../../tmp/servers/virsirnadb/1899050449
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18761ccttgctgttccacaatgtcgtatt25
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 97154.........................97178100
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 118835_____________.........g..11882444
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 9499_____..........__________949040
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 10111_____..........__________1010240
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 95849___.c.........cg.._______9583548
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 42367___________.........c.___4235740
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 49997______.........g.________5000740
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 66869_____________.........___6686136
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 92345.........________________9235336
NC_009334.1 Human herpesvirus 4, complete genome 98066.......a..............c..9809092
NC_009334.1 Human herpesvirus 4, complete genome 165522______............c._____16550952
NC_009334.1 Human herpesvirus 4, complete genome 95926..c.........c.c._________9594152
NC_009334.1 Human herpesvirus 4, complete genome 119743_____________.........g..11973244
NC_009334.1 Human herpesvirus 4, complete genome 9448_____..........__________943940
NC_009334.1 Human herpesvirus 4, complete genome 10060_____..........__________1005140
NC_009334.1 Human herpesvirus 4, complete genome 96761___.c.........cg.._______9674748
NC_009334.1 Human herpesvirus 4, complete genome 131934_________.t.........c.___13194644
NC_009334.1 Human herpesvirus 4, complete genome 42550___________.........c.___4254040
NC_009334.1 Human herpesvirus 4, complete genome 50178______.........g.________5018840
NC_009334.1 Human herpesvirus 4, complete genome 66986_____________.........___6697836
NC_009334.1 Human herpesvirus 4, complete genome 93257.........________________9326536
NC_009334.1 Human herpesvirus 4, complete genome 129196_____.........___________12920436