../../tmp/servers/virsirnadb/886979357
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18681ctgcaaagggacccacggtggaacagg27
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 95822..........g................9584896
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 3258______________...t.........324644
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 107788______________..........t..10780044
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 13641___________..........._____1365140
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 16714___________..........._____1672440
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 19787___________..........._____1979740
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 22860___________..........._____2287040
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 25933___________..........._____2594340
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 29006___________..........._____2901640
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 32079___________..........._____3208940
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 35152___________..........._____3516240
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 118239..c.........gtc.aa..cc...__11821562
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 5048____________.........c..g._503544
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 8087_____________..........t.__807640
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 89230___.........t..____________8924140
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 120001_______________..........c.11999040
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 3609___________..........______360037
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 9491_________________..........950037
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 57724_..........________________5773337
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 122462___________..........______12247137
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 44788_....gcc..t.ag.atc.........4476362
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 13141_____.........ta..c._______1315544
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 16214_____.........ta..c._______1622844
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 19287_____.........ta..c._______1930144
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 22360_____.........ta..c._______2237444
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 25433_____.........ta..c._______2544744
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 28506_____.........ta..c._______2852044
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 31579_____.........ta..c._______3159344
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 34652_____.........ta..c._______3466644
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 63576____________.........tc..c.6359044
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 84915_.c..gt.........___________8492944
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 97171_____________..tt........._9715940
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 103424__...g..cttt.ac.........___10344555
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 10101_______________.t........._1011137
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 47407________________.........c.4741737
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 7218__.........________________721033
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 37576______.........____________3758433
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 51662____________.........______5167033
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 72457____________.........______7246533
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 104938____________.........______10494633
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 106725_........._________________10671733
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 114252____________.........______11426033
NC_009334.1 Human herpesvirus 4, complete genome 96734..........g................9676096
NC_009334.1 Human herpesvirus 4, complete genome 136593__________..t............__13660751
NC_009334.1 Human herpesvirus 4, complete genome 3258______________...t.........324644
NC_009334.1 Human herpesvirus 4, complete genome 108699______________..........t..10871144
NC_009334.1 Human herpesvirus 4, complete genome 119147..c.........gtc.aa..cc...__11912362
NC_009334.1 Human herpesvirus 4, complete genome 5048____________.........c..g._503544
NC_009334.1 Human herpesvirus 4, complete genome 135288_______.a.g..........______13530144
NC_009334.1 Human herpesvirus 4, complete genome 86393______________.........g.._8638240
NC_009334.1 Human herpesvirus 4, complete genome 90143___.........t..____________9015440
NC_009334.1 Human herpesvirus 4, complete genome 120909_______________..........c.12089840
NC_009334.1 Human herpesvirus 4, complete genome 133568_______..........t.________13357940
NC_009334.1 Human herpesvirus 4, complete genome 161815_____.g..........__________16180440
NC_009334.1 Human herpesvirus 4, complete genome 3609___________..........______360037
NC_009334.1 Human herpesvirus 4, complete genome 9440_________________..........944937
NC_009334.1 Human herpesvirus 4, complete genome 57854_..........________________5786337
NC_009334.1 Human herpesvirus 4, complete genome 123370___________..........______12337937
NC_009334.1 Human herpesvirus 4, complete genome 129205________________.........._12919637
NC_009334.1 Human herpesvirus 4, complete genome 44968_....gcc..t.ag.atc.........4494362
NC_009334.1 Human herpesvirus 4, complete genome 13091_____.........ta..c._______1310544
NC_009334.1 Human herpesvirus 4, complete genome 16161_____.........ta..c._______1617544
NC_009334.1 Human herpesvirus 4, complete genome 19231_____.........ta..c._______1924544
NC_009334.1 Human herpesvirus 4, complete genome 22301_____.........ta..c._______2231544
NC_009334.1 Human herpesvirus 4, complete genome 25371_____.........ta..c._______2538544
NC_009334.1 Human herpesvirus 4, complete genome 28441_____.........ta..c._______2845544
NC_009334.1 Human herpesvirus 4, complete genome 31511_____.........ta..c._______3152544
NC_009334.1 Human herpesvirus 4, complete genome 34581_____.........ta..c._______3459544
NC_009334.1 Human herpesvirus 4, complete genome 63694____________.........tc..c.6370844
NC_009334.1 Human herpesvirus 4, complete genome 104336__...g..cttt.ac.........___10435755
NC_009334.1 Human herpesvirus 4, complete genome 10050_______________.t........._1006037
NC_009334.1 Human herpesvirus 4, complete genome 47588________________.........c.4759837
NC_009334.1 Human herpesvirus 4, complete genome 60250________________.c.........6026037
NC_009334.1 Human herpesvirus 4, complete genome 51843____________.........______5185133
NC_009334.1 Human herpesvirus 4, complete genome 72573____________.........______7258133
NC_009334.1 Human herpesvirus 4, complete genome 105850____________.........______10585833
NC_009334.1 Human herpesvirus 4, complete genome 107636_........._________________10762833
NC_009334.1 Human herpesvirus 4, complete genome 115163____________.........______11517133
NC_009334.1 Human herpesvirus 4, complete genome 136951________.........__________13694333
NC_009334.1 Human herpesvirus 4, complete genome 141576___........._______________14156833
NC_009334.1 Human herpesvirus 4, complete genome 149606_____........._____________14959833
NC_009334.1 Human herpesvirus 4, complete genome 164705_________........._________16469733
NC_009334.1 Human herpesvirus 4, complete genome 167300___________........._______16729233