../../tmp/servers/virsirnadb/1781517383
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18701ccgggagcgatagagcagggccccg25
NC_009334.1 Human herpesvirus 4, complete genome 97782.........................97806100
NC_009334.1 Human herpesvirus 4, complete genome 62077___________...........t..6209052
NC_009334.1 Human herpesvirus 4, complete genome 56443_____..........t.t..gg.._5642560
NC_009334.1 Human herpesvirus 4, complete genome 123933_____...cc.........c..___12391756
NC_009334.1 Human herpesvirus 4, complete genome 47705____________..........a..4769348
NC_009334.1 Human herpesvirus 4, complete genome 74400___________..c.........._7441248
NC_009334.1 Human herpesvirus 4, complete genome 116961___...ttt.a.t.a..........11698264
NC_009334.1 Human herpesvirus 4, complete genome 138425____________...........a.13843748
NC_009334.1 Human herpesvirus 4, complete genome 137885_____________..........._13789544
NC_009334.1 Human herpesvirus 4, complete genome 104844___________..........g.__10483344
NC_009334.1 Human herpesvirus 4, complete genome 107217____________..........t._10720644
NC_009334.1 Human herpesvirus 4, complete genome 111419______..........t._______11143044
NC_009334.1 Human herpesvirus 4, complete genome 12381______________.........._1239040
NC_009334.1 Human herpesvirus 4, complete genome 15451______________.........._1546040
NC_009334.1 Human herpesvirus 4, complete genome 18521______________.........._1853040
NC_009334.1 Human herpesvirus 4, complete genome 21591______________.........._2160040
NC_009334.1 Human herpesvirus 4, complete genome 24661______________.........._2467040
NC_009334.1 Human herpesvirus 4, complete genome 27731______________.........._2774040
NC_009334.1 Human herpesvirus 4, complete genome 30801______________.........._3081040
NC_009334.1 Human herpesvirus 4, complete genome 33871______________.........._3388040
NC_009334.1 Human herpesvirus 4, complete genome 45349______________.........._4534040
NC_009334.1 Human herpesvirus 4, complete genome 45990___________..........____4599940
NC_009334.1 Human herpesvirus 4, complete genome 48646______________.........._4863740
NC_009334.1 Human herpesvirus 4, complete genome 57887___..........____________5789640
NC_009334.1 Human herpesvirus 4, complete genome 77223.........gg..c.__________7720948
NC_009334.1 Human herpesvirus 4, complete genome 111234_______.c.........c._____11124644
NC_009334.1 Human herpesvirus 4, complete genome 118949____________.........tt..11896144
NC_009334.1 Human herpesvirus 4, complete genome 81742______________.........g.8175240
NC_009334.1 Human herpesvirus 4, complete genome 126959_____________.........g._12694940
NC_009334.1 Human herpesvirus 4, complete genome 5492____________.........____550036
NC_009334.1 Human herpesvirus 4, complete genome 54644________________.........5465236
NC_009334.1 Human herpesvirus 4, complete genome 66298_______________........._6630636
NC_009334.1 Human herpesvirus 4, complete genome 75176_____________.........___7516836
NC_009334.1 Human herpesvirus 4, complete genome 105742________________.........10575036
NC_009334.1 Human herpesvirus 4, complete genome 114897_______________........._11490536
NC_009334.1 Human herpesvirus 4, complete genome 121240_____________.........___12124836
NC_009334.1 Human herpesvirus 4, complete genome 121264_______________........._12125636
NC_009334.1 Human herpesvirus 4, complete genome 129715____________.........____12972336
NC_009334.1 Human herpesvirus 4, complete genome 161472.........________________16146436
NC_009334.1 Human herpesvirus 4, complete genome 165986______.........__________16599436
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 96870........................_9689396
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 61959___________...........t..6197252
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 56262_____..........t.t..gg.._5624460
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 123025_____...cc.........c..___12300956
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 47524____________..........a..4751248
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 74284___________..c.........._7429648
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 116053___...ttt.a.t.a..........11607464
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 81596______________...........8160644
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 37178______.g..c........._____3719148
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 45799..a.t..tagc..........____4581960
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 103932___________..........g.__10392144
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 106306____________..........t._10629544
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 110508______..........t._______11051944
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 12431______________.........._1244040
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 15504______________.........._1551340
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 18577______________.........._1858640
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 21650______________.........._2165940
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 24723______________.........._2473240
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 27796______________.........._2780540
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 30869______________.........._3087840
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 33942______________.........._3395140
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 48465______________.........._4845640
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 57757___..........____________5776640
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 77107.........gg..c.__________7709348
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 110323_______.c.........c._____11033544
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 118041____________.........tt..11805344
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 126051_____________.........g._12604140
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 5492____________.........____550036
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 45169______________.........__4516136
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 54463________________.........5447136
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 66181_______________........._6618936
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 75060_____________.........___7505236
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 104830________________.........10483836
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 113986_______________........._11399436
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 116221_______________........._11622936
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 120332_____________.........___12034036