.1 Human BK virus (strain MM) genome. (Closely related to SV40.) 2234....................2253100
V01109.1 Human BK virus (strain MM) genome. (Closely related to SV40.) 688_............_______69960
DQ305492.1 BK polyomavirus strain UT, complete genome 4112....................4131100
DQ305492.1 BK polyomavirus strain UT, complete genome 2566_............_______257760
AB365157.1 BK polyomavirus DNA, complete genome, isolate: SAU-3 3955....................3974100
AB365157.1 BK polyomavirus DNA, complete genome, isolate: SAU-3 2409_............_______242060
NC_001538.1 BK polyomavirus, complete genome 4075....................4094100
NC_001538.1 BK polyomavirus, complete genome 2529_............_______254060
AY628234.1 BK polyomavirus isolate BKV HC-u2, complete genome 4015_...................403395
AY628234.1 BK polyomavirus isolate BKV HC-u2, complete genome 2468_............_______247960
AY628235.1 BK polyomavirus isolate BKV HC-u5, complete genome 4064_...................408295
AY628235.1 BK polyomavirus isolate BKV HC-u5, complete genome 2517_............_______252860
AY628236.1 BK polyomavirus isolate BKV HC-u9, complete genome 4064_...................408295
AY628236.1 BK polyomavirus isolate BKV HC-u9, complete genome 2517_............_______252860
AY628224.1 BK polyomavirus isolate BKV CAP-m18, complete genome 4064_...................408295
AY628224.1 BK polyomavirus isolate BKV CAP-m18, complete genome 2517_............_______252860
AY628226.1 BK polyomavirus isolate BKV CAP-h2, complete genome 4064_...................408295
AY628226.1 BK polyomavirus isolate BKV CAP-h2, complete genome 2517_............_______252860
AY628227.1 BK polyomavirus isolate BKV CAP-h22, complete genome 4064_...................408295
AY628227.1 BK polyomavirus isolate BKV CAP-h22, complete genome 2517_............_______252860
AY628228.1 BK polyomavirus isolate BKV CAP-h5, complete genome 4064_...................408295
AY628228.1 BK polyomavirus isolate BKV CAP-h5, complete genome 2517_............_______252860
AY628229.1 BK polyomavirus isolate BKV CAP-h8, complete genome 4064_...................408295
AY628229.1 BK polyomavirus isolate BKV CAP-h8, complete genome 2517_............_______252860
AY628230.1 BK polyomavirus isolate BKV CAP-m13, complete genome 4064_...................408295
AY628230.1 BK polyomavirus isolate BKV CAP-m13, complete genome 2517_............_______252860
AY628231.1 BK polyomavirus isolate BKV CAP-m2, complete genome 4064_...................408295
AY628231.1 BK polyomavirus isolate BKV CAP-m2, complete genome 2517_............_______252860
AY628232.1 BK polyomavirus isolate BKV CAP-m5, complete genome 4064_...................408295
AY628232.1 BK polyomavirus isolate BKV CAP-m5, complete genome 2517_............_______252860
AY628233.1 BK polyomavirus isolate BKV CAP-m9, complete genome 4064_...................408295
AY628233.1 BK polyomavirus isolate BKV CAP-m9, complete genome 2517_............_______252860
AY628225.1 BK polyomavirus isolate BKV HI-u5, complete genome 4064_...................408295
AY628225.1 BK polyomavirus isolate BKV HI-u5, complete genome 2517_............_______252860
AY628237.1 BK polyomavirus isolate BKV HI-u6, complete genome 4052_...................407095
AY628237.1 BK polyomavirus isolate BKV HI-u6, complete genome 2505_............_______251660
AY628238.1 BK polyomavirus isolate BKV HI-u8, complete genome 4055_...................407395
AY628238.1 BK polyomavirus isolate BKV HI-u8, complete genome 2508_............_______251960
AB213487.1 BK polyomavirus DNA, complete genome, isolate:TW-2 3956_...................397495
AB213487.1 BK polyomavirus DNA, complete genome, isolate:TW-2 2409_............_______242060
AB217917.1 BK polyomavirus DNA, complete genome, isolate: TW-1a 3956_...................397495
AB217917.1 BK polyomavirus DNA, complete genome, isolate: TW-1a 2409_............_______242060
AB217918.1 BK polyomavirus DNA, complete genome, isolate: TW-1b 3956_...................397495
AB217918.1 BK polyomavirus DNA, complete genome, isolate: TW-1b 2409_............_______242060
AB217920.1 BK polyomavirus DNA, complete genome, isolate: TW-8a 3956_...................397495
AB217920.1 BK polyomavirus DNA, complete genome, isolate: TW-8a 2409_............_______242060
AB217921.1 BK polyomavirus DNA, complete genome, isolate: THK-9a 3956_...................397495
AB217921.1 BK polyomavirus DNA, complete genome, isolate: THK-9a 2409_............_______242060
AB211369.1 BK polyomavirus DNA, complete genome, isolate: Dik 3956_...................397495
AB211369.1 BK polyomavirus DNA, complete genome, isolate: Dik 2409_............_______242060
AB211374.1 BK polyomavirus DNA, complete genome, isolate: KOM-5 3956_...................397495
AB211374.1 BK polyomavirus DNA, complete genome, isolate: KOM-5 2409_............_______242060
AB211379.1 BK polyomavirus DNA, complete genome, isolate: THK-9 3956_...................397495
AB211379.1 BK polyomavirus DNA, complete genome, isolate: THK-9 2409_............_______242060
AB211385.1 BK polyomavirus DNA, complete genome, isolate: TW-8 3956_...................397495
AB211385.1 BK polyomavirus DNA, complete genome, isolate: TW-8 2409_............_______242060
AB211370.1 BK polyomavirus DNA, complete genome, isolate: JL 3917_...................393595
AB211370.1 BK polyomavirus DNA, complete genome, isolate: JL 2370_............_______238160
AB211371.1 BK polyomavirus DNA, complete genome, isolate: WW 3956_...................397495
AB211371.1 BK polyomavirus DNA, complete genome, isolate: WW 2409_............_______242060
AB211372.1 BK polyomavirus DNA, complete genome, isolate: MT 3956_...................397495
AB211372.1 BK polyomavirus DNA, complete genome, isolate: MT 2409_............_______242060
AB211373.1 BK polyomavirus DNA, complete genome, isolate: KOM-1 3956_...................397495
AB211373.1 BK polyomavirus DNA, complete genome, isolate: KOM-1 2409_............_______242060
AB211375.1 BK polyomavirus DNA, complete genome, isolate: KOM-6 3956_...................397495
AB211375.1 BK polyomavirus DNA, complete genome, isolate: KOM-6 2409_............_______242060
AB211376.1 BK polyomavirus DNA, complete genome, isolate: RYU-1 3956_...................397495
AB211376.1 BK polyomavirus DNA, complete genome, isolate: RYU-1 2409_............_______242060
AB211377.1 BK polyomavirus DNA, complete genome, isolate: RYU-2 3948_...................396695
AB211377.1 BK polyomavirus DNA, complete genome, isolate: RYU-2 2401_............_______241260
AB211378.1 BK polyomavirus DNA, complete genome, isolate: THK-6 3955_...................397395
AB211378.1 BK polyomavirus DNA, complete genome, isolate: THK-6 2408_............_______241960
AB211380.1 BK polyomavirus DNA, complete genome, isolate: THK-11 3956_...................397495
AB211380.1 BK polyomavirus DNA, complete genome, isolate: THK-11 2409_............_______242060
AB211381.1 BK polyomavirus DNA, complete genome, isolate: TW-1 3956_...................397495
AB211381.1 BK polyomavirus DNA, complete genome, isolate: TW-1 2409_............_______242060
AB211382.1 BK polyomavirus DNA, complete genome, isolate: TW-4 3956_...................397495
AB211382.1 BK polyomavirus DNA, complete genome, isolate: TW-4 2409_............_______242060
AB211383.1 BK polyomavirus DNA, complete genome, isolate: TW-5 3956_...................397495
AB211383.1 BK polyomavirus DNA, complete genome, isolate: TW-5 2409_............_______242060
AB211384.1 BK polyomavirus DNA, complete genome, isolate: TW-7 3955_...................397395
AB211384.1 BK polyomavirus DNA, complete genome, isolate: TW-7 2409_............_______242060
AB260028.1 BK polyomavirus DNA, complete genome, isolate: FIN-13 3956_...................397495
AB260028.1 BK polyomavirus DNA, complete genome, isolate: FIN-13 2409_............_______242060
AB260029.1 BK polyomavirus DNA, complete genome, isolate: FIN-11 3956_...................397495
AB260029.1 BK polyomavirus DNA, complete genome, isolate: FIN-11 2409_............_______242060
AB260030.1 BK polyomavirus DNA, complete genome, isolate: FIN-23 3956_...................397495
AB260030.1 BK polyomavirus DNA, complete genome, isolate: FIN-23 2409_............_______242060
AB260031.1 BK polyomavirus DNA, complete genome, isolate: FIN-14 3956_...................397495
AB260031.1 BK polyomavirus DNA, complete genome, isolate: FIN-14 2409_............_______242060
AB260032.1 BK polyomavirus DNA, complete genome, isolate: FIN-10 3956_...................397495
AB260032.1 BK polyomavirus DNA, complete genome, isolate: FIN-10 2409_............_______242060
AB263915.1 BK polyomavirus DNA, complete genome, isolate: ESP-2 3956_...................397495
AB263915.1 BK polyomavirus DNA, complete genome, isolate: ESP-2 2409_............_______242060
AB263917.1 BK polyomavirus DNA, complete genome, isolate: ETH-4 3956_...................397495
AB263917.1 BK polyomavirus DNA, complete genome, isolate: ETH-4 2409_............_______242060
AB263918.1 BK polyomavirus DNA, complete genome, isolate: FNL-12 3956_...................397495
AB263918.1 BK polyomavirus DNA, complete genome, isolate: FNL-12 2409_............_______242060
AB263919.1 BK polyomavirus DNA, complete genome, isolate: FNL-22 3956_...................397495
AB263919.1 BK polyomavirus DNA, complete genome, isolate: FNL-22 2409_............_______242060
AB263921.1 BK polyomavirus DNA, complete genome, isolate: GBR-4 3956_...................397495
AB263921.1 BK polyomavirus DNA, complete genome, isolate: GBR-4 2409_............_______242060
AB263922.1 BK polyomavirus DNA, complete genome, isolate: GBR-6 3956_...................397495
AB263922.1 BK polyomavirus DNA, complete genome, isolate: GBR-6 2409_............_______242060
AB263923.1 BK polyomavirus DNA, complete genome, isolate: GBR-8 3956_...................397495
AB263923.1 BK polyomavirus DNA, complete genome, isolate: GBR-8 2409_............_______242060
AB263924.1 BK polyomavirus DNA, complete genome, isolate: GBR-9 3956_...................397495
AB263924.1 BK polyomavirus DNA, complete genome, isolate: GBR-9 2409_............_______242060
AB263925.1 BK polyomavirus DNA, complete genome, isolate: ITA-5 3947_...................396595
AB263925.1 BK polyomavirus DNA, complete genome, isolate: ITA-5 2400_............_______241160
AB263927.1 BK polyomavirus DNA, complete genome, isolate: KEN-3 3956_...................397495
AB263927.1 BK polyomavirus DNA, complete genome, isolate: KEN-3 2409_............_______242060
AB263929.1 BK polyomavirus DNA, complete genome, isolate: MMR-6 3977_...................399595
AB263929.1 BK polyomavirus DNA, complete genome, isolate: MMR-6 2430_............_______244160
AB263930.1 BK polyomavirus DNA, complete genome, isolate: NEC-12 3956_...................397495
AB263930.1 BK polyomavirus DNA, complete genome, isolate: NEC-12 2409_............_______242060
AB263931.1 BK polyomavirus DNA, complete genome, isolate: NEC-8 3956_...................397495
AB263931.1 BK polyomavirus DNA, complete genome, isolate: NEC-8 2409_............_______242060
AB263932.1 BK polyomavirus DNA, complete genome, isolate: NER-1 3956_...................397495
AB263932.1 BK polyomavirus DNA, complete genome, isolate: NER-1 2409_............_______242060
AB263933.1 BK polyomavirus DNA, complete genome, isolate: PHL-6 3956_...................397495
AB263933.1 BK polyomavirus DNA, complete genome, isolate: PHL-6 2409_............_______242060
AB263934.1 BK polyomavirus DNA, complete genome, isolate: PHL-7 3956_...................397495
AB263934.1 BK polyomavirus DNA, complete genome, isolate: PHL-7 2409_............_______242060
AB263935.1 BK polyomavirus DNA, complete genome, isolate: SWE-2 3955_...................397395
AB263935.1 BK polyomavirus DNA, complete genome, isolate: SWE-2 2409_............_______242060
AB263936.1 BK polyomavirus DNA, complete genome, isolate: TUR-5 3956_...................397495
AB263936.1 BK polyomavirus DNA, complete genome, isolate: TUR-5 2409_............_______242060
AB263937.1 BK polyomavirus DNA, complete genome, isolate: VNM-9 3956_...................397495
AB263937.1 BK polyomavirus DNA, complete genome, isolate: VNM-9 2409_............_______242060
AB298940.1 BK polyomavirus DNA, complete genome, isolate: NEA-25 3956_...................397495
AB298940.1 BK polyomavirus DNA, complete genome, isolate: NEA-25 2409_............_______242060
AB298941.1 BK polyomavirus DNA, complete genome, isolate: NEB-6 3956_...................397495
AB298941.1 BK polyomavirus DNA, complete genome, isolate: NEB-6 2409_............_______242060
AB298942.1 BK polyomavirus DNA, complete genome, isolate: NGY-5 3956_...................397495
AB298942.1 BK polyomavirus DNA, complete genome, isolate: NGY-5 2409_............_______242060
AB298943.1 BK polyomavirus DNA, complete genome, isolate: NGY-38 3956_...................397495
AB298943.1 BK polyomavirus DNA, complete genome, isolate: NGY-38 2409_............_______242060
AB298944.1 BK polyomavirus DNA, complete genome, isolate: NAR-12 3956_...................397495
AB298944.1 BK polyomavirus DNA, complete genome, isolate: NAR-12 2409_............_______242060
AB298945.1 BK polyomavirus DNA, complete genome, isolate: NAR-13 3956_...................397495
AB298945.1 BK polyomavirus DNA, complete genome, isolate: NAR-13 2409_............_______242060
AB298946.1 BK polyomavirus DNA, complete genome, isolate: OKN-14 3956_...................397495
AB298946.1 BK polyomavirus DNA, complete genome, isolate: OKN-14 2409_............_______242060
AB298947.1 BK polyomavirus DNA, complete genome, isolate: OKN-18 3956_...................397495
AB298947.1 BK polyomavirus DNA, complete genome, isolate: OKN-18 2409_............_______242060
AB301086.1 BK polyomavirus DNA, complete genome, isolate: LAB-7 3956_...................397495
AB301086.1 BK polyomavirus DNA, complete genome, isolate: LAB-7 2409_............_______242060
AB301087.1 BK polyomavirus DNA, complete genome, isolate: LAB-8 3956_...................397495
AB301087.1 BK polyomavirus DNA, complete genome, isolate: LAB-8 2409_............_______242060
AB301088.1 BK polyomavirus DNA, complete genome, isolate: LAB-11 3956_...................397495
AB301088.1 BK polyomavirus DNA, complete genome, isolate: LAB-11 2409_............_______242060
AB301089.1 BK polyomavirus DNA, complete genome, isolate: LAB-14 3956_...................397495
AB301089.1 BK polyomavirus DNA, complete genome, isolate: LAB-14 2409_............_______242060
AB301090.1 BK polyomavirus DNA, complete genome, isolate: LAB-18 3956_...................397495
AB301090.1 BK polyomavirus DNA, complete genome, isolate: LAB-18 2409_............_______242060
AB301091.1 BK polyomavirus DNA, complete genome, isolate: LAB-20 3956_...................397495
AB301091.1 BK polyomavirus DNA, complete genome, isolate: LAB-20 2409_............_______242060
AB301092.1 BK polyomavirus DNA, complete genome, isolate: LAB-21 3956_...................397495
AB301092.1 BK polyomavirus DNA, complete genome, isolate: LAB-21 2409_............_______242060
AB301093.1 BK polyomavirus DNA, complete genome, isolate: LAB-22 3956_...................397495
AB301093.1 BK polyomavirus DNA, complete genome, isolate: LAB-22 2409_............_______242060
AB301094.1 BK polyomavirus DNA, complete genome, isolate: LAB-25 3956_...................397495
AB301094.1 BK polyomavirus DNA, complete genome, isolate: LAB-25 2409_............_______242060
AB301095.1 BK polyomavirus DNA, complete genome, isolate: LAB-27 3956_...................397495
AB301095.1 BK polyomavirus DNA, complete genome, isolate: LAB-27 2409_............_______242060
AB301096.1 BK polyomavirus DNA, complete genome, isolate: LAB-29 3956_...................397495
AB301096.1 BK polyomavirus DNA, complete genome, isolate: LAB-29 2409_............_______242060
AB301098.1 BK polyomavirus DNA, complete genome, isolate: J2B-1 3956_...................397495
AB301098.1 BK polyomavirus DNA, complete genome, isolate: J2B-1 2409_............_______242060
AB301099.1 BK polyomavirus DNA, complete genome, isolate: J2B-2 3956_...................397495
AB301099.1 BK polyomavirus DNA, complete genome, isolate: J2B-2 2409_............_______242060
AB301100.1 BK polyomavirus DNA, complete genome, isolate: J2B-9 3956_...................397495
AB301100.1 BK polyomavirus DNA, complete genome, isolate: J2B-9 2409_............_______242060
AB301102.1 BK polyomavirus DNA, complete genome, isolate: J2B-13 3956_...................397495
AB301102.1 BK polyomavirus DNA, complete genome, isolate: J2B-13 2409_............_______242060
AB301103.1 BK polyomavirus DNA, complete genome, isolate: J3B-3 3956_...................397495
AB301103.1 BK polyomavirus DNA, complete genome, isolate: J3B-3 2409_............_______242060
AB365131.1 BK polyomavirus DNA, complete genome, isolate: FUK-23 3956_...................397495
AB365131.1 BK polyomavirus DNA, complete genome, isolate: FUK-23 2409_............_______242060
AB365132.1 BK polyomavirus DNA, complete genome, isolate: NAR-9 3956_...................397495
AB365132.1 BK polyomavirus DNA, complete genome, isolate: NAR-9 2409_............_______242060
AB365133.1 BK polyomavirus DNA, complete genome, isolate: NAR-15 3956_...................397495
AB365133.1 BK polyomavirus DNA, complete genome, isolate: NAR-15 2409_............_______242060
AB365134.1 BK polyomavirus DNA, complete genome, isolate: NAR-16 3970_...................398895
AB365134.1 BK polyomavirus DNA, complete genome, isolate: NAR-16 2423_............_______243460
AB365135.1 BK polyomavirus DNA, complete genome, isolate: NAR-17 3956_...................397495
AB365135.1 BK polyomavirus DNA, complete genome, isolate: NAR-17 2409_............_______242060
AB365136.1 BK polyomavirus DNA, complete genome, isolate: NAR-21 3956_...................397495
AB365136.1 BK polyomavirus DNA, complete genome, isolate: NAR-21 2409_............_______242060
AB365137.1 BK polyomavirus DNA, complete genome, isolate: NAR-41 3956_...................397495
AB365137.1 BK polyomavirus DNA, complete genome, isolate: NAR-41 2409_............_______242060
AB365144.1 BK polyomavirus DNA, complete genome, isolate: NEC-7 3956_...................397495
AB365144.1 BK polyomavirus DNA, complete genome, isolate: NEC-7 2409_............_______242060
AB365145.1 BK polyomavirus DNA, complete genome, isolate: NEC-15 3956_...................397495
AB365145.1 BK polyomavirus DNA, complete genome, isolate: NEC-15 2409_............_______242060
AB365146.1 BK polyomavirus DNA, complete genome, isolate: NEC-22 3956_...................397495
AB365146.1 BK polyomavirus DNA, complete genome, isolate: NEC-22 2409_............_______242060
AB365148.1 BK polyomavirus DNA, complete genome, isolate: OKN-16 3956_...................397495
AB365148.1 BK polyomavirus DNA, complete genome, isolate: OKN-16 2409_............_______242060
AB365151.1 BK polyomavirus DNA, complete genome, isolate: OKN-28 3956_...................397495
AB365151.1 BK polyomavirus DNA, complete genome, isolate: OKN-28 2409_............_______242060
AB365152.1 BK polyomavirus DNA, complete genome, isolate: OKN-36 3956_...................397495
AB365152.1 BK polyomavirus DNA, complete genome, isolate: OKN-36 2409_............_______242060
AB365153.1 BK polyomavirus DNA, complete genome, isolate: OKN-42 3956_...................397495
AB365153.1 BK polyomavirus DNA, complete genome, isolate: OKN-42 2409_............_______242060
AB365154.1 BK polyomavirus DNA, complete genome, isolate: OKN-48 3956_...................397495
AB365154.1 BK polyomavirus DNA, complete genome, isolate: OKN-48 2409_............_______242060
AB365155.1 BK polyomavirus DNA, complete genome, isolate: OKN-50 3956_...................397495
AB365155.1 BK polyomavirus DNA, complete genome, isolate: OKN-50 2409_............_______242060
AB365156.1 BK polyomavirus DNA, complete genome, isolate: OKN-58 3956_...................397495
AB365156.1 BK polyomavirus DNA, complete genome, isolate: OKN-58 2409_............_______242060
AB365158.1 BK polyomavirus DNA, complete genome, isolate: SHA-4 3956_...................397495
AB365158.1 BK polyomavirus DNA, complete genome, isolate: SHA-4 2409_............_______242060
AB365159.1 BK polyomavirus DNA, complete genome, isolate: SHA-7 3956_...................397495
AB365159.1 BK polyomavirus DNA, complete genome, isolate: SHA-7 2409_............_______242060
AB365160.1 BK polyomavirus DNA, complete genome, isolate: SHA-9 3956_...................397495
AB365160.1 BK polyomavirus DNA, complete genome, isolate: SHA-9 2409_............_______242060
AB365161.1 BK polyomavirus DNA, complete genome, isolate: SHA-10 3956_...................397495
AB365161.1 BK polyomavirus DNA, complete genome, isolate: SHA-10 2409_............_______242060
AB365162.1 BK polyomavirus DNA, complete genome, isolate: SHA-13 3956_...................397495
AB365162.1 BK polyomavirus DNA, complete genome, isolate: SHA-13 2409_............_______242060
AB365163.1 BK polyomavirus DNA, complete genome, isolate: SHA-19 3956_...................397495
AB365163.1 BK polyomavirus DNA, complete genome, isolate: SHA-19 2409_............_______242060
AB365164.1 BK polyomavirus DNA, complete genome, isolate: SHA-22 3956_...................397495
AB365164.1 BK polyomavirus DNA, complete genome, isolate: SHA-22 2409_............_______242060
AB365165.1 BK polyomavirus DNA, complete genome, isolate: SHA-23 3956_...................397495
AB365165.1 BK polyomavirus DNA, complete genome, isolate: SHA-23 2409_............_______242060
AB365166.1 BK polyomavirus DNA, complete genome, isolate: SHA-25 3956_...................397495
AB365166.1 BK polyomavirus DNA, complete genome, isolate: SHA-25 2409_............_______242060
AB365169.1 BK polyomavirus DNA, complete genome, isolate: SHA-40 3956_...................397495
AB365169.1 BK polyomavirus DNA, complete genome, isolate: SHA-40 2409_............_______242060
AB365170.1 BK polyomavirus DNA, complete genome, isolate: SHA-41 3956_...................397495
AB365170.1 BK polyomavirus DNA, complete genome, isolate: SHA-41 2409_............_______242060
AB365174.1 BK polyomavirus DNA, complete genome, isolate: SHA-56 3956_...................397495
AB365174.1 BK polyomavirus DNA, complete genome, isolate: SHA-56 2409_............_______242060
AB365175.1 BK polyomavirus DNA, complete genome, isolate: SHA-62 3956_...................397495
AB365175.1 BK polyomavirus DNA, complete genome, isolate: SHA-62 2409_............_______242060
AB365176.1 BK polyomavirus DNA, complete genome, isolate: SHA-70 3956_...................397495
AB365176.1 BK polyomavirus DNA, complete genome, isolate: SHA-70 2409_............_______242060
AB365177.1 BK polyomavirus DNA, complete genome, isolate: SHA-72 3956_...................397495
AB365177.1 BK polyomavirus DNA, complete genome, isolate: SHA-72 2409_............_______242060
AB369087.1 BK polyomavirus DNA, complete genome, isolate: A-23H 3956_...................397495
AB369087.1 BK polyomavirus DNA, complete genome, isolate: A-23H 2409_............_______242060
AB369088.1 BK polyomavirus DNA, complete genome, isolate: A-36H 3956_...................397495
AB369088.1 BK polyomavirus DNA, complete genome, isolate: A-36H 2409_............_______242060
AB369090.1 BK polyomavirus DNA, complete genome, isolate: A-43H 3956_...................397495
AB369090.1 BK polyomavirus DNA, complete genome, isolate: A-43H 2409_............_______242060
AB369091.1 BK polyomavirus DNA, complete genome, isolate: A-47H 3956_...................397495
AB369091.1 BK polyomavirus DNA, complete genome, isolate: A-47H 2409_............_______242060
AB369094.1 BK polyomavirus DNA, complete genome, isolate: A-68H 3956_...................397495
AB369094.1 BK polyomavirus DNA, complete genome, isolate: A-68H 2409_............_______242060
AB369095.1 BK polyomavirus DNA, complete genome, isolate: FUJ-4 3956_...................397495
AB369095.1 BK polyomavirus DNA, complete genome, isolate: FUJ-4 2409_............_______242060
AB369096.1 BK polyomavirus DNA, complete genome, isolate: FUJ-6 3956_...................397495
AB369096.1 BK polyomavirus DNA, complete genome, isolate: FUJ-6 2409_............_______242060
AB369097.1 BK polyomavirus DNA, complete genome, isolate: FUJ-15 3956_...................397495
AB369097.1 BK polyomavirus DNA, complete genome, isolate: FUJ-15 2409_............_______242060
AB369098.1 BK polyomavirus DNA, complete genome, isolate: FUJ-27 3956_...................397495
AB369098.1 BK polyomavirus DNA, complete genome, isolate: FUJ-27 2409_............_______242060
AB369099.1 BK polyomavirus DNA, complete genome, isolate: FUJ-31 3956_...................397495
AB369099.1 BK polyomavirus DNA, complete genome, isolate: FUJ-31 2409_............_______242060
AB369100.1 BK polyomavirus DNA, complete genome, isolate: FUJ-34 3956_...................397495
AB369100.1 BK polyomavirus DNA, complete genome, isolate: FUJ-34 2409_............_______242060
AB369101.1 BK polyomavirus DNA, complete genome, isolate: FUJ-36 3956_...................397495
AB369101.1 BK polyomavirus DNA, complete genome, isolate: FUJ-36 2409_............_______242060
AB485694.1 BK polyomavirus DNA, complete genome, isolate: MT clone 6 3956_...................397495
AB485694.1 BK polyomavirus DNA, complete genome, isolate: MT clone 6 2409_............_______242060
AB485695.1 BK polyomavirus DNA, complete genome, isolate: MT clone 7 4099_...................411795
AB485695.1 BK polyomavirus DNA, complete genome, isolate: MT clone 7 2552_............_______256360
AB485696.1 BK polyomavirus DNA, complete genome, isolate: MT clone 8 3956_...................397495
AB485696.1 BK polyomavirus DNA, complete genome, isolate: MT clone 8 2409_............_______242060
AB485697.1 BK polyomavirus DNA, complete genome, isolate: MT clone 11 4159_...................417795
AB485697.1 BK polyomavirus DNA, complete genome, isolate: MT clone 11 2645_............_______265660
AB485698.1 BK polyomavirus DNA, complete genome, isolate: MT clone 18 4193_...................421195
AB485698.1 BK polyomavirus DNA, complete genome, isolate: MT clone 18 2646_............_______265760
AB485699.1 BK polyomavirus DNA, complete genome, isolate: MT clone 29 4194_...................421295
AB485699.1 BK polyomavirus DNA, complete genome, isolate: MT clone 29 2647_............_______265860
AB485700.1 BK polyomavirus DNA, complete genome, isolate: MT clone 32 4175_...................419395
AB485700.1 BK polyomavirus DNA, complete genome, isolate: MT clone 32 2628_............_______263960
AB485701.1 BK polyomavirus DNA, complete genome, isolate: MT clone 44 4188_...................420695
AB485701.1 BK polyomavirus DNA, complete genome, isolate: MT clone 44 2641_............_______265260
AB485702.1 BK polyomavirus DNA, complete genome, isolate: MT clone 47 4099_...................411795
AB485702.1 BK polyomavirus DNA, complete genome, isolate: MT clone 47 2552_............_______256360
AB485703.1 BK polyomavirus DNA, complete genome, isolate: MT clone 50 3947_...................396595
AB485703.1 BK polyomavirus DNA, complete genome, isolate: MT clone 50 2400_............_______241160
AB485704.1 BK polyomavirus DNA, complete genome, isolate: MT clone 51 3989_...................400795
AB485704.1 BK polyomavirus DNA, complete genome, isolate: MT clone 51 2442_............_______245360
AB485705.1 BK polyomavirus DNA, complete genome, isolate: MT clone 54 3989_...................400795
AB485705.1 BK polyomavirus DNA, complete genome, isolate: MT clone 54 2442_............_______245360
AB485706.1 BK polyomavirus DNA, complete genome, isolate: MT clone 59 3989_...................400795
AB485706.1 BK polyomavirus DNA, complete genome, isolate: MT clone 59 2442_............_______245360
AB485707.1 BK polyomavirus DNA, complete genome, isolate: MT clone 87 3956_...................397495
AB485707.1 BK polyomavirus DNA, complete genome, isolate: MT clone 87 2409_............_______242060
AB485708.1 BK polyomavirus DNA, complete genome, isolate: MT clone 93 3989_...................400795
AB485708.1 BK polyomavirus DNA, complete genome, isolate: MT clone 93 2442_............_______245360
AB485709.1 BK polyomavirus DNA, complete genome, isolate: MT clone 97 3991_...................400995
AB485709.1 BK polyomavirus DNA, complete genome, isolate: MT clone 97 2444_............_______245560
AB485710.1 BK polyomavirus DNA, complete genome, isolate: MT clone 104 4099_...................411795
AB485710.1 BK polyomavirus DNA, complete genome, isolate: MT clone 104 2552_............_______256360
AB485711.1 BK polyomavirus DNA, complete genome, isolate: MT clone 108 3947_...................396595
AB485711.1 BK polyomavirus DNA, complete genome, isolate: MT clone 108 2400_............_______241160
AB485712.1 BK polyomavirus DNA, complete genome, isolate: MT clone 111 4099_...................411795
AB485712.1 BK polyomavirus DNA, complete genome, isolate: MT clone 111 2552_............_______256360
AB464953.1 BK polyomavirus DNA, complete genome, isolate: ANY-2 3956_...................397495
AB464953.1 BK polyomavirus DNA, complete genome, isolate: ANY-2 2409_............_______242060
AB464954.1 BK polyomavirus DNA, complete genome, isolate: ANY-3 3956_...................397495
AB464954.1 BK polyomavirus DNA, complete genome, isolate: ANY-3 2409_............_______242060
AB464955.1 BK polyomavirus DNA, complete genome, isolate: ANY-7 3956_...................397495
AB464955.1 BK polyomavirus DNA, complete genome, isolate: ANY-7 2409_............_______242060
AB464956.1 BK polyomavirus DNA, complete genome, isolate: ANY-13 3956_...................397495
AB464956.1 BK polyomavirus DNA, complete genome, isolate: ANY-13 2409_............_______242060
AB464957.1 BK polyomavirus DNA, complete genome, isolate: ANY-29 3956_...................397495
AB464957.1 BK polyomavirus DNA, complete genome, isolate: ANY-29 2409_............_______242060
AB464958.1 BK polyomavirus DNA, complete genome, isolate: ANY-32 3956_...................397495
AB464958.1 BK polyomavirus DNA, complete genome, isolate: ANY-32 2409_............_______242060
AB464959.1 BK polyomavirus DNA, complete genome, isolate: ANY-33 3956_...................397495
AB464959.1 BK polyomavirus DNA, complete genome, isolate: ANY-33 2409_............_______242060
AB464960.1 BK polyomavirus DNA, complete genome, isolate: ANY-38 3956_...................397495
AB464960.1 BK polyomavirus DNA, complete genome, isolate: ANY-38 2409_............_______242060
AB464961.1 BK polyomavirus DNA, complete genome, isolate: ANY-56 3956_...................397495
AB464961.1 BK polyomavirus DNA, complete genome, isolate: ANY-56 2409_............_______242060
AB464962.1 BK polyomavirus DNA, complete genome, isolate: ANY-57 3956_...................397495
AB464962.1 BK polyomavirus DNA, complete genome, isolate: ANY-57 2409_............_______242060
AB464963.1 BK polyomavirus DNA, complete genome, isolate: ANY-63 3956_...................397495
AB464963.1 BK polyomavirus DNA, complete genome, isolate: ANY-63 2409_............_______242060
FR720308.1 BK polyomavirus complete genome, isolate RU2 3956_...................397495
FR720308.1 BK polyomavirus complete genome, isolate RU2 2409_............_______242060
FR720309.1 BK polyomavirus complete genome, isolate RU3 3953_...................397195
FR720309.1 BK polyomavirus complete genome, isolate RU3 2406_............_______241760
FR720310.1 BK polyomavirus complete genome, isolate RU4 3956_...................397495
FR720310.1 BK polyomavirus complete genome, isolate RU4 2409_............_______242060
FR720311.1 BK polyomavirus complete genome, isolate RU5 3956_...................397495
FR720311.1 BK polyomavirus complete genome, isolate RU5 2409_............_______242060
FR720312.1 BK polyomavirus complete genome, isolate RU6 3956_...................397495
FR720312.1 BK polyomavirus complete genome, isolate RU6 2409_............_______242060
FR720313.1 BK polyomavirus complete genome, isolate RU7 3956_...................397495
FR720313.1 BK polyomavirus complete genome, isolate RU7 2409_............_______242060
FR720314.1 BK polyomavirus complete genome, isolate RU8 3956_...................397495
FR720314.1 BK polyomavirus complete genome, isolate RU8 2409_............_______242060
FR720315.1 BK polyomavirus complete genome, isolate RU9 3956_...................397495
FR720315.1 BK polyomavirus complete genome, isolate RU9 2409_............_______242060
FR720318.1 BK polyomavirus complete genome, isolate RU12 3956_...................397495
FR720318.1 BK polyomavirus complete genome, isolate RU12 2409_............_______242060
FR720321.1 BK polyomavirus complete genome, isolate RU16 3956_...................397495
FR720321.1 BK polyomavirus complete genome, isolate RU16 2409_............_______242060
FR720322.1 BK polyomavirus complete genome, isolate RU18 3956_...................397495
FR720322.1 BK polyomavirus complete genome, isolate RU18 2409_............_______242060
FR720323.1 BK polyomavirus complete genome, isolate RU19 3956_...................397495
FR720323.1 BK polyomavirus complete genome, isolate RU19 2409_............_______242060
AB263912.1 BK polyomavirus DNA, complete genome, isolate: CAF-15 3955............c.......397495
AB263912.1 BK polyomavirus DNA, complete genome, isolate: CAF-15 2409_............_______242060
AB263913.1 BK polyomavirus DNA, complete genome, isolate: CAF-5 3955............c.......397495
AB263913.1 BK polyomavirus DNA, complete genome, isolate: CAF-5 2409_............_______242060
AB263914.1 BK polyomavirus DNA, complete genome, isolate: CAF-9 3955............c.......397495
AB263914.1 BK polyomavirus DNA, complete genome, isolate: CAF-9 2409_............_______242060
AB263926.1 BK polyomavirus DNA, complete genome, isolate: KEN-1 3955............c.......397495
AB263926.1 BK polyomavirus DNA, complete genome, isolate: KEN-1 2409_............_______242060
AB263928.1 BK polyomavirus DNA, complete genome, isolate: KEN-4 3955............c.......397495
AB263928.1 BK polyomavirus DNA, complete genome, isolate: KEN-4 2409_............_______242060
AB263938.1 BK polyomavirus DNA, complete genome, isolate: ZAF-1 3955............c.......397495
AB263938.1 BK polyomavirus DNA, complete genome, isolate: ZAF-1 2409_............_______242060
AB369092.1 BK polyomavirus DNA, complete genome, isolate: A-62H 3955............c.......397495
AB369092.1 BK polyomavirus DNA, complete genome, isolate: A-62H 2409_............_______242060
M23122.1PLYCGAS BK polyomavirus strain AS, complete genome 3911__.............c....392885
M23122.1PLYCGAS BK polyomavirus strain AS, complete genome 2375_............_______238660
AB211386.1 BK polyomavirus DNA, complete genome, isolate: KOM-3 3944__.............c....396185
AB211386.1 BK polyomavirus DNA, complete genome, isolate: KOM-3 2408_............_______241960
AB263916.1 BK polyomavirus DNA, complete genome, isolate: ETH-3 3950__.............c....396785
AB263916.1 BK polyomavirus DNA, complete genome, isolate: ETH-3 2408_............_______241960
AB263920.1 BK polyomavirus DNA, complete genome, isolate: GBR-12 3941__.............c....395885
AB263920.1 BK polyomavirus DNA, complete genome, isolate: GBR-12 2399_............_______241060
EF376992.1 BK polyomavirus isolate J/1025/05, complete genome 3941__.............c....395885
EF376992.1 BK polyomavirus isolate J/1025/05, complete genome 2399_............_______241060
AB301101.1 BK polyomavirus DNA, complete genome, isolate: J2B-11 3941__.............c....395885
AB301101.1 BK polyomavirus DNA, complete genome, isolate: J2B-11 2399_............_______241060
AB365130.1 BK polyomavirus DNA, complete genome, isolate: FUK-22 3944__.............c....396185
AB365130.1 BK polyomavirus DNA, complete genome, isolate: FUK-22 2408_............_______241960
AB365139.1 BK polyomavirus DNA, complete genome, isolate: NEA-27 3944__.............c....396185
AB365139.1 BK polyomavirus DNA, complete genome, isolate: NEA-27 2408_............_______241960
AB369093.1 BK polyomavirus DNA, complete genome, isolate: A-66H 3959_....aa.............397785
AB369093.1 BK polyomavirus DNA, complete genome, isolate: A-66H 2410_............_______242160
AB217919.1 BK polyomavirus DNA, complete genome, isolate: TW-3a 3960__...aa.............397780
AB217919.1 BK polyomavirus DNA, complete genome, isolate: TW-3a 2410_............_______242160
AB211388.1 BK polyomavirus DNA, complete genome, isolate: KOM-7 3950__...aa.............396780
AB211388.1 BK polyomavirus DNA, complete genome, isolate: KOM-7 2401_............_______241260
AB211391.1 BK polyomavirus DNA, complete genome, isolate: TW-3 3960__...aa.............397780
AB211391.1 BK polyomavirus DNA, complete genome, isolate: TW-3 2410_............_______242160
AB211387.1 BK polyomavirus DNA, complete genome, isolate: KOM-2 3949__...aa.............396680
AB211387.1 BK polyomavirus DNA, complete genome, isolate: KOM-2 2401_............_______241260
AB211389.1 BK polyomavirus DNA, complete genome, isolate: RYU-3 3950__...aa.............396780
AB211389.1 BK polyomavirus DNA, complete genome, isolate: RYU-3 2400_............_______241160
AB211390.1 BK polyomavirus DNA, complete genome, isolate: THK-8 3869__...aa.............388680
AB211390.1 BK polyomavirus DNA, complete genome, isolate: THK-8 2319_............_______233060
AB260033.1 BK polyomavirus DNA, complete genome, isolate: FIN-2 3960__...aa.............397780
AB260033.1 BK polyomavirus DNA, complete genome, isolate: FIN-2 2410_............_______242160
AB260034.1 BK polyomavirus DNA, complete genome, isolate: FIN-4 3960__...aa.............397780
AB260034.1 BK polyomavirus DNA, complete genome, isolate: FIN-4 2410_............_______242160
AB269822.1 BK polyomavirus DNA, complete genome, strain: FIN-2 3960__...aa.............397780
AB269822.1 BK polyomavirus DNA, complete genome, strain: FIN-2 2410_............_______242160
AB269823.1 BK polyomavirus DNA, complete genome, strain: Fin-4 3960__...aa.............397780
AB269823.1 BK polyomavirus DNA, complete genome, strain: Fin-4 2410_............_______242160
AB269824.1 BK polyomavirus DNA, complete genome, strain: FNL-9 3960__...aa.............397780
AB269824.1 BK polyomavirus DNA, complete genome, strain: FNL-9 2410_............_______242160
AB269825.1 BK polyomavirus DNA, complete genome, strain: FNL-17 3960__...aa.............397780
AB269825.1 BK polyomavirus DNA, complete genome, strain: FNL-17 2410_............_______242160
AB269826.1 BK polyomavirus DNA, complete genome, strain: FUJ-13 3951__...aa.............396880
AB269826.1 BK polyomavirus DNA, complete genome, strain: FUJ-13 2401_............_______241260
AB269827.1 BK polyomavirus DNA, complete genome, strain: FUJ-18 3960__...aa.............397780
AB269827.1 BK polyomavirus DNA, complete genome, strain: FUJ-18 2410_............_______242160
AB269828.1 BK polyomavirus DNA, complete genome, strain: FUJ-32 3960__...aa.............397780
AB269828.1 BK polyomavirus DNA, complete genome, strain: FUJ-32 2410_............_______242160
AB269829.1 BK polyomavirus DNA, complete genome, strain: GRC-3 3960__...aa.............397780
AB269829.1 BK polyomavirus DNA, complete genome, strain: GRC-3 2410_............_______242160
AB269830.1 BK polyomavirus DNA, complete genome, strain: GRC-4 3960__...aa.............397780
AB269830.1 BK polyomavirus DNA, complete genome, strain: GRC-4 2410_............_______242160
AB269831.1 BK polyomavirus DNA, complete genome, strain: GRC-5 3960__...aa.............397780
AB269831.1 BK polyomavirus DNA, complete genome, strain: GRC-5 2410_............_______242160
AB269832.1 BK polyomavirus DNA, complete genome, strain: ITA-3 3960__...aa.............397780
AB269832.1 BK polyomavirus DNA, complete genome, strain: ITA-3 2410_............_______242160
AB269833.1 BK polyomavirus DNA, complete genome, strain: ITA-4 3960__...aa.............397780
AB269833.1 BK polyomavirus DNA, complete genome, strain: ITA-4 2410_............_______242160
AB269834.1 BK polyomavirus DNA, complete genome, strain: JPN-15 3950__...aa.............396780
AB269834.1 BK polyomavirus DNA, complete genome, strain: JPN-15 2401_............_______241260
AB269835.1 BK polyomavirus DNA, complete genome, strain: JPN-31 3949__...aa.............396680
AB269835.1 BK polyomavirus DNA, complete genome, strain: JPN-31 2401_............_______241260
AB269837.1 BK polyomavirus DNA, complete genome, strain: JPN-33 3960__...aa.............397780
AB269837.1 BK polyomavirus DNA, complete genome, strain: JPN-33 2410_............_______242160
AB269838.1 BK polyomavirus DNA, complete genome, strain: JPN-34 3949__...aa.............396680
AB269838.1 BK polyomavirus DNA, complete genome, strain: JPN-34 2401_............_______241260
AB269839.1 BK polyomavirus DNA, complete genome, strain: JPN-35 3949__...aa.............396680
AB269839.1 BK polyomavirus DNA, complete genome, strain: JPN-35 2401_............_______241260
AB269840.1 BK polyomavirus DNA, complete genome, strain: JPN-36 3960__...aa.............397780
AB269840.1 BK polyomavirus DNA, complete genome, strain: JPN-36 2410_............_______242160
AB269841.1 BK polyomavirus DNA, complete genome, strain: MMR-1 3951__...aa.............396880
AB269841.1 BK polyomavirus DNA, complete genome, strain: MMR-1 2401_............_______241260
AB269842.1 BK polyomavirus DNA, complete genome, strain: MMR-24 3960__...aa.............397780
AB269842.1 BK polyomavirus DNA, complete genome, strain: MMR-24 2410_............_______242160
AB269843.1 BK polyomavirus DNA, complete genome, strain: MMR-28 3960__...aa.............397780
AB269843.1 BK polyomavirus DNA, complete genome, strain: MMR-28 2410_............_______242160
AB269844.1 BK polyomavirus DNA, complete genome, strain: MMR-29 3951__...aa.............396880
AB269844.1 BK polyomavirus DNA, complete genome, strain: MMR-29 2401_............_______241260
AB269845.1 BK polyomavirus DNA, complete genome, strain: MMR-43 3948__...aa.............396580
AB269845.1 BK polyomavirus DNA, complete genome, strain: MMR-43 2401_............_______241260
AB269846.1 BK polyomavirus DNA, complete genome, strain: MON-1 3959__...aa.............397680
AB269846.1 BK polyomavirus DNA, complete genome, strain: MON-1 2409_............_______242060
AB269847.1 BK polyomavirus DNA, complete genome, strain: MON-2 3960__...aa.............397780
AB269847.1 BK polyomavirus DNA, complete genome, strain: MON-2 2410_............_______242160
AB269848.1 BK polyomavirus DNA, complete genome, strain: MON-3 3960__...aa.............397780
AB269848.1 BK polyomavirus DNA, complete genome, strain: MON-3 2410_............_______242160
AB269849.1 BK polyomavirus DNA, complete genome, strain: MON-5 3960__...aa.............397780
AB269849.1 BK polyomavirus DNA, complete genome, strain: MON-5 2410_............_______242160
AB269850.1 BK polyomavirus DNA, complete genome, strain: MON-6 3960__...aa.............397780
AB269850.1 BK polyomavirus DNA, complete genome, strain: MON-6 2410_............_______242160
AB269851.1 BK polyomavirus DNA, complete genome, strain: MON-8 3950__...aa.............396780
AB269851.1 BK polyomavirus DNA, complete genome, strain: MON-8 2401_............_______241260
AB269852.1 BK polyomavirus DNA, complete genome, strain: NEC-14 3960__...aa.............397780
AB269852.1 BK polyomavirus DNA, complete genome, strain: NEC-14 2410_............_______242160
AB269853.1 BK polyomavirus DNA, complete genome, strain: NEC-24 3960__...aa.............397780
AB269853.1 BK polyomavirus DNA, complete genome, strain: NEC-24 2410_............_______242160
AB269854.1 BK polyomavirus DNA, complete genome, strain: NEC-4 3960__...aa.............397780
AB269854.1 BK polyomavirus DNA, complete genome, strain: NEC-4 2410_............_______242160
AB269855.1 BK polyomavirus DNA, complete genome, strain: NWC-14 3960__...aa.............397780
AB269855.1 BK polyomavirus DNA, complete genome, strain: NWC-14 2410_............_______242160
AB269856.1 BK polyomavirus DNA, complete genome, strain: NWC-15 3960__...aa.............397780
AB269856.1 BK polyomavirus DNA, complete genome, strain: NWC-15 2410_............_______242160
AB269857.1 BK polyomavirus DNA, complete genome, strain: NWC-7 3961__...aa.............397880
AB269857.1 BK polyomavirus DNA, complete genome, strain: NWC-7 2410_............_______242160
AB269858.1 BK polyomavirus DNA, complete genome, strain: NWC-8 3960__...aa.............397780
AB269858.1 BK polyomavirus DNA, complete genome, strain: NWC-8 2410_............_______242160
AB269859.1 BK polyomavirus DNA, complete genome, strain: PHL-8 3960__...aa.............397780
AB269859.1 BK polyomavirus DNA, complete genome, strain: PHL-8 2410_............_______242160
AB269860.1 BK polyomavirus DNA, complete genome, strain: SEC-3 3960__...aa.............397780
AB269860.1 BK polyomavirus DNA, complete genome, strain: SEC-3 2410_............_______242160
AB269861.1 BK polyomavirus DNA, complete genome, strain: SEC-6 3960__...aa.............397780
AB269861.1 BK polyomavirus DNA, complete genome, strain: SEC-6 2410_............_______242160
AB269862.1 BK polyomavirus DNA, complete genome, strain: SEC-21 3931__...aa.............394880
AB269862.1 BK polyomavirus DNA, complete genome, strain: SEC-21 2381_............_______239260
AB269863.1 BK polyomavirus DNA, complete genome, strain: SWC-1 3960__...aa.............397780
AB269863.1 BK polyomavirus DNA, complete genome, strain: SWC-1 2410_............_______242160
AB269864.1 BK polyomavirus DNA, complete genome, strain: SWC-2 3960__...aa.............397780
AB269864.1 BK polyomavirus DNA, complete genome, strain: SWC-2 2410_............_______242160
AB269865.1 BK polyomavirus DNA, complete genome, strain: SWC-4 3960__...aa.............397780
AB269865.1 BK polyomavirus DNA, complete genome, strain: SWC-4 2410_............_______242160
AB269866.1 BK polyomavirus DNA, complete genome, strain: SWE-4 3960__...aa.............397780
AB269866.1 BK polyomavirus DNA, complete genome, strain: SWE-4 2410_............_______242160
AB269867.1 BK polyomavirus DNA, complete genome, strain: VNM-1 3960__...aa.............397780
AB269867.1 BK polyomavirus DNA, complete genome, strain: VNM-1 2410_............_______242160
AB269868.1 BK polyomavirus DNA, complete genome, strain: VNM-2 3951__...aa.............396880
AB269868.1 BK polyomavirus DNA, complete genome, strain: VNM-2 2401_............_______241260
AB269869.1 BK polyomavirus DNA, complete genome, strain: VNM-7 3960__...aa.............397780
AB269869.1 BK polyomavirus DNA, complete genome, strain: VNM-7 2410_............_______242160
AB301097.1 BK polyomavirus DNA, complete genome, isolate: LAB-33 3960__...aa.............397780
AB301097.1 BK polyomavirus DNA, complete genome, isolate: LAB-33 2410_............_______242160
AB365138.1 BK polyomavirus DNA, complete genome, isolate: NEA-2 3950__...aa.............396780
AB365138.1 BK polyomavirus DNA, complete genome, isolate: NEA-2 2401_............_______241260
AB365140.1 BK polyomavirus DNA, complete genome, isolate: NEA-28 4062__...aa.............407980
AB365140.1 BK polyomavirus DNA, complete genome, isolate: NEA-28 2513_............_______252460
AB365141.1 BK polyomavirus DNA, complete genome, isolate: NEB-10 3950__...aa.............396780
AB365141.1 BK polyomavirus DNA, complete genome, isolate: NEB-10 2401_............_______241260
AB365142.1 BK polyomavirus DNA, complete genome, isolate: NEB-26 3960__...aa.............397780
AB365142.1 BK polyomavirus DNA, complete genome, isolate: NEB-26 2410_............_______242160
AB365143.1 BK polyomavirus DNA, complete genome, isolate: NEB-27 3960__...aa.............397780
AB365143.1 BK polyomavirus DNA, complete genome, isolate: NEB-27 2410_............_______242160
AB365147.1 BK polyomavirus DNA, complete genome, isolate: NGY-19 3960__...aa.............397780
AB365147.1 BK polyomavirus DNA, complete genome, isolate: NGY-19 2410_............_______242160
AB365149.1 BK polyomavirus DNA, complete genome, isolate: OKN-19 3950__...aa.............396780
AB365149.1 BK polyomavirus DNA, complete genome, isolate: OKN-19 2400_............_______241160
AB365150.1 BK polyomavirus DNA, complete genome, isolate: OKN-22 3950__...aa.............396780
AB365150.1 BK polyomavirus DNA, complete genome, isolate: OKN-22 2401_............_______241260
AB365167.1 BK polyomavirus DNA, complete genome, isolate: SHA-28 3960__...aa.............397780
AB365167.1 BK polyomavirus DNA, complete genome, isolate: SHA-28 2410_............_______242160
AB365168.1 BK polyomavirus DNA, complete genome, isolate: SHA-30 3960__...aa.............397780
AB365168.1 BK polyomavirus DNA, complete genome, isolate: SHA-30 2410_............_______242160
AB365171.1 BK polyomavirus DNA, complete genome, isolate: SHA-43 3960__...aa.............397780
AB365171.1 BK polyomavirus DNA, complete genome, isolate: SHA-43 2410_............_______242160
AB365172.1 BK polyomavirus DNA, complete genome, isolate: SHA-47 3960__...aa.............397780
AB365172.1 BK polyomavirus DNA, complete genome, isolate: SHA-47 2410_............_______242160
AB365173.1 BK polyomavirus DNA, complete genome, isolate: SHA-55 3960__...aa.............397780
AB365173.1 BK polyomavirus DNA, complete genome, isolate: SHA-55 2410_............_______242160
AB365178.1 BK polyomavirus DNA, complete genome, isolate: SHA-78 3960__...aa.............397780
AB365178.1 BK polyomavirus DNA, complete genome, isolate: SHA-78 2410_............_______242160
AB369089.1 BK polyomavirus DNA, complete genome, isolate: A-37H 3960__...aa.............397780
AB369089.1 BK polyomavirus DNA, complete genome, isolate: A-37H 2410_............_______242160
FR720316.1 BK polyomavirus complete genome, isolate RU10 3960__...aa.............397780
FR720316.1 BK polyomavirus complete genome, isolate RU10 2410_............_______242160
FR720317.1 BK polyomavirus complete genome, isolate RU11 3960__...aa.............397780
FR720317.1 BK polyomavirus complete genome, isolate RU11 2410_............_______242160
FR720319.1 BK polyomavirus complete genome, isolate RU13 3960__...aa.............397780
FR720319.1 BK polyomavirus complete genome, isolate RU13 2410_............_______242160
FR720320.1 BK polyomavirus complete genome, isolate RU15 3960__...aa.............397780
FR720320.1 BK polyomavirus complete genome, isolate RU15 2410_............_______242160
AB269836.1 BK polyomavirus DNA, complete genome, strain: JPN-32 2410_............_______242160