../../tmp/servers/virsirnadb/1590992256
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18771cgattaaggaccttgttatgacaaa25
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 97312.........................97336100
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 1521__________..........t..__153348
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 99436__________..ag.........__9942444
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 70414__________.........______7042236
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 108324______.........__________10831636
NC_009334.1 Human herpesvirus 4, complete genome 98224.................t..c....9824892
NC_009334.1 Human herpesvirus 4, complete genome 1521__________..........t..__153348
NC_009334.1 Human herpesvirus 4, complete genome 100348__________..ag.........__10033644
NC_009334.1 Human herpesvirus 4, complete genome 70530__________.........______7053836
NC_009334.1 Human herpesvirus 4, complete genome 109235______.........__________10922736
NC_009334.1 Human herpesvirus 4, complete genome 140846________.........________14085436