../../tmp/servers/virsirnadb/1462286075
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi17791gaaccagatcacgaacttggagcagtccg29
AF316321.2 Enterovirus 5865/sin/000009, complete genome 4250.............................4278100
AF352027.1 Enterovirus 5666/sin/002209, complete genome 4250.............................4278100
DQ341365.1 Human enterovirus 71 isolate PP37-MAL-01, complete genome 4250.............................4278100
DQ341366.1 Human enterovirus 71 isolate SB2864-SAR-00, complete genome 4250...t..............a..........427893
EF373575.1 Human enterovirus 71 strain E2002042-TW-CDC polyprotein gene, complet4252...t..............a..........428093
AB550336.1 Human enterovirus 71 genomic RNA, complete genome, strain: C7/Osaka-o4251...............t..a..........427993
AB550337.1 Human enterovirus 71 genomic RNA, complete genome, strain: C7/Osaka-L4251...............t..a..........427993
AJ586873.1 Human enterovirus 71 gene for polyprotein, isolate EV71/9/97/SHA89 4250............a..t..a..........427889
DQ341364.1 Human enterovirus 71 isolate 5511-SIN-00, complete genome 4251...............t..a..a.......427989
AM396587.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate UH1/P4250............a..t..a..........427889
DQ341362.1 Human enterovirus 71 isolate SB12736-SAR-03, complete genome 4251............a..t..a..a.......427986
DQ341363.1 Human enterovirus 71 isolate S19841-SAR-03, complete genome 4251............a..t..a..a.......427986
AB575927.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1134186............a..t..a.....a....421486
DQ133459.1 Human enterovirus 71 strain 1235 polyprotein gene, complete cds 4246...t......t..........a..a..t.427482
FJ461781.1 Human enterovirus 71 isolate NUH0083/SIN/08, complete genome 4215............a..t..a..a.....t.424382
GU366191.1 Human enterovirus 71 strain Henan10-08-China, complete genome 4246..........t.a........a..a..t.427482
GQ279369.1 Human enterovirus 71 strain SZ/HK08-5, complete genome 4246...t......t.a...........a..t.427482
GQ279369.1 Human enterovirus 71 strain SZ/HK08-5, complete genome 4732______...a..a........._______471748
HM002488.1 Human enterovirus 71 strain BJ366, complete genome 4246...t......t..........a..a..t.427482
AB575911.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1004185......a...t.a...........a..t.421382
AB575912.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1084199......a...t.a...........a..t.422782
HQ423142.1 Human enterovirus 71 strain KMM/09, complete genome 4246..........t.a........a..a..t.427482
HQ423143.1 Human enterovirus 71 strain KM186/09, complete genome 4246..........t.a........a..a..t.427482
AY421768.1 Human coxsackievirus A12 strain Texas-12, complete genome 4243..........t.c...c.t.....a..t.427179
AY697458.1 Human enterovirus 76 polyprotein gene, complete cds 4266..........t.t...a.t..a.....t.429479
AY697459.1 Human enterovirus 89 polyprotein gene, complete cds 4257.........tt.c...a.t.....a..t.428575
DQ341358.1 Human enterovirus 71 isolate S40221-SAR-00, complete genome 4248..........t.t..tc.t..a.....g.427675
DQ341358.1 Human enterovirus 71 isolate S40221-SAR-00, complete genome 4733_______.....a........._______471948
DQ341361.1 Human enterovirus 71 isolate 1M-AUS-12-00, complete genome 4248..........t.t..tc.t..a.....g.427675
DQ341361.1 Human enterovirus 71 isolate 1M-AUS-12-00, complete genome 4733_______..............._______471951
DQ452074.1 Human enterovirus 71 strain 804/NO/03, complete genome 4249..........t.t..tc.t..a.....g.427775
DQ452074.1 Human enterovirus 71 strain 804/NO/03, complete genome 4735______......a........._______472051
EU414334.1 Human enterovirus 71 strain PLday4-CH-06, complete genome 4247..........t.t..tc.t..a.....g.427575
EU414335.1 Human enterovirus 71 strain PLday1-CH-06, complete genome 4247..........t.t..tc.t..a.....g.427575
EU812514.1 Human coxsackievirus A16 strain FY18 from China, complete genome 4255..........t.a...c.a..a..a..t.428375
FJ198212.1 Human coxsackievirus A16 strain GZ08, complete genome 4249..........t.a..tc.t..a.....t.427775
AB550340.1 Human enterovirus 71 genomic RNA, complete genome, strain: KED005-org4248..........t.t..tc.t..a.....g.427675
AB550340.1 Human enterovirus 71 genomic RNA, complete genome, strain: KED005-org4733_______.....a........._______471948
AB550341.1 Human enterovirus 71 genomic RNA, complete genome, strain: KED005-LPS4248..........t.t..tc.t..a.....g.427675
AB550341.1 Human enterovirus 71 genomic RNA, complete genome, strain: KED005-LPS4733_______.....a........._______471948
AB575937.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1414160..........t.t..tc.t..a.....g.418875
AB575937.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1414645_______.....a........._______463148
AB501329.1 Human echovirus 13 gene for polyprotein, complete cds, strain: 2002-24223..g.........c.c.a.t....._____424665
AB501330.1 Human echovirus 13 gene for polyprotein, complete cds, strain: 2002-24223..g.........c.c.a.t....._____424665
AB501332.1 Human echovirus 13 gene for polyprotein, complete cds, strain: S3(1)-4223..g.........c.c.a.t....._____424665
DQ341360.1 Human enterovirus 71 isolate J115-MAL-01, complete genome 4247..........t.t..tc.t..a..a..g.427572
DQ341360.1 Human enterovirus 71 isolate J115-MAL-01, complete genome 4732_______.....a........._______471848
AB550332.1 Human enterovirus 71 genomic RNA, complete genome, strain: 1095-org 4248.........tt.t..tc.c..a.....a.427672
AB550332.1 Human enterovirus 71 genomic RNA, complete genome, strain: 1095-org 4733_______.....a........._______471948
AB550333.1 Human enterovirus 71 genomic RNA, complete genome, strain: 1095-LPS1 4248.........tt.t..tc.c..a.....a.427672
AB550333.1 Human enterovirus 71 genomic RNA, complete genome, strain: 1095-LPS1 4733_______.....a........._______471948
AF499641.1 Human coxsackievirus A19 strain 8663, complete genome 4258.........gg.t.ca...c.c.....__428468
DQ341357.1 Human enterovirus 71 isolate 7F-AUS-6-99, complete genome 4734______......a........._______471951
DQ381846.1 Human enterovirus 71 strain 6F/AUS/6/99, complete genome 4734______......a........._______471951
AB575936.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 9614673______......a........._______465851
AB575939.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 3654665______......a........._______465051
AB575941.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 2484673______......a........._______465851
AB575942.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 3694668______......a........._______465351
AB575948.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1014691______......a........._______467651
AB426611.1 Human enterovirus 97 genomic RNA, complete genome, strain: DT94-0227 4226_.g.........c.cta.t......ag..425368
AF499639.1 Human coxsackievirus A17 strain G12, complete genome 1535__.........tt......__________155151
AF499639.1 Human coxsackievirus A17 strain G12, complete genome 906____________..........gg...__89244
AB501331.1 Human echovirus 13 gene for polyprotein, complete cds, strain: I5(1)-4223..g.........c.c.a.t..a.._____424662
AF136379.1 Enterovirus 71 isolate NCKU9822 polyprotein mRNA, complete cds 4734_______.....a........._______472048
AF176044.1 Enterovirus 71 polyprotein gene, complete cds 4735_______.....a........._______472148
AF304457.1 Enterovirus 71 strain Tainan/5746/98 polyprotein mRNA, complete cds 4734_______.....a........._______472048
AF304458.1 Enterovirus 71 strain Tainan/4643/98 polyprotein mRNA, complete cds 4734_______.....a........._______472048
AF304459.1 Enterovirus 71 strain Tainan/6092/98 polyprotein mRNA, complete cds 4734_______.....a........._______472048
AY421765.1 Human coxsackievirus A7 strain Parker, complete genome 4728_______..a............_______471448
DQ060149.1 Human enterovirus 71 strain pinf7-54A from Taiwan, complete genome 4734_______.....a........._______472048
DQ341359.1 Human enterovirus 71 isolate S10862-SAR-98, complete genome 4733_______.....a........._______471948
AM396584.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate ENT/P4732_______.....a........._______471848
AM396585.1 Human enterovirus 71 gene for polyprotein, genomic RNA, isolate ENT/P4732_______.....a........._______471848
EF063152.1 Human enterovirus 71 strain E2005125-TW polyprotein gene, complete cd4733_______.....a........._______471948
AB575935.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 4804677_______.....a........._______466348
AB575938.1 Human enterovirus 71 gene for polyprotein, complete cds, isolate: 1004706_______.....a........._______469248
AF405669.1 Human poliovirus 1 isolate HAI00003, complete genome 4219_......tcg.t.........________420055
AF499637.1 Human coxsackievirus A13 strain Flores, complete genome 3230_________.g......gca.........321155
AF465511.1 Human coxsackievirus A13 strain Flores, complete genome 3230_________.g......gca.........321155
EU144042.1 Human coxsackievirus B3 isolate CVB3-MCH polyprotein gene, complete c5513______.........g.g..t.t...___553255
AF111983.3 Human poliovirus 1 isolate CHN-Henan/91-3, complete genome 4299_.........t.t.cta.cc.c......_432565
AM084225.1 Human poliovirus 2 RNA for polyprotein, complete genome, genomic RNA,4293.........tg...cta.tc.t.....__431965
AB180070.1 Human poliovirus 1 gene for polyprotein, complete cds, isolate:Mindan901____________..........gg...._88648
AB180071.1 Human poliovirus 1 gene for polyprotein, complete cds, isolate:Luzon-901____________..........gg...._88648
AB180072.1 Human poliovirus 1 gene for polyprotein, complete cds, isolate:Luzon-901____________..........gg...._88648
AB180073.1 Human poliovirus 1 gene for polyprotein, complete cds, isolate:Luzon-901____________..........gg...._88648
AF326764.2 Simian enterovirus 46 strain OM22 (P15), complete genome 3319__..tc.g...ac..tc..........__334362
FJ607338.1 Human enterovirus 71 strain 605/SHENZHEN/08/China/HFMD Severe/2008, c4731______...g..a........._______471648
GQ892830.1 Human enterovirus 71 strain GX/LZ 08-04/08/CHN, complete genome 4732______...g..a........._______471748
GQ994990.1 Human enterovirus 71 strain Chongqing2-09-China, complete genome 4732______...g..a........._______471748
HM002489.1 Human enterovirus 71 strain BJ398, complete genome 4733______...g..a........._______471848
HQ891923.1 Human enterovirus 71 strain Shanghai 27-2009, complete genome 4733______...g..a........._______471848
HQ891924.1 Human enterovirus 71 strain Shanghai 28-2009, complete genome 4733______...g..a........._______471848
HQ891927.1 Human enterovirus 71 strain Shanghai 64-2009, complete genome 4733______...g..a........._______471848
HQ891928.1 Human enterovirus 71 strain Shanghai 117-2009, complete genome 4733______...g..a........._______471848
HQ269389.1 Human coxsackievirus A16 isolate XM-CA16-3560, complete genome 4736______...g..a........._______472148
HQ400942.1 Human enterovirus 71 HZ08/Hangzhou/2008, complete genome 4732______...g..a........._______471748
HQ456306.1 Human enterovirus A strain GZ2010-134, complete genome 4732______...g..a........._______471748
HQ456310.1 Human enterovirus A strain GZ08-530, complete genome 4732______...g..a........._______471748
HQ456311.1 Human enterovirus A strain GZ08-522, complete genome 4732______...g..a........._______471748
HQ456312.1 Human enterovirus A strain GZ08-520, complete genome 4732______...g..a........._______471748
AY426531.1 Human enterovirus 68 strain Fermon, complete genome 1065__.........t...gca.t...______108555
AY426531.1 Human enterovirus 68 strain Fermon, complete genome 2478___________.........t.tg...._249448
AY278551.1 Human poliovirus 2 isolate P2S/Mog66-4 (21043), complete genome 4218..g....tca.t.........________419855
AY278551.1 Human poliovirus 2 isolate P2S/Mog66-4 (21043), complete genome 5031.g..........c.c.a..__________504951
AB205395.1 Human enterovirus C genomic RNA, complete genome, strain: Cambodia-025023.g..........c.c.a..__________504151
AB601882.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC1943___________.........t.tg...._195948
AB601882.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC530__.........t...______________54241
AB601883.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC1942___________.........t.tg...._195848
AB601883.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC529__.........t...______________54141
AB601884.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC1943___________.........t.tg...._195948
AB601884.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC530__.........t...______________54241
AB601885.1 Human enterovirus 68 gene for polyprotein, complete cds, strain: JPOC1943___________.........t.tg...._195948
DQ890388.1 Human poliovirus 2 strain PER8310769, complete genome 4294_.........t.t.cga.cc.c.....__431962
AF083069.1 Echovirus 5, complete genome 5597__________..a..........t.a.__561348
AY843297.1 Human enterovirus 79 strain USA/CA79-10384, complete genome 5594__________..c..........t.a.__561048
AY843308.1 Human enterovirus 101 strain CIV03-10361, complete genome 2871__.........t.t..g..__________288748
EF555644.1 Human enterovirus 99, complete genome 903_____________.........gg...._88944
EF555644.1 Human enterovirus 99, complete genome 3862______________...........____387237
EF555645.1 Human enterovirus 102, complete genome 904____________..........gg...__89044
AY421764.1 Human coxsackievirus A6 strain Gdula, complete genome 4758_______..g..a........._______474444
GQ279368.1 Human coxsackievirus A16 strain SZ/HK08-3, complete genome 7079___.........c..t..___________709344
GQ279371.1 Human coxsackievirus A16 strain SZ/HK08-7, complete genome 4734_______..g..a........._______472044
HQ426649.1 Human enterovirus 71 strain 2010FJLY008, complete genome 4729_______..g..a........._______471544
EF107097.1 Human enterovirus 94 isolate 19/04 from Democratic Republic of the Co4482__..........a..______________449441
M33854.1CXA3CG Coxsackievirus B3 (CVB3) complete genome 7352.........a...________________736441
M16572.1CXA3G Coxsackievirus B3, complete genome 7350.........a...________________736241
M88483.1CXAB3CG Coxsackievirus B3 mRNA, complete genome 7353.........a...________________736541
AF231763.1 Coxsackievirus B3 strain 31-1-93, complete genome 7353.........a...________________736541
AF231764.1 Coxsackievirus B3 strain P, complete genome 7353.........a...________________736541
AF231765.1 Coxsackievirus B3 strain PD, complete genome 7353.........a...________________736541
AY302560.1 Enterovirus 69 strain Toluca-1 complete genome 2799______..........g..__________278741
AY752945.1 Human coxsackievirus B3 strain 0, complete genome 7353.........a...________________736541
AY752946.1 Human coxsackievirus B3 strain 20, complete genome 7353.........a...________________736541
AY752944.2 Human coxsackievirus B3 strain 28, complete genome 7353.........a...________________736541
AY421763.1 Human coxsackievirus A5 strain Swartz, complete genome 2356_______________..........c.._236841
AJ544513.1 Human poliovirus 2 gene for polyprotein, genomic RNA, isolate 102050 4217_.g...ac.a.t.........________419851
AY876912.1 Human enterovirus Ningbo3-02, complete genome 4312...........__________________432237
AY876913.1 Human enterovirus Hangzhou13-02, complete genome 4312...........__________________432237
AY302555.1 Human echovirus 32 strain PR-10 complete genome 2464__________________...........247437