../../tmp/servers/virsirnadb/2013240224
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi11351gatctcaatctcgggaacctcaa23
L08805.1HPBETNC Hepatitis B virus envelope, surface and nucleocapsid protein g2423.......................2445100
U95551.1 Hepatitis B virus subtype ayw, complete genome 2426.......................2448100
AB014369.1 Hepatitis B virus genomic DNA, complete sequence, isolate 10D10HCC 2424.......................2446100
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 2424.......................2446100
AB014381.1 Hepatitis B virus genomic DNA, complete sequence, isolate 22Y04HCC 2424.......................2446100
AB014388.1 Hepatitis B virus genomic DNA, complete sequence, isolate 29Y11HCC 2370.......................2392100
AB014393.1 Hepatitis B virus genomic DNA, complete sequence, isolate 34Y16HCC 2424.......................2446100
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 2424.......................2446100
AF121251.1 Hepatitis B virus isolate HBV/9873, complete genome 2424.......................2446100
AF182805.1 Hepatitis B virus strain WLAID, complete genome 2393.......................2415100
AB042285.1 Hepatitis B virus DNA, complete genome, isolate:NSS-4 2424.......................2446100
AJ344115.1 Hepatitis B virus complete genome, genotype A, isolate X27 2430.......................2452100
AB073823.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi35 2424.......................2446100
AB073836.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw25 2424.......................2446100
AB073841.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw30 2424.......................2446100
AB090269.1 Hepatitis B virus DNA, complete genome, strain:CH2-OHf 2424.......................2446100
AY206380.1 Hepatitis B virus strain FMU009 complete genome 2426.......................2448100
AY206391.1 Hepatitis B virus strain FMU020 complete genome 2426.......................2448100
AB104710.1 Hepatitis B virus DNA, complete sequence, isolate: EG105 2426.......................2448100
AY233281.1 Hepatitis B virus isolate 303 complete genome 2430.......................2452100
AY167097.1 Hepatitis B virus isolate IIIb, complete genome 2424.......................2446100
AY167102.1 Hepatitis B virus isolate Vc, complete genome 2424.......................2446100
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 2430.......................2452100
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 2430.......................2452100
AB116087.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND8 2430.......................2452100
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 2430.......................2452100
AB116092.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH20 2430.......................2452100
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 2426.......................2448100
AB109478.1 Hepatitis B virus DNA, complete genome, strain:Ehime10: Iyo 41676 2424.......................2446100
AB188241.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA25 2424.......................2446100
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 2430.......................2452100
AB119254.1 Hepatitis B virus DNA, complete genome, strain:Ehime16:BD No53,2003012424.......................2446100
AJ627228.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 34408 2418.......................2440100
DQ399006.1 Hepatitis B virus isolate G1, complete genome 524.......................546100
AB219427.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4075, PNN2 2424.......................2446100
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 2430.......................2452100
AB222709.1 Hepatitis B virus DNA, complete genome, isolate: UZBV34 2424.......................2446100
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 2424.......................2446100
DQ788835.1 Hepatitis B virus splice variant AP12, complete genome 1939.......................1961100
DQ986376.1 Hepatitis B virus strain F0297, complete genome 2396.......................2418100
DQ995804.1 Hepatitis B virus isolate C1691-11, complete genome 2424.......................2446100
AB270536.1 Hepatitis B virus DNA, complete genome, isolate: MGL226F 2429.......................2451100
AB270537.1 Hepatitis B virus DNA, complete genome, isolate: MGL22F 2424.......................2446100
AB270538.1 Hepatitis B virus DNA, complete genome, isolate: MGL231F 2424.......................2446100
AB270542.1 Hepatitis B virus DNA, complete genome, isolate: MGL12F 2424.......................2446100
AB195946.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-2 2379.......................2401100
DQ993683.1 Hepatitis B virus isolate patient 82, complete genome 2424.......................2446100
AB298720.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1S 2424.......................2446100
AB298721.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1C 2424.......................2446100
AB300360.1 Hepatitis B virus DNA, complete genome, isolate: patient2 2424.......................2446100
EU158262.1 Hepatitis B virus isolate G116, complete genome 2424.......................2446100
EU547563.1 Hepatitis B virus isolate MC06, complete genome 2424.......................2446100
AB302942.1 Hepatitis B virus DNA, complte genome, isolate: GRE3837NN 2424.......................2446100
AB302943.1 Hepatitis B virus DNA, complte genome, isolate: GRE3639NN 2424.......................2446100
AB302944.1 Hepatitis B virus DNA, complte genome, isolate: GRE3641NN 2424.......................2446100
AB302945.1 Hepatitis B virus DNA, complte genome, isolate: GRE3643NN 2424.......................2446100
EU871972.1 Hepatitis B virus isolate 6-024-8, complete genome 2424.......................2446100
EU871973.1 Hepatitis B virus isolate 6-024-99-5, complete genome 2424.......................2446100
AB453985.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH7 2430.......................2452100
AB453989.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH11 2430.......................2452100
EU939547.1 Hepatitis B virus isolate C45, complete genome 2424.......................2446100
EU939582.1 Hepatitis B virus isolate B25, complete genome 2424.......................2446100
EU939657.1 Hepatitis B virus isolate D139, complete genome 2424.......................2446100
EU939665.1 Hepatitis B virus isolate C129, complete genome 2424.......................2446100
EU939671.1 Hepatitis B virus isolate C201, complete genome 2424.......................2446100
EU939678.1 Hepatitis B virus isolate D106, complete genome 2424.......................2446100
AB367406.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 15/Adefovir2424.......................2446100
AB367419.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 28, derived2424.......................2446100
AB367426.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 35, derived2379.......................2401100
AB367435.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 44/Adefovir2418.......................2440100
FJ151414.1 Hepatitis B virus strain FD18-3, complete genome 1939.......................1961100
AB367801.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 30 2379.......................2401100
FJ386611.1 Hepatitis B virus isolate 2018, complete genome 2424.......................2446100
FJ386615.1 Hepatitis B virus isolate 2061, complete genome 2424.......................2446100
FJ386616.1 Hepatitis B virus isolate 2064, complete genome 2424.......................2446100
FJ386624.1 Hepatitis B virus isolate 2187, complete genome 2424.......................2446100
FJ386633.1 Hepatitis B virus isolate 2372, complete genome 2424.......................2446100
FJ386654.1 Hepatitis B virus isolate S51, complete genome 2424.......................2446100
FJ386677.1 Hepatitis B virus isolate S1104, complete genome 2382.......................2404100
FM199974.1 Hepatitis B virus complete genome, strain 45021 2430.......................2452100
FJ361772.1 Hepatitis B virus 146/Thailand, complete genome 2406.......................2428100
FJ787477.1 Hepatitis B virus isolate LWM-1, complete genome 2424.......................2446100
AB362931.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon2430.......................2452100
GQ372968.1 Hepatitis B virus isolate 6380-3, complete genome 2424.......................2446100
GQ377518.1 Hepatitis B virus isolate J14, complete genome 2424.......................2446100
GQ377543.1 Hepatitis B virus isolate J63, complete genome 2424.......................2446100
GQ377592.1 Hepatitis B virus isolate J149, complete genome 2424.......................2446100
GQ377605.1 Hepatitis B virus isolate J169, complete genome 2424.......................2446100
GQ475321.1 Hepatitis B virus isolate KOR17CHB, complete genome 2424.......................2446100
GQ475326.1 Hepatitis B virus isolate KOR22LC, complete genome 2376.......................2398100
GQ475341.1 Hepatitis B virus isolate KOR37HCC, complete genome 2424.......................2446100
GQ475343.1 Hepatitis B virus isolate KOR39HCC, complete genome 2391.......................2413100
GQ475352.1 Hepatitis B virus isolate KOR48HCC, complete genome 2391.......................2413100
FN545826.1 Hepatitis B virus complete genome, strain 34010 2430.......................2452100
FN545830.1 Hepatitis B virus complete genome, strain 34033 2430.......................2452100
FN545840.1 Hepatitis B virus complete genome, strain 42339 2418.......................2440100
AB555498.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA41 2424.......................2446100
HQ684849.1 Hepatitis B virus isolate HBVJSTZ2, complete genome 2424.......................2446100
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 2397.................t.....241995
X01587.1 Hepatitis B virus subtype adr4 (HBV) 2296.................t.....231895
X14193.1 Hepatitis B virus DNA for adr mutant 2422.................t.....244495
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 2430.................t.....245295
X02763.1 Hepatitis b virus genome (serotype adw2) 618.................t.....64095
X65257.1 Hepatitis B virus (ayw,patient C) PreS1, PreS2, PreC, C, X and polyme2426.................t.....244895
X65258.1 Hepatitis B virus (ayw,patient CI) genes PreS1, PreS2, PreC, C, X and2426.................t.....244895
X65259.1 Hepatitis B virus (ayw,patient E) genes PreS1, PreS2, PreC, C, X and 2426.................t.....244895
X68292.1 Hepatitis B Virus DNA 2426.................t.....244895
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 2430.................t.....245295
V01460.1 Hepatitis B virus (strain ayw) genome 761.................t.....73995
X02496.1 Human hepatitis B virus strain ayw variant 2426.................t.....244895
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 2298.................t.....232095
D00330.1HPBADW2 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl2424.................t.....244695
D00331.1HPBADW3 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl2424.................t.....244695
D12980.1HPBCG Hepatitis B virus subtype adr(SRADR) DNA, complete genome 2298.................t.....232095
S50225.1 {HBV variant} [hepatitis B virus HBV, surface antigen-negative patien2432.................t.....245495
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 2424.................t.....244695
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 2432.................t.....245495
X59795.1 Hepatitis B virus (ayw subtype mutant) complete genome 2405.................t.....242795
M38454.1HPBADR1CG Hepatitis B virus , complete genome 1030.................t.....105295
M54923.1HPBADWZ Hepatitis B virus (subtype adw), complete genome 2424.................t.....244695
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 2422.................t.....244495
Z35716.1 Human hepatitis B virus (ayw4) genes for surface protein S, core prot2426.................t.....244895
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot2432.................t.....245495
D23678.1HPBA2HYS2 Hepatitis B virus (A2-HBVYS2) complete genome sequence 2424...................c...244695
D23680.1HPBB4HST1 Hepatitis B virus (B4-HBVST1) complete genome sequence 2403.................t.....242595
D23681.1HPBC4HST2 Hepatitis B virus (C4-HBVST2) complete genome sequence 2424.................t.....244695
D23682.1HPBB5HKO1 Hepatitis B virus (B5-HBVKO1) complete genome sequence 2424.................t.....244695
D23683.1HPBC5HKO2 Hepatitis B virus (C5-HBVKO2) complete genome sequence 2424.................t.....244695
D23684.1HPBC6T588 Hepatitis B virus (C6-TKB588) complete genome sequence 2424.................t.....244695
X85254.1 Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polym2426.................t.....244895
D50489.1HPBA11A Hepatitis B virus DNA, complete genome, isolate:A11 2418.................t.....244095
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete2418.................t.....244095
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete2418.................t.....244095
X80924.1 Hepatitis B virus (patient 4) complete genome 2426.................t.....244895
X80926.1 Hepatitis B virus (patient 5) complete genome 2426.................t.....244895
X80925.1 Hepatitis B virus (patient 6) complete genome 2426.................t.....244895
X51970.1 Hepatitis B virus (HBV 991) complete genome 2430.................t.....245295
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes2430.................t.....245295
X97849.1 Hepatitis B virus (patient 3) complete genome 2426.................t.....244895
X97851.1 Hepatitis B virus (patient 6) complete genome 2426.................t.....244895
Y07587.1 Hepatitis B virus, complete genome 2426.................t.....244895
X98077.1 Hepatitis B virus complete genome, wild type 2424.................t.....244695
D50517.1 Hepatitis B virus clone HBV-ASA-EX1 genomic DNA, complete sequence 2424.................t.....244695
D50518.1 Hepatitis B virus clone HBV-ASA-EX2 genomic DNA, complete sequence 2424.................t.....244695
D50519.1 Hepatitis B virus clone HBV-ASA-EX3 genomic DNA, complete sequence 2424.................t.....244695
D50520.1 Hepatitis B virus clone HBV-ASA-EX4 genomic DNA, complete sequence 2424.................t.....244695
AF043593.1 Hepatitis B virus isolate 6/89, complete genome 2412.................t.....243495
AF043594.1 Hepatitis B virus isolate 1/91, complete genome 2424.................t.....244695
AB014360.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D01HCC 2424.................t.....244695
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 2376.................t.....239895
AB014362.1 Hepatitis B virus genomic DNA, complete sequence, isolate 03D03HCC 2424.................t.....244695
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 2424.................t.....244695
AB014365.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D06HCC 2424.................t.....244695
AB014366.1 Hepatitis B virus genomic DNA, complete sequence, isolate 07D07HCC 2436...................c...245895
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 2376.................t.....239895
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 2430.................t.....245295
AB014372.1 Hepatitis B virus genomic DNA, complete sequence, isolate 13D13HCC 2424.................t.....244695
AB014373.1 Hepatitis B virus genomic DNA, complete sequence, isolate 14D14HCC 2388.................t.....241095
AB014374.1 Hepatitis B virus genomic DNA, complete sequence, isolate 15D15HCC 2424.................t.....244695
AB014375.1 Hepatitis B virus genomic DNA, complete sequence, isolate 16T01HCC 2379.................t.....240195
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 2424.................t.....244695
AB014377.1 Hepatitis B virus genomic DNA, complete sequence, isolate 18T03HCC 2424.................t.....244695
AB014378.1 Hepatitis B virus genomic DNA, complete sequence, isolate 19Y01HCC 2424.................t.....244695
AB014379.1 Hepatitis B virus genomic DNA, complete sequence, isolate 20Y02HCC 2424.................t.....244695
AB014380.1 Hepatitis B virus genomic DNA, complete sequence, isolate 21Y03HCC 2424.................t.....244695
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 2377.................t.....239995
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 2385.................t.....240795
AB014395.1 Hepatitis B virus genomic DNA, complete sequence, isolate 36Y18HCC 2411.................t.....243395
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 2424.................t.....244695
AB014392.1 Hepatitis B virus genomic DNA, complete sequence, isolate 33Y15HCC 2424.................t.....244695
AB014399.1 Hepatitis B virus genomic DNA, complete sequence, isolate 40Y22HCC 2424.................t.....244695
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 2430.................t.....245295
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 2426.................t.....244895
AF068756.1 Hepatitis B virus, complete genome 2427.................t.....244995
AF100308.1 Hepatitis B virus strain 2-18, complete genome 2426.................t.....244895
AF100309.1 Hepatitis B virus strain 56, complete genome 2426.................t.....244895
AJ131133.1 Hepatitis B virus, complete genome, strain JL1 2423.................t.....244595
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 2421.................t.....244395
Y18856.1 Hepatitis B virus complete genome, isolate HBV-C5 2421.................t.....244395
Y18857.1 Hepatitis B virus complete genome, isolate HBV-C6 2421.................t.....244395
Y18858.1 Hepatitis B virus complete genome, isolate HBV-C7 2421.................t.....244395
AF143298.1 Hepatitis B virus clone 7720-G8, complete genome 554.................t.....57695
AF143299.1 Hepatitis B virus clone 7744-G9, complete genome 515.................t.....53795
AF143300.1 Hepatitis B virus clone 7832-G4, complete genome 497.................t.....51995
AF143301.1 Hepatitis B virus clone BW1903, complete genome 617.................t.....63995
AF143304.1 Hepatitis B virus clone HD319, complete genome 593.................t.....61595
AF143305.1 Hepatitis B virus clone RM501, complete genome 590.................t.....61295
AF143306.1 Hepatitis B virus clone RM517, complete genome 617.................t.....63995
AF143307.1 Hepatitis B virus clone RM518, complete genome 380.................t.....40295
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 1057.................t.....107995
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 1057.................t.....107995
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 1057.................t.....107995
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 1057.................t.....107995
AF151735.1 Hepatitis B virus, complete genome 2424.................t.....244695
AB031262.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietA-32424.................t.....244695
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-22424.................t.....244695
AB031266.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-32424.................t.....244695
AB031267.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-62424.................t.....244695
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 2426.................t.....244895
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 2426.................t.....244895
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 2422.................t.....244495
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 2422.................t.....244495
AB026815.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 2:full 2422.................t.....244495
AB033550.1 Hepatitis B virus DNA, complete genome 2424.................t.....244695
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 2424.................t.....244695
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 2424.................t.....244695
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 2424.................t.....244695
AB033555.1 Hepatitis B virus DNA, complete genome, isolate:PAD744 2424.................t.....244695
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 2424.................t.....244695
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 2424.................t.....244695
AB033558.1 Hepatitis B virus DNA, complete genome, isolate:JYW796 2424.................t.....244695
AB033559.1 Hepatitis B virus DNA, complete genome, isolate:PYW310 2424.................t.....244695
AB010289.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-1 2424.................t.....244695
AF121243.1 Hepatitis B virus isolate HBV/14611, complete genome 2424.................t.....244695
AF121244.1 Hepatitis B virus isolate HBV/15122, complete genome 2424.................t.....244695
AF121245.1 Hepatitis B virus isolate HBV/16091, complete genome 2424.................t.....244695
AF121246.1 Hepatitis B virus isolate HBV/IK29902, complete genome 2424.................t.....244695
AF121247.1 Hepatitis B virus isolate HBV/719, complete genome 2424.................t.....244695
AF121249.1 Hepatitis B virus isolate HBV/4014, complete genome 2424.................t.....244695
AF280817.1 Hepatitis B virus DNA, complete sequence, isolate: HBV-D1 2424.................t.....244695
AF233236.1 Hepatitis B virus strain adw2 isolate HBV334, complete genome 465.................t.....48795
AF282917.1 Hepatitis B virus isolate HBV-B1, complete genome 2424.................t.....244695
AF282918.1 Hepatitis B virus isolate HBV-B2, complete genome 2424.................t.....244695
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 2426.................t.....244895
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 2426.................t.....244895
AF182804.1 Hepatitis B virus strain WLAP10, complete genome 2426.................t.....244895
AF241410.1 Hepatitis B virus isolate 3270, complete genome 2424.................t.....244695
AF241411.1 Hepatitis B virus isolate 8290, complete genome 2424.................t.....244695
AB050018.1 Hepatitis B virus DNA, complete genome 2424.................t.....244695
AB042284.1 Hepatitis B virus DNA, complete genome, isolate:NSS-3 2424.................t.....244695
AJ132335.1 Hepatitis B Virus complete genome, isolate PES1 2424.................t.....244695
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 2424.................t.....244695
AB049610.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN29 2424.................t.....244695
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 2424.................t.....244695
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 2424.................t.....244695
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 2424.................t.....244695
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 2424.................t.....244695
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 2424.................t.....244695
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 2424.................t.....244695
AF223961.1 Hepatitis B virus strain C-1858 isolate ea8, complete genome 2424.................t.....244695
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 2430.................t.....245295
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2424.................t.....244695
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2424.................t.....244695
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2424.................t.....244695
AF330110.1 Hepatitis B virus strain T-1858 genotype C, complete genome 2424.................t.....244695
AF363961.1 Hepatitis B virus strain G683-1, complete genome 604.................t.....62695
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 604.................t.....62695
AY034878.1 Hepatitis B virus isolate HBVKL, complete genome 605.................t.....62795
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 604.................t.....62695
AY040627.1 Hepatitis B virus genotype C, complete genome 2424.................t.....244695
AJ309369.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 102430.................t.....245295
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 112430.................t.....245295
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 112430.................t.....245295
AF297619.1 Hepatitis B virus adw2, complete genome 2430.................t.....245295
AF297620.1 Hepatitis B virus adw1, complete genome 2430.................t.....245295
AF297621.1 Hepatitis B virus isolate 78, complete genome 2430.................t.....245295
AF297622.1 Hepatitis B virus isolate 79, complete genome 2430.................t.....245295
AF297623.1 Hepatitis B virus isolate 83, complete genome 2379.................t.....240195
AF297624.1 Hepatitis B virus isolate 80, complete genome 2430.................t.....245295
AF297625.1 Hepatitis B virus isolate 84, complete genome 2430.................t.....245295
AF411408.1 Hepatitis B virus strain FMU#14, complete genome 2426.................t.....244895
AF411409.1 Hepatitis B virus strain FMC#16, complete genome 2426.................t.....244895
AF411410.1 Hepatitis B virus strain FMC#20, complete genome 2399.................t.....242195
AF411411.1 Hepatitis B virus strain FMC#97, complete genome 2426.................t.....244895
AF411412.1 Hepatitis B virus strain FMC#15, complete genome 2426.................t.....244895
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 2424.................t.....244695
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 2424.................t.....244695
AY033072.1 Hepatitis B virus serotype ayw1, complete genome 604.................t.....62695
AY033073.1 Hepatitis B virus serotype ayw1, complete genome 604.................t.....62695
AY066028.1 Hepatitis B virus isolate FH4, complete genome 2426.................t.....244895
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 2430.................t.....245295
AF458664.1 Hepatitis B virus isolate C84, complete genome 2426.................t.....244895
AF458665.1 Hepatitis B virus isolate C733, complete genome 2426.................t.....244895
AF461357.1 Hepatitis B virus isolate FH5, compete genome 2426.................t.....244895
AF461358.1 Hepatitis B virus isolate FH8, compete genome 2207.................t.....222995
AF461359.1 Hepatitis B virus isolate c16, compete genome 2207.................t.....222995
AF461360.1 Hepatitis B virus isolate FH14-2, compete genome 2426.................t.....244895
AF461361.1 Hepatitis B virus isolate FH3Q, compete genome 2420.................t.....244295
AF461363.1 Hepatitis B virus isolate C8, compete genome 2426.................t.....244895
AF462041.1 Hepatitis B virus clone pAM6, complete genome 2429.................t.....245195
AJ344116.1 Hepatitis B virus complete genome, genotype D, isolate GX27 2424.................t.....244695
AJ344117.1 Hepatitis B virus complete genome, genotype D 2424.................t.....244695
AF473543.1 Hepatitis B virus isolate 2e, complete genome 2424.................t.....244695
AF479684.1 Hepatitis B virus isolate 3c, complete genome 2424.................t.....244695
U87742.3 Hepatitis B virus isolate 7983, complete genome 2442.................t.....246495
U87746.3 Hepatitis B virus isolate 7782, complete genome 2465.................t.....248795
AB073822.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi32 2424.................t.....244695
AB073824.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi4 2424...................c...244695
AB073825.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi51 2424.................t.....244695
AB073826.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi89 2424.................t.....244695
AB073827.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK11 2424.................t.....244695
AB073828.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK37 2424.................t.....244695
AB073829.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK38 2424.................t.....244695
AB073831.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH61 2424.................t.....244695
AB073832.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th65 2424...................c...244695
AB073833.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi59 2424.................t.....244695
AB073834.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi16 2424.................t.....244695
AB073835.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi29 2424.................t.....244695
AB073837.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ku1 2424.................t.....244695
AB073840.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw36 2424.................t.....244695
AB073843.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw27 2424...................c...244695
AB073844.1 Hepatitis B virus DNA, complete genome, isolate:HBV-T11 2424...................c...244695
AB073845.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ya16 2424...................c...244695
AB073847.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Fu53 2424...................c...244695
AB073850.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na102 2424...................c...244695
AB073851.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry1 2424...................c...244695
AB073852.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry11 2424...................c...244695
AB073853.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry24 2424...................c...244695
AB073854.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry30 2424...................c...244695
AB073856.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry46 2424...................c...244695
U87747.3 Hepatitis B virus isolate Wong, complete genome 2427.................t.....244995
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 2424.................t.....244695
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 2424.................t.....244695
AY090452.1 Hepatitis B virus strain Z29, complete genome 2427.................a.....244995
AY090453.1 Hepatitis B virus strain 14-94, complete genome 2427.................t.....244995
AY123424.1 Hepatitis B virus, complete genome 2426.................t.....244895
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro2430.................t.....245295
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro2430.................t.....245295
AY123041.1 Hepatitis B virus serotype adr, complete genome 2298.................t.....232095
AY128092.1 Hepatitis B virus clone pEco63, complete genome 2432.................t.....245495
AF286594.1 Hepatitis B virus subtype adr, complete genome 2424.................t.....244695
AF536524.1 Hepatitis B virus clone 2A, complete genome 2430.................t.....245295
AF533983.1 Hepatitis B virus genotype C, complete genome 2424.................t.....244695
AF418674.1 Hepatitis B virus patient 1185 clone 1, complete genome 2425.................t.....244795
AF418675.1 Hepatitis B virus patient 1185 clone 2, complete genome 2425.................t.....244795
AF418676.1 Hepatitis B virus patient 567 clone 1, complete genome 2413.................t.....243595
AF418677.1 Hepatitis B virus patient 567 clone 2, complete genome 2413.................t.....243595
AF418678.1 Hepatitis B virus patient 567 clone 3, complete genome 2374.................t.....239695
AF418679.1 Hepatitis B virus patient 821 clone 1, complete genome 2423.................t.....244595
AF418680.1 Hepatitis B virus patient 821 clone 2, complete genome 2423.................t.....244595
AF418681.1 Hepatitis B virus patient 821 clone 3, complete genome 2423.................t.....244595
AF418682.1 Hepatitis B virus patient 4727 clone 1, complete genome 2426.................t.....244895
AF418683.1 Hepatitis B virus patient 4727 clone 2, complete genome 2426.................t.....244895
AF418684.1 Hepatitis B virus patient 313 clone 1, complete genome 2430.................t.....245295
AF418685.1 Hepatitis B virus patient 313 clone 2, complete genome 2430.................t.....245295
AF418686.1 Hepatitis B virus patient 313 clone 3, complete genome 2426.................t.....244895
AF418687.1 Hepatitis B virus patient 313 clone 4, complete genome 2427.................t.....244995
AF418688.1 Hepatitis B virus patient 313 clone 5, complete genome 2428.................t.....245095
AF418689.1 Hepatitis B virus patient 313 clone 6, complete genome 2429.................t.....245195
AF418690.1 Hepatitis B virus patient 313 clone 7, complete genome 2430.................t.....245295
AF418691.1 Hepatitis B virus patient 313 clone 8, complete genome 2429.................t.....245195
AF418692.1 Hepatitis B virus patient 313 clone 9, complete genome 2431.................t.....245395
AY152726.1 Hepatitis B virus isolate 8.22, complete genome 2430.................t.....245295
AY161138.1 Hepatitis B virus clone S1.1 complete genome 2433.................t.....245595
AY161139.1 Hepatitis B virus clone S1.2 complete genome 2430.................t.....245295
AY161140.1 Hepatitis B virus clone S2.1 complete genome 2430.................t.....245295
AY161141.1 Hepatitis B virus clone S2.2 complete genome 2430.................t.....245295
AY161142.1 Hepatitis B virus clone S3.1, complete genome 2376.................t.....239895
AY161143.1 Hepatitis B virus clone S3.2, complete genome 2415.................t.....243795
AY161144.1 Hepatitis B virus clone S3.3, complete genome 2415.................t.....243795
AY161145.1 Hepatitis B virus clone S4.1 complete genome 2424.................t.....244695
AY161146.1 Hepatitis B virus clone S4.2 complete genome 2424.................t.....244695
AY161147.1 Hepatitis B virus clone S5.1 complete genome 2429.................t.....245195
AY161148.1 Hepatitis B virus clone S5.2 complete genome 2427.................t.....244995
AY161149.1 Hepatitis B virus clone S5.3 complete genome 2429.................t.....245195
AY161157.1 Hepatitis B virus clone S7.1 complete genome 2424.................t.....244695
AY161159.1 Hepatitis B virus clone S8.1 complete genome 2424.................t.....244695
AY161160.1 Hepatitis B virus clone S8.2 complete genome 2424.................t.....244695
AY161161.1 Hepatitis B virus clone S9.1 complete genome 2421.................t.....244395
AY161162.1 Hepatitis B virus clone S9.2 complete genome 2421.................t.....244395
AY161163.1 Hepatitis B virus clone S9.3 complete genome 2421.................t.....244395
AY148342.1 Hepatitis B virus, complete genome 604.................t.....62695
AB078032.1 Hepatitis B virus complete genome, isolate:AH1-SY 2424.................t.....244695
AB100695.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH133 2424.................t.....244695
AB090268.1 Hepatitis B virus DNA, complete genome, strain:CH1-OHs 2424.................t.....244695
AB090270.1 Hepatitis B virus DNA, complete genome, strain:b-dono12 2424.................t.....244695
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 2299.................t.....232195
AY217373.1 Hepatitis B virus isolate 594, complete genome 2428.................t.....245095
AY217375.1 Hepatitis B virus isolate 599, complete genome 2444.................t.....246695
AY217376.1 Hepatitis B virus isolate Q1-1, complete genome 2415.................t.....243795
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 2214.................t.....223695
AY217378.1 Hepatitis B virus isolate Q3-2, complete genome 2413.................t.....243595
AY217357.1 Hepatitis B virus isolate B1r-4, complete genome 2424.................t.....244695
AY217358.1 Hepatitis B virus isolate B8r-4, complete genome 2424.................t.....244695
AY217359.1 Hepatitis B virus isolate Q6-5, complete genome 2424.................t.....244695
AY217360.1 Hepatitis B virus isolate 6-4, complete genome 2424.................t.....244695
AY217365.1 Hepatitis B virus isolate Q7-1, complete genome 2421.................t.....244395
AY217366.1 Hepatitis B virus isolate 17127, complete genome 2424.................t.....244695
AY217367.1 Hepatitis B virus isolate 17993, complete genome 2422.................t.....244495
AY217368.1 Hepatitis B virus isolate 21949, complete genome 2364.................t.....238695
AY217369.1 Hepatitis B virus isolate H2, complete genome 2422.................t.....244495
AY217370.1 Hepatitis B virus isolate 7-2, complete genome 2241.................t.....226395
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 2424.................t.....244695
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 2424.................t.....244695
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 2424.................t.....244695
AY206374.1 Hepatitis B virus strain FMU003 complete genome 2426.................t.....244895
AY206375.1 Hepatitis B virus strain FMU004 complete genome 2426.................t.....244895
AY206376.1 Hepatitis B virus strain FMU005 complete genome 2426.................t.....244895
AY206377.1 Hepatitis B virus strain FMU006 complete genome 2459.................t.....248195
AY206379.1 Hepatitis B virus strain FMU008 complete genome 2426.................t.....244895
AY206382.1 Hepatitis B virus strain FMU011 complete genome 2426.................t.....244895
AY206383.1 Hepatitis B virus strain FMU012 complete genome 2426.................t.....244895
AY206384.1 Hepatitis B virus strain FMU013 complete genome 2426.................t.....244895
AY206385.1 Hepatitis B virus strain FMU014 complete genome 2393.................t.....241595
AY206388.1 Hepatitis B virus strain FMU017 complete genome 2309.................t.....233195
AY206389.1 Hepatitis B virus strain FMU018 complete genome 2426.................t.....244895
AY206393.1 Hepatitis B virus strain FMU022 complete genome 2315.................t.....233795
AB078031.2 Hepatitis B virus complete genome, isolate:FH1-YS 2424.................t.....244695
AB078033.2 Hepatitis B virus complete genome, isolate:IS1-OY 2424.................t.....244695
AY220698.1 Hepatitis B virus strain 536207, complete genome 2426.................t.....244895
AY220701.1 Hepatitis B virus strain WJQ310, complete genome 2330.................t.....235295
AY220703.1 Hepatitis B virus strain WZJ319, complete genome 2426.................t.....244895
AY220704.1 Hepatitis B virus strain WZJ942, complete genome 2426.................t.....244895
AY306136.1 Hepatitis B virus isolate H85, complete genome 2424.................t.....244695
AB104709.1 Hepatitis B virus DNA, complete sequence, isolate: EG64 2426.................t.....244895
AB104711.1 Hepatitis B virus DNA, complete sequence, isolate: EG104 2426.................t.....244895
AB104712.1 Hepatitis B virus DNA, complete sequence, isolate: EG75 2426.................t.....244895
AY233274.1 Hepatitis B virus isolate 0962 complete genome 2430.................t.....245295
AY233275.1 Hepatitis B virus isolate 163 complete genome 2430.................t.....245295
AY233276.1 Hepatitis B virus isolate 1839 complete genome 2430.................t.....245295
AY233277.1 Hepatitis B virus isolate 1848 complete genome 2430.................t.....245295
AY233278.1 Hepatitis B virus isolate 1 complete genome 2430.................t.....245295
AY233279.1 Hepatitis B virus isolate 28 complete genome 2430.................t.....245295
AY233280.1 Hepatitis B virus isolate 2 complete genome 2430.................t.....245295
AY233282.1 Hepatitis B virus isolate 306 complete genome 2430.................t.....245295
AY233283.1 Hepatitis B virus isolate 4038 complete genome 2430.................t.....245295
AY233284.1 Hepatitis B virus isolate 5283 complete genome 2430.................t.....245295
AY233285.1 Hepatitis B virus isolate 795 complete genome 2430.................t.....245295
AY233286.1 Hepatitis B virus isolate 818 complete genome 2430.................t.....245295
AY233287.1 Hepatitis B virus isolate 8225 complete genome 2430.................t.....245295
AY233288.1 Hepatitis B virus isolate 823 complete genome 2430.................t.....245295
AY233289.1 Hepatitis B virus isolate 833 complete genome 2430.................t.....245295
AY233290.1 Hepatitis B virus isolate 85 complete genome 2430.................t.....245295
AY233291.1 Hepatitis B virus isolate 179 complete genome 2424.................t.....244695
AY233292.1 Hepatitis B virus isolate 184 complete genome 2424.................t.....244695
AY233294.1 Hepatitis B virus isolate 305 complete genome 2424.................t.....244695
AY233295.1 Hepatitis B virus isolate 8 complete genome 2424.................t.....244695
AY233296.1 Hepatitis B virus isolate 185 complete genome 2424.................t.....244695
AY167089.1 Hepatitis B virus isolate Ia, complete genome 2424.................t.....244695
AY167090.1 Hepatitis B virus isolate Ib, complete genome 2424.................t.....244695
AY167093.1 Hepatitis B virus isolate IIa, complete genome 2424.................t.....244695
AY167095.1 Hepatitis B virus isolate IIc, complete genome 2424.................t.....244695
AY167098.1 Hepatitis B virus isolate IVa, complete genome 2424.................t.....244695
AY167099.1 Hepatitis B virus isolate IVb, complete genome 2424.................t.....244695
AY167100.1 Hepatitis B virus isolate Va, complete genome 2424.................t.....244695
AB115551.1 Hepatitis B virus DNA, complete genome, isolate:HBV-CB15 2424.................t.....244695
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co2422.................t.....244495
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 162424.................t.....244695
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 602424.................t.....244695
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 2430.................t.....245295
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 2430.................t.....245295
AY373430.1 Hepatitis B virus clone SWT.3 complete genome 2424.................t.....244695
AY373431.1 Hepatitis B virus clone SWT.4 complete genome 2424.................t.....244695
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 2430.................t.....245295
AB106884.1 Hepatitis B virus DNA, complete genome, strain:HBV-Ya14 2424...................c...244695
AB106885.1 Hepatitis B virus DNA, complete genome, strain:HBV-YA34 2425...................c...244795
AY293309.1 Hepatitis B virus strain Whutj-37, complete genome 1051.................t.....107395
AY236161.1 Hepatitis B virus isolate 12A, complete genome 604.................t.....62695
AY236163.1 Hepatitis B virus isolate 29, complete genome 604.................t.....62695
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 2430.................t.....245295
AB126581.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU301 2426.................t.....244895
AB111112.1 Hepatitis B virus DNA, complete genome, clone: HS-0 2424.................t.....244695
AB111114.1 Hepatitis B virus DNA, complete genome, clone: HS-12 2424.................t.....244695
AB111115.1 Hepatitis B virus DNA, complete genome, clone: K5-0 2258.................t.....228095
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 2363.................t.....238595
AB111117.1 Hepatitis B virus DNA, complete genome, clone: K5-13 2376.................t.....239895
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 2501.................t.....252395
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 2424.................t.....244695
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 2424.................t.....244695
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 2424.................t.....244695
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 2424.................t.....244695
AB111123.1 Hepatitis B virus DNA, complete genome, clone: KM4-12 2424.................t.....244695
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 2424.................t.....244695
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 2424.................t.....244695
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 2424.................t.....244695
AB112066.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY624 2424.................t.....244695
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 2424.................t.....244695
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 2415.................t.....243795
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 2424.................t.....244695
AB112472.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH124 2424.................t.....244695
AY518556.1 Hepatitis B virus isolate 57-1 subtype adw, complete genome 2424.................t.....244695
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 2424.................t.....244695
AB117759.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB14 2424.................t.....244695
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 2430.................t.....245295
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 2430.................t.....245295
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 2430.................t.....245295
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 2430.................t.....245295
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 2430.................t.....245295
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 2430.................t.....245295
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 2430.................t.....245295
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 2430.................t.....245295
AB116089.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP39 2430.................t.....245295
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 2430.................t.....245295
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 2430.................t.....245295
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 2430.................t.....245295
AB116266.1 Hepatitis B virus DNA, complete genome, strain: Ehime TY:871225 2424.................t.....244695
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 2424.................t.....244695
AB115417.1 Hepatitis B virus DNA, complete genome, isolate:HBV-O47 2424.................t.....244695
AB106895.1 Hepatitis B virus DNA, complete genome, isolate:pHB4-4 2424.................t.....244695
AY661792.1 Hepatitis B virus isolate ayw, complete genome 2426.................t.....244895
AY661793.1 Hepatitis B virus isolate 2, complete genome 2426.................t.....244895
AY596102.1 Hepatitis B virus isolate Ia-1, complete genome 2424.................t.....244695
AY596104.1 Hepatitis B virus isolate Ia-4, complete genome 2424.................t.....244695
AY596106.1 Hepatitis B virus isolate Ia-6, complete genome 2424.................t.....244695
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 2424.................t.....244695
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 2424.................t.....244695
AY596110.1 Hepatitis B virus isolate II-2, complete genome 2424.................t.....244695
AY596112.1 Hepatitis B virus isolate Ia-7, complete genome 2424.................t.....244695
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 2432.................t.....245495
AY721605.1 Hepatitis B virus isolate AK1.1, complete genome 2426.................t.....244895
AY721606.1 Hepatitis B virus isolate AT1.2, complete genome 2426.................t.....244895
AY721607.1 Hepatitis B virus isolate HIY1.3, complete genome 2426.................t.....244895
AY721608.1 Hepatitis B virus isolate IB1.4, complete genome 2426.................t.....244895
AY721609.1 Hepatitis B virus isolate AA1.5, complete genome 2426.................t.....244895
AY721610.1 Hepatitis B virus isolate FK1.6, complete genome 2426.................t.....244895
AY721611.1 Hepatitis B virus isolate SK1.7, complete genome 2426.................t.....244895
AY721612.1 Hepatitis B virus isolate BL1.8, complete genome 2426.................t.....244895
AY766463.1 Hepatitis B virus strain GDH1 from China, complete genome 2424.................t.....244695
AY641558.1 Hepatitis B virus isolate He74, complete genome 2424.................t.....244695
AY641559.1 Hepatitis B virus isolate He53, complete genome 2424.................t.....244695
AY641560.1 Hepatitis B virus isolate He100, complete genome 2424.................t.....244695
AY641561.1 Hepatitis B virus isolate He127, complete genome 2424.................t.....244695
AY641562.1 Hepatitis B virus isolate He82, complete genome 2424.................t.....244695
AY800389.1 Hepatitis B virus isolate ZY041024, complete genome 2424.................t.....244695
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 2415.................t.....243795
AY800391.1 Hepatitis B virus isolate ZY041026, complete genome 2424.................t.....244695
AY800392.1 Hepatitis B virus isolate ZY041027, complete genome 2424.................t.....244695
AY796030.1 Hepatitis B virus isolate FC1.9, complete genome 2426.................t.....244895
AY796032.1 Hepatitis B virus isolate NA1.11, complete genome 2426.................t.....244895
AB113875.1 Hepatitis B virus DNA, complete genome, strain:HCC-1-MC 2424.................t.....244695
AB113876.1 Hepatitis B virus DNA, complete genome, strain:HCC-2-NY 2424.................t.....244695
AB113878.1 Hepatitis B virus DNA, complete genome, strain:Ehime-Lam-MM1-001208 2424.................t.....244695
AB113879.1 Hepatitis B virus DNA, complete genome, strain:AH-1-ON980424 2424.................t.....244695
AB109475.1 Hepatitis B virus DNA, complete genome, strain:Ehime7: Iyo 0218004 2424.................t.....244695
AB109476.1 Hepatitis B virus DNA, complete genome, strain:Ehime8: Iyo 8288043 2424.................t.....244695
AB109477.1 Hepatitis B virus DNA, complete genome, strain:Ehime9: Iyo 529380 2424.................t.....244695
AB109479.1 Hepatitis B virus DNA, complete genome, strain:Ehime11: Iyo 529207 2424.................t.....244695
AB110075.1 Hepatitis B virus DNA, complete genome, strain: Ehime12:IM 011025 2424.................t.....244695
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 2424.................t.....244695
AB198077.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.2 2424.................t.....244695
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 2424.................t.....244695
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 2424.................t.....244695
AB198080.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.5 2424.................t.....244695
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 2424.................t.....244695
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 2424.................t.....244695
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 2424.................t.....244695
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 2424.................t.....244695
AY738139.1 Hepatitis B virus clone A1, complete genome 2430.................t.....245295
AY738140.1 Hepatitis B virus clone A2, complete genome 2430.................t.....245295
AY738141.1 Hepatitis B virus clone A3, complete genome 2430.................t.....245295
AY738142.1 Hepatitis B virus clone A4, complete genome 2430.................t.....245295
AY738143.1 Hepatitis B virus clone A11, complete genome 2430.................t.....245295
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 2430.................t.....245295
AB188242.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA38 2424.................t.....244695
AB188244.1 Hepatitis B virus DNA, complete genome, isolate:UZ24 2424.................t.....244695
AJ748098.1 Hepatitis B virus complete genome, genotype C 2424.................t.....244695
AB205118.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ1-1-2 2430.................t.....245295
AB205119.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-1 2424.................t.....244695
AB205120.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-2 2424.................t.....244695
AB205122.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH69-1 2424.................t.....244695
AB205123.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CN578-1 2424.................t.....244695
AB205124.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ3-1-1 2424.................t.....244695
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 2424.................t.....244695
AB205126.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF714-1 2424.................t.....244695
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 2424.................t.....244695
AB205128.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU316-1 2424.................t.....244695
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 2424.................t.....244695
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 2424.................t.....244695
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 2424.................t.....244695
AY817511.1 Hepatitis B virus isolate CHN-L49 from China, complete genome 2424.................t.....244695
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 2424.................t.....244695
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 2424.................t.....244695
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 2424.................t.....244695
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 2424.................t.....244695
AY945307.1 Hepatitis B virus, complete genome 2424.................t.....244695
AP007263.1 HBV genotype A DNA, complete genome, isolate: HB-JI444AF 2430.................t.....245295
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 2430.................t.....245295
AY934764.1 Hepatitis B virus isolate 9210699, complete genome 2430.................t.....245295
AY934765.1 Hepatitis B virus isolate 24306, complete genome 2430.................t.....245295
AY934766.1 Hepatitis B virus isolate 24233, complete genome 2430.................t.....245295
AY934767.1 Hepatitis B virus isolate 27178, complete genome 2430.................t.....245295
AY934768.1 Hepatitis B virus isolate 25830, complete genome 2430.................t.....245295
AY934769.1 Hepatitis B virus isolate 23719, complete genome 2430.................t.....245295
AY934770.1 Hepatitis B virus isolate 953642, complete genome 2430.................t.....245295
AY934771.1 Hepatitis B virus isolate 27439, complete genome 2430.................t.....245295
AY934772.1 Hepatitis B virus isolate 1908, complete genome 2430.................t.....245295
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 2430.................t.....245295
AY934774.1 Hepatitis B virus isolate 9615549, complete genome 2430.................t.....245295
DQ020002.1 Hepatitis B virus isolate 380, complete genome 2430.................t.....245295
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 2430.................t.....245295
AB212625.1 Hepatitis B virus DNA, complete genome, isolateVT1026 2424.................t.....244695
AB212626.1 Hepatitis B virus DNA, complete genome, isolateVT1022 2424.................t.....244695
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 2430.................t.....245295
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 2430.................t.....245295
AB194952.1 Hepatitis B virus DNA, complete genome, isolate: CMR711 2430.................t.....245295
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 2424.................t.....244695
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 2424.................t.....244695
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 2424.................t.....244695
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 2424.................t.....244695
DQ089765.1 Hepatitis B virus isolate HK428, complete genome 2424.................t.....244695
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 2424.................t.....244695
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 2424.................t.....244695
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 2424.................t.....244695
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 2424.................t.....244695
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 2424.................t.....244695
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 2424.................t.....244695
DQ089774.1 Hepatitis B virus isolate HK858, complete genome 2425.................t.....244795
DQ089775.1 Hepatitis B virus isolate HK290, complete genome 2424.................t.....244695
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 2424.................t.....244695
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 2424.................t.....244695
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 2424.................t.....244695
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 2424.................t.....244695
DQ089781.1 Hepatitis B virus isolate HK1476, complete genome 2424.................t.....244695
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 2424.................t.....244695
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 2424.................t.....244695
DQ089787.1 Hepatitis B virus isolate HK352, complete genome 2424.................t.....244695
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 2424.................t.....244695
DQ089790.1 Hepatitis B virus isolate HK1248, complete genome 2424.................t.....244695
DQ089791.1 Hepatitis B virus isolate HK1205, complete genome 2424.................t.....244695
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 2424.................t.....244695
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 2424.................t.....244695
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 2377..................a....239995
DQ089795.1 Hepatitis B virus isolate HK1465, complete genome 2427.................t.....244995
DQ089796.1 Hepatitis B virus isolate HK751, complete genome 2424.................t.....244695
DQ089797.1 Hepatitis B virus isolate HK1169, complete genome 2424.................t.....244695
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 2424................t......244695
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 2424.................t.....244695
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 2385.................t.....240795
DQ089801.1 Hepatitis B virus isolate HK2100, complete genome 2424.................t.....244695
DQ089802.1 Hepatitis B virus isolate HK1371, complete genome 2424.................t.....244695
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 2424.................t.....244695
DQ111986.1 Hepatitis B virus isolate MBT181, complete genome 2424.................t.....244695
DQ111987.1 Hepatitis B virus isolate MMU36, complete genome 2424.................t.....244695
AY862860.1 Hepatitis B virus clone Q11, complete genome 2424.................t.....244695
AY862861.1 Hepatitis B virus clone Q17, complete genome 2424.................t.....244695
AY862862.1 Hepatitis B virus clone Q20, complete genome 2424.................t.....244695
AY862863.1 Hepatitis B virus clone Q23, complete genome 2424.................t.....244695
AY862864.1 Hepatitis B virus clone Q34, complete genome 2424.................t.....244695
AY862865.1 Hepatitis B virus clone Q311, complete genome 2424.................t.....244695
AY862867.1 Hepatitis B virus clone Q42, complete genome 2430.................t.....245295
AY862868.1 Hepatitis B virus clone Q43, complete genome 2430.................t.....245295
AY862869.1 Hepatitis B virus clone Q80, complete genome 2424.................t.....244695
AB231909.1 Hepatitis B virus DNA, complete genome, isolate:VH10 2424.................t.....244695
AB119251.1 Hepatitis B virus DNA, complete genome, strain:Ehime13:BD No2,20020822424.................t.....244695
AB119255.1 Hepatitis B virus DNA, complete genome, strain:Ehime17:Iyo 0719039 2424.................t.....244695
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 1025.................t.....104795
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 4240.................t.....426295
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 1007.................t.....102995
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 4221.................t.....424395
AB188245.2 Hepatitis B virus DNA, complete genome, isolate:ALTAY136 2424.................t.....244695
AB188243.2 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA27 2424.................t.....244695
DQ246215.1 Hepatitis B virus isolate GZ-DYH, complete genome 2424.................t.....244695
AB182589.1 Hepatitis B virus DNA, complete genome, isolate:CH:Mat-Ko 2424.................t.....244695
DQ361535.1 Hepatitis B virus isolate CRP-228, complete genome 2394.................t.....241695
DQ377158.1 Hepatitis B virus isolate WJT31, complete genome 2424.................t.....244695
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 2405.................t.....242795
DQ377160.1 Hepatitis B virus isolate WJT16, complete genome 2424.................t.....244695
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 2424.................t.....244695
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 2424.................t.....244695
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 2424.................t.....244695
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 2424.................t.....244695
AB247916.1 Hepatitis B virus DNA, complete genome, lamivudine resistance with in2424.................t.....244695
AJ627217.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20953 2424.................t.....244695
AJ627219.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 24039 2424.................t.....244695
AJ627220.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 29234 2424.................t.....244695
AJ627221.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 30125 2424.....a.................244695
AJ627222.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 31228 2424.................t.....244695
AJ627223.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33720 2424.................t.....244695
AJ627224.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33852 2424.................t.....244695
AJ627225.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 19749 2424.................t.....244695
AJ627226.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20952 2421.................t.....244395
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 2430.................t.....245295
DQ315776.1 Hepatitis B virus isolate EI00615, complete genome 2424.................t.....244695
DQ315777.1 Hepatitis B virus isolate EI03194, complete genome 2424.................t.....244695
DQ315778.1 Hepatitis B virus isolate EI0388, complete genome 2424.................t.....244695
DQ315779.1 Hepatitis B virus isolate EI0399, complete genome 2424.................t.....244695
DQ315780.1 Hepatitis B virus isolate EI02456, complete genome 2394.................t.....241695
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 2424.................t.....244695
DQ315782.1 Hepatitis B virus isolate EI0423, complete genome 2415.................t.....243795
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 2424.................t.....244695
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 2430.................t.....245295
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 2430.................t.....245295
AB250109.1 Hepatitis B virus DNA, complete genome, isolate: IH030213 2374.................t.....239695
AB205152.1 Hepatitis B virus DNA, complete genome, isolate: HB-JFH7-99 2424.................t.....244695
AB219426.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4014, PNN1 2424.................t.....244695
AB219428.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4076, PNN3 2424.................t.....244695
AB219429.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4101, PNN4 2424.................t.....244695
AB219430.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4148, PNN5 2424.................t.....244695
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 2430.................t.....245295
AB222710.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6M 2424.................t.....244695
AB222711.1 Hepatitis B virus DNA, complete genome, isolate: UZNV24 2424.................t.....244695
AB222712.1 Hepatitis B virus DNA, complete genome, isolate: UZBV61 2424.................t.....244695
AB222713.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6 2424.................t.....244695
AB222714.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7 2424.................t.....244695
AB222715.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7M 2424.................t.....244695
DQ448619.1 Hepatitis B virus isolate GZ-DYH, complete genome 2424.................t.....244695
DQ448620.1 Hepatitis B virus isolate GZ-DYF, complete genome 2424.................t.....244695
DQ448621.1 Hepatitis B virus isolate GZ-HQY, complete genome 2424.................t.....244695
DQ448622.1 Hepatitis B virus isolate GZ-JSM, complete genome 2424.................t.....244695
DQ448623.1 Hepatitis B virus isolate GZ-LMX, complete genome 2424.................t.....244695
DQ448624.1 Hepatitis B virus isolate GZ-QSA, complete genome 2424.................t.....244695
DQ448625.1 Hepatitis B virus isolate GZ-TXB, complete genome 2424.................t.....244695
DQ448626.1 Hepatitis B virus isolate GZ-XLB, complete genome 2424.................t.....244695
DQ448627.1 Hepatitis B virus isolate GZ-ZFL, complete genome 2424.................t.....244695
DQ448628.1 Hepatitis B virus isolate GZ-ZX, complete genome 2424.................g.....244695
AB210820.1 Hepatitis B virus DNA, complete genome, strain:Tokyo 1 2424.................t.....244695
AB210821.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 1-OA 2424.................t.....244695
AB210822.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 2-OS 2424.................t.....244695
DQ463787.1 Hepatitis B virus isolate 928-9_1979, complete genome 2424...................c...244695
DQ463791.1 Hepatitis B virus isolate 539-16_1979, complete genome 2424...................c...244695
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 2424...................c...244695
DQ463795.1 Hepatitis B virus isolate 928-9_2004, complete genome 2424...................c...244695
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 2424...................c...244695
DQ463797.1 Hepatitis B virus isolate 650-15_2004, complete genome 2424...................c...244695
DQ463799.1 Hepatitis B virus isolate 539-16_2004, complete genome 2424...................c...244695
DQ463800.1 Hepatitis B virus isolate 524-3_2004, complete genome 2424...................c...244695
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 2424...................c...244695
AM180623.1 Hepatitis B virus complete genome, isolate MAL36 2422.................t.....244495
DQ478881.1 Hepatitis B virus isolate CHN-QH2, complete genome 2424.................t.....244695
DQ478882.1 Hepatitis B virus isolate CHN-QH3, complete genome 2424.................t.....244695
DQ478883.1 Hepatitis B virus isolate CHN-QH33, complete genome 2433.................t.....245595
DQ478884.1 Hepatitis B virus isolate CHN-QH4, complete genome 2424.................t.....244695
DQ478886.1 Hepatitis B virus isolate CHN-QH5, complete genome 2424.................t.....244695
DQ478887.1 Hepatitis B virus isolate CHN-QH8, complete genome 2424.................t.....244695
DQ478888.1 Hepatitis B virus isolate CHN-QH9, complete genome 2424.................t.....244695
DQ478889.1 Hepatitis B virus isolate CHN-QH14, complete genome 2424.................t.....244695
DQ478890.1 Hepatitis B virus isolate CHN-QH18, complete genome 2424.................t.....244695
DQ478891.1 Hepatitis B virus isolate CHN-QH19, complete genome 2424.................t.....244695
DQ478892.1 Hepatitis B virus isolate CHN-QH28, complete genome 2424.................t.....244695
DQ478893.1 Hepatitis B virus isolate CHN-QH29, complete genome 2424.................t.....244695
DQ478894.1 Hepatitis B virus isolate CHN-QH30, complete genome 2424.................t.....244695
DQ478895.1 Hepatitis B virus isolate CHN-QH31, complete genome 2424.................t.....244695
DQ478896.1 Hepatitis B virus isolate CHN-QH32, complete genome 2424.................t.....244695
DQ478897.1 Hepatitis B virus isolate CHN-QH37, complete genome 2424.................t.....244695
DQ478898.1 Hepatitis B virus isolate CHN-QH38, complete genome 2424.................t.....244695
DQ478899.1 Hepatitis B virus isolate CHN-D20, complete genome 2424.................t.....244695
DQ478901.1 Hepatitis B virus isolate CHN-H155, complete genome 2424.................t.....244695
DQ486023.1 Hepatitis B virus isolate LT10, complete genome 604.................t.....62695
DQ486024.1 Hepatitis B virus isolate LT9, complete genome 604.................t.....62695
AB241109.1 Hepatitis B virus DNA, complete genome, isolate:PhCH24 2424.................t.....244695
AB241110.1 Hepatitis B virus DNA, complete genome, isolate:PhLC03 2424.................t.....244695
AB241111.1 Hepatitis B virus DNA, complete genome, isolate:PhLC14 2424.................t.....244695
AB241112.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC15 2268.................t.....229095
AB241113.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC13 2268.................t.....229095
AB241114.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC01 2430.................t.....245295
AB241115.1 Hepatitis B virus DNA, complete genome, isolate:PhCH09 2430.................t.....245295
AB241116.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC03 2389.................t.....241195
AB241117.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC05 2424.................t.....244695
AM282986.1 Hepatitis B virus (SUBTYPE ADW2), genotype A, complete genome 2430.................t.....245295
AB246317.1 Hepatitis B virus DNA, complete genome, isolate: TA112 2394.................t.....241695
DQ536410.1 Hepatitis B virus isolate JeF339 clone JeF339U-3, complete genome 2424.................t.....244695
DQ536411.1 Hepatitis B virus isolate JeF339 clone JeF339U-1, complete genome 2424.................t.....244695
DQ536412.1 Hepatitis B virus isolate JeF339 clone JeF339U-2, complete genome 2280.................t.....230295
DQ536413.1 Hepatitis B virus isolate JeF339 clone JeF339D-1, complete genome 1938.................t.....196095
DQ536414.1 Hepatitis B virus isolate JeF339 clone JeF339D-2, complete genome 1938.................t.....196095
DQ683578.1 Hepatitis B virus from South Korea, complete genome 2424.................t.....244695
AM184125.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate O64 2430.................t.....245295
AM184126.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate N35 2430.................t.....245295
DQ904357.1 Hepatitis B virus strain A0004 from China, complete genome 2426.................t.....244895
DQ922650.1 Hepatitis B virus strain C0955, complete genome 2426.................t.....244895
DQ975271.1 Hepatitis B virus strain B0641, complete genome 2426.................t.....244895
DQ975273.1 Hepatitis B virus strain e1013, complete genome 2426.................t.....244895
DQ993181.1 Hepatitis B virus strain A0583, complete genome 2350.................t.....237295
DQ980547.1 Hepatitis B virus strain E0113, complete genome 2339.................t.....236195
DQ980548.1 Hepatitis B virus strain C1198, complete genome 2426.................t.....244895
DQ980549.1 Hepatitis B virus strain B0949, complete genome 2393.................t.....241595
DQ980550.1 Hepatitis B virus strain B0206, complete genome 2369.................t.....239195
DQ980551.1 Hepatitis B virus strain A0712, complete genome 2393.................t.....241595
DQ986375.1 Hepatitis B virus strain 616-93, complete genome 2426.................t.....244895
AB246335.1 Hepatitis B virus DNA, complete genome, clone: Aa_IND 2430.................t.....245295
AB246336.1 Hepatitis B virus DNA, complete genome, clone: Aa_SAF 2430.................t.....245295
AB246337.1 Hepatitis B virus DNA, complete genome, clone: Ae_US 2430.................t.....245295
AB246338.1 Hepatitis B virus DNA, complete genome, clone: Ae_JPN 2430.................t.....245295
AB246339.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN51 2424.................t.....244695
AB246340.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN58 2424.................t.....244695
AB246344.1 Hepatitis B virus DNA, complete genome, clone: C_JPN22 2424.................t.....244695
AB246345.1 Hepatitis B virus DNA, complete genome, clone: C_JPNAT 2424.................t.....244695
AB246346.1 Hepatitis B virus DNA, complete genome, clone: C_HK74 2424.................t.....244695
AB246347.1 Hepatitis B virus DNA, complete genome, clone: D_IND60 2424.................t.....244695
AB246348.1 Hepatitis B virus DNA, complete genome, clone: D_US68 2424.................t.....244695
DQ995801.1 Hepatitis B virus isolate H60-6, complete genome 2424.................t.....244695
DQ995803.1 Hepatitis B virus isolate C265-15, complete genome 2424...................c...244695
DQ995805.1 Hepatitis B virus isolate H60-2.5KB, complete genome 2371.................t.....239395
AB288026.1 Hepatitis B virus DNA, complete genome, genotype: C, country: Japan, 2424.................t.....244695
EF134945.1 Hepatitis B virus isolate G247-B3, complete genome 604.................t.....62695
EF134946.1 Hepatitis B virus isolate G247-B5, complete genome 604.................t.....62695
AB267090.1 Hepatitis B virus ayw/Japan/Ehime 22-HS/2005 DNA, complete genome 2424.................t.....244695
EF208113.1 Hepatitis B virus clone B-S3, complete genome 2430.................t.....245295
EF208114.1 Hepatitis B virus clone B-S7, complete genome 2371.................t.....239395
EF208115.1 Hepatitis B virus clone B-S8, complete genome 2371.................t.....239395
AB270547.1 Hepatitis B virus DNA, complete genome, isolate: MGL295F 2424.................t.....244695
AB270548.1 Hepatitis B virus DNA, complete genome, isolate: MGL207F 2424.................t.....244695
AB270549.1 Hepatitis B virus DNA, complete genome, isolate: MGL79F 2424.................t.....244695
AB270534.1 Hepatitis B virus DNA, complete genome, isolate: MGL110F 2422.................t.....244495
AB270535.1 Hepatitis B virus DNA, complete genome, isolate: MGL50F 2424.................t.....244695
AB270543.1 Hepatitis B virus DNA, complete genome, isolate: MGL209F 2424.................t.....244695
AB270544.1 Hepatitis B virus DNA, complete genome, isolate: MGL215F 2416.................t.....243895
AB270545.1 Hepatitis B virus DNA, complete genome, isolate: MGL108F 2379.................t.....240195
AB270546.1 Hepatitis B virus DNA, complete genome, isolate: MGL88F 2424.................t.....244695
EF103275.1 Hepatitis B virus isolate Ran11, complete genome 2424.................t.....244695
EF103276.1 Hepatitis B virus isolate Ran22, complete genome 2424.................t.....244695
EF103277.1 Hepatitis B virus isolate Ran33, complete genome 2424.................t.....244695
EF103278.1 Hepatitis B virus isolate Ran60, complete genome 2430.................t.....245295
EF103279.1 Hepatitis B virus isolate Ran99, complete genome 2424.................t.....244695
EF103280.1 Hepatitis B virus isolate Ran100, complete genome 2424.................t.....244695
EF103281.1 Hepatitis B virus isolate Ran102, complete genome 2415.................t.....243795
EF103282.1 Hepatitis B virus isolate Ran103, complete genome 2424.................t.....244695
EF103284.1 Hepatitis B virus isolate Ran113, complete genome 2424...........a...........244695
AM295795.1 Hepatitis B virus complete genome, clone LB1Clone5 2430.................t.....245295
AM295796.1 Hepatitis B virus complete genome, clone LB1Clone10 2430.................t.....245295
AM295797.1 Hepatitis B virus complete genome, clone LB2Clone6 2430.................t.....245295
AM295798.1 Hepatitis B virus complete genome, clone LB3Clone1 2042.................t.....206495
AM295799.1 Hepatitis B virus complete genome, clone LB3Clone5 2042.................t.....206495
AM295800.2 Hepatitis B virus complete genome, clone LB3Clone11 2431.................t.....245395
DQ890381.1 Hepatitis B virus strain S40U, complete genome 2430.................t.....245295
EF536065.1 Hepatitis B virus strain XZK pre-t, complete genome 2426.................t.....244895
EF536066.1 Mutant Hepatitis B virus strain XZK t-w128, complete genome 2426.................t.....244895
EF137802.1 Hepatitis B virus strain JH4-1896-G, complete genome 2424.................t.....244695
AB195930.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-1 2424.................t.....244695
AB195931.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-2 2424.................t.....244695
AB195932.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-3 2424.................t.....244695
AB195933.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-1 2424.................t.....244695
AB195934.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-2 2424.................t.....244695
AB195935.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-3 2424.................t.....244695
AB195936.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-1 2424.................t.....244695
AB195937.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-2 2424.................t.....244695
AB195938.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-3 2424.................t.....244695
AB195939.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-1 2424.................t.....244695
AB195940.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-2 2424.................t.....244695
AB195941.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-3 2424.................t.....244695
AB195942.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-1 2424.................t.....244695
AB195943.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-2 2424.................t.....244695
AB195944.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-3 2424.................t.....244695
AB195947.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-1 2424.................t.....244695
AB195948.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-2 2424.................t.....244695
AB195949.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-1 2424.................t.....244695
AB195950.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-2 2424.................t.....244695
AB195951.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-3 2424.................t.....244695
AB195952.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-1 2424.................t.....244695
AB195953.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-2 2424.................t.....244695
AB195954.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-3 2424.................t.....244695
AB195955.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-1 2424.................t.....244695
AB195956.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-2 2424.................t.....244695
AB195957.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-3 2424.................t.....244695
AM422939.1 Hepatitis B virus, genotype D, complete genome, isolate X28 2424.................t.....244695
DQ993680.1 Hepatitis B virus isolate patient 268, complete genome 2424.................t.....244695
DQ993681.1 Hepatitis B virus isolate patient 290, complete genome 2424.................t.....244695
DQ993684.1 Hepatitis B virus isolate patient 336, complete genome 2424.................t.....244695
DQ993686.1 Hepatitis B virus isolate patient 342, complete genome 2424.................t.....244695
DQ993687.1 Hepatitis B virus isolate patient 700, complete genome 2424.................t.....244695
DQ993688.1 Hepatitis B virus isolate 209-0519-Nature1.2-unSero, complete genome 2424.................t.....244695
DQ993689.1 Hepatitis B virus isolate 209-1119-Nature1.1-unSero, complete genome 2424.................t.....244695
DQ993690.1 Hepatitis B virus isolate 204-1113-Nature1.1-unSero, complete genome 2424.................t.....244695
DQ993691.1 Hepatitis B virus isolate 4007-0803-Nature2.2-unSero, complete genome2424.................t.....244695
DQ993692.1 Hepatitis B virus isolate 4007-0810-Nature2.1-unSero, complete genome2424.................t.....244695
DQ993693.1 Hepatitis B virus isolate 232-1125-Nature1.1-unSero, complete genome 2424.................t.....244695
DQ993694.1 Hepatitis B virus isolate patient 234, complete genome 2424.................t.....244695
DQ993696.1 Hepatitis B virus isolate patient 452b1, complete genome 2424.................t.....244695
DQ993697.1 Hepatitis B virus isolate patient 940b1, complete genome 2424.................t.....244695
DQ993698.1 Hepatitis B virus isolate 6144-0327-ETCvs3TC-Naive, complete genome 2424.................t.....244695
DQ993699.1 Hepatitis B virus isolate 6144-0226-ETCvs3TC-Break, complete genome 2424.................t.....244695
DQ993700.1 Hepatitis B virus isolate JMY-0725-ETC, complete genome 2424.................t.....244695
DQ993701.1 Hepatitis B virus isolate JMY-0210-ETCvs3TC-Brack, complete genome 2424.................t.....244695
DQ993702.1 Hepatitis B virus isolate JMY-0919-ETCvs3TC-Naive, complete genome 2424.................t.....244695
DQ993703.1 Hepatitis B virus isolate 236-0526-Nature1.2-Sero, complete genome 2424.................t.....244695
DQ993704.1 Hepatitis B virus isolate 239-1127-Nature3.1-unSero, complete genome 2424.................t.....244695
DQ993705.1 Hepatitis B virus isolate 239-0625-Nature3.4-unSero, complete genome 2424.................t.....244695
DQ993706.1 Hepatitis B virus isolate 239-0402-Nature3.3-unSero, complete genome 2424.................t.....244695
DQ993707.1 Hepatitis B virus isolate 239-O218-Nature3.2-unSero, complete genome 2424.................t.....244695
DQ993708.1 Hepatitis B virus isolate 6136-1228-Naive, complete genome 2424.................t.....244695
DQ993709.1 Hepatitis B virus isolate 6136-0127-ETCvs3TC-Break, complete genome 2424.................t.....244695
DQ993710.1 Hepatitis B virus isolate 6144-0718-ETC, complete genome 2424.................t.....244695
EF688062.1 Hepatitis B virus isolate GZ28-1, complete genome 2424.................t.....244695
EF473973.1 Hepatitis B virus isolate EIH45AChinese, complete genome 2424.................t.....244695
EF473974.1 Hepatitis B virus isolate EIH21AChinese, complete genome 2424.................t.....244695
EF473975.1 Hepatitis B virus isolate 2061Chinese, complete genome 2424.................t.....244695
EF473977.1 Hepatitis B virus isolate KD048East, complete genome 2424.................t.....244695
AB202071.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-1 2424.................t.....244695
AB202072.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-2 2400.................t.....242295
EU086721.1 Hepatitis B virus isolate HRO/w4601-2002, complete genome 2430.................t.....245295
EF494376.1 Hepatitis B virus isolate TW706 genotype C, complete genome 2430.................t.....245295
EF494379.1 Hepatitis B virus isolate TW8585 genotype C, complete genome 2424.................t.....244695
EF494381.1 Hepatitis B virus isolate TW936 genotype B, complete genome 2424.................t.....244695
EU139543.1 Hepatitis B virus strain NDJ, complete genome 2424.................t.....244695
EU054331.1 Hepatitis B virus strain FE-929-MO, complete genome 2430.................t.....245295
AB300359.1 Hepatitis B virus DNA, complete genome, isolate: patient1 2424.................t.....244695
AB300362.1 Hepatitis B virus DNA, complete genome, isolate: patient4 2424.................t.....244695
AB300363.1 Hepatitis B virus DNA, complete genome, isolate: patient5 2424.................t.....244695
AB300364.1 Hepatitis B virus DNA, complete genome, isolate: patient6 2424.................t.....244695
AB300365.1 Hepatitis B virus DNA, complete genome, isolate: patient7 2424.................t.....244695
AB300366.1 Hepatitis B virus DNA, complete genome, isolate: patient8 2430.................t.....245295
AB300367.1 Hepatitis B virus DNA, complete genome, isolate: patient9 2430.................t.....245295
AB300368.1 Hepatitis B virus DNA, complete genome, isolate: patient10 2424.................t.....244695
AB300372.1 Hepatitis B virus DNA, complete genome, isolate: patient14 2424.................t.....244695
AB300373.1 Hepatitis B virus DNA, complete genome, isolate: patient15 2400...................c...242295
EF473971.1 Hepatitis B virus isolate 2059Java, complete genome 2424.................t.....244695
EF473972.1 Hepatitis B virus isolate 1839Java, complete genome 2424.................t.....244695
EF473976.1 Hepatitis B virus isolate Alr049East, complete genome 2424.................t.....244695
AB368297.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c2322.................t.....234495
AB287319.1 Hepatitis B virus DNA, complete genome, isolate: AlaskaG23 2424...................c...244695
AB287322.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-3 2424...................c...244695
AB287323.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-4 2424...................c...244695
AB287325.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-6 2424...................c...244695
AB287326.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A44 2424...................c...244695
AB287328.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba 51 2424.................t.....244695
AB287329.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba A55 2424.................t.....244695
EU155893.1 Hepatitis B virus isolate 4, complete genome 2424.................t.....244695
EU155895.1 Hepatitis B virus isolate 5b, complete genome 1792.................t.....181495
AB330366.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ2HB2421.................t.....244395
AB330367.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ14H2424.................t.....244695
AB330368.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ54H2424.................t.....244695
AB330369.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ5HB2424.................t.....244695
AB330370.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ6HB2424.................t.....244695
EU185780.1 Hepatitis B virus isolate H-IDU7 (Rec.Arg-1) D3/A2 recombinant, compl2424.................t.....244695
EU185786.1 Hepatitis B virus isolate S-IDU11, complete genome 2430.................t.....245295
EU185787.1 Hepatitis B virus isolate S-IDU4, complete genome 2430.................t.....245295
EU185789.1 Hepatitis B virus isolate S-IDU8, complete genome 2430.................t.....245295
EU305540.1 Hepatitis B virus isolate G67-123, complete genome 2424.................t.....244695
EU305541.1 Hepatitis B virus isolate G67-190, complete genome 2424.................t.....244695
EU305542.1 Hepatitis B virus isolate G67-1251, complete genome 2424.................t.....244695
EU305543.1 Hepatitis B virus isolate L15-57, complete genome 2425.................t.....244795
EU305544.1 Hepatitis B virus isolate L15-129, complete genome 2425.................t.....244795
EU305545.1 Hepatitis B virus isolate L15-196, complete genome 2424.................t.....244695
EU305547.1 Hepatitis B virus isolate M118-481, complete genome 2424.................t.....244695
EU305548.1 Hepatitis B virus isolate M118-673, complete genome 2424.................t.....244695
AM494716.1 Hepatitis B virus complete genome, isolate CAR175 2424.................t.....244695
AM494718.1 Hepatitis B virus complete genome, isolate CAR204 2430.................t.....245295
EU306671.1 Hepatitis B virus clone 626-49, complete genome 2337.................t.....235995
EU306672.1 Hepatitis B virus clone 626-20, complete genome 2337.................t.....235995
EU306673.1 Hepatitis B virus clone 213-10, complete genome 2424.................t.....244695
EU306674.1 Hepatitis B virus clone 213-6, complete genome 2415.................t.....243795
EU306675.1 Hepatitis B virus clone 213-21, complete genome 2415.................t.....243795
EU306677.1 Hepatitis B virus clone 220-14, complete genome 2424.................t.....244695
EU306678.1 Hepatitis B virus clone 220-36, complete genome 2424.................t.....244695
EU306679.1 Hepatitis B virus clone 220-26, complete genome 2424.................t.....244695
EU306680.1 Hepatitis B virus clone 220-27, complete genome 2424.................t.....244695
EU306681.1 Hepatitis B virus clone 220-44, complete genome 2424.................t.....244695
EU306682.1 Hepatitis B virus clone 220-8, complete genome 2423.................t.....244595
EU306683.1 Hepatitis B virus clone 220-30, complete genome 2423.................t.....244595
EU306684.1 Hepatitis B virus clone 220-43, complete genome 2434.................t.....245695
EU306685.1 Hepatitis B virus clone 327-4, complete genome 2424.................t.....244695
EU306686.1 Hepatitis B virus clone 327-28, complete genome 2425.................t.....244795
EU306687.1 Hepatitis B virus clone 327-6, complete genome 2424.................t.....244695
EU306688.1 Hepatitis B virus clone 327-54, complete genome 2424.................t.....244695
EU306689.1 Hepatitis B virus clone 327-27, complete genome 2424.................t.....244695
EU306690.1 Hepatitis B virus clone 327-71, complete genome 2424.................t.....244695
EU306691.1 Hepatitis B virus clone 327-57, complete genome 2424.................t.....244695
EU306692.1 Hepatitis B virus clone 327-73, complete genome 2423.................t.....244595
EU306693.1 Hepatitis B virus clone 327-67, complete genome 2416.................t.....243895
EU306694.1 Hepatitis B virus clone 327-46, complete genome 2415.................t.....243795
EU306695.1 Hepatitis B virus clone 712-64, complete genome 2424.................t.....244695
EU306696.1 Hepatitis B virus clone 712-47, complete genome 2424.................t.....244695
EU306697.1 Hepatitis B virus clone 712-99, complete genome 2424.................t.....244695
EU306698.1 Hepatitis B virus clone 712-105, complete genome 2424.................t.....244695
EU306699.1 Hepatitis B virus clone 807-13, complete genome 2424.................t.....244695
EU306700.1 Hepatitis B virus clone 221-2, complete genome 2424.................t.....244695
EU306701.1 Hepatitis B virus clone 221-10, complete genome 2424.................t.....244695
EU306702.1 Hepatitis B virus clone 221-11, complete genome 2424.................t.....244695
EU306703.1 Hepatitis B virus clone 221-13, complete genome 2424.................t.....244695
EU306704.1 Hepatitis B virus clone 221-29, complete genome 2424.................t.....244695
EU306705.1 Hepatitis B virus clone 221-31, complete genome 2424.................t.....244695
EU306706.1 Hepatitis B virus clone 221-33, complete genome 2424.................t.....244695
EU306707.1 Hepatitis B virus clone 221-36, complete genome 2424.................t.....244695
EU306708.1 Hepatitis B virus clone 221-37, complete genome 2424.................t.....244695
EU306709.1 Hepatitis B virus clone 221-42, complete genome 2424.................t.....244695
EU306710.1 Hepatitis B virus clone 221-14, complete genome 2424.................t.....244695
EU306711.1 Hepatitis B virus clone 221-50, complete genome 2424.................t.....244695
EU306712.1 Hepatitis B virus clone 221-15, complete genome 2424.................t.....244695
EU306713.1 Hepatitis B virus clone 602-27, complete genome 2424.................t.....244695
EU306714.1 Hepatitis B virus clone 602-77, complete genome 2424.................t.....244695
EU306715.1 Hepatitis B virus clone 602(son)-17, complete genome 2407.................t.....242995
EU306716.1 Hepatitis B virus clone 602(son)-18, complete genome 2245.................t.....226795
EU306717.1 Hepatitis B virus clone 602(son)-22, complete genome 2407.................t.....242995
EU306718.1 Hepatitis B virus clone 602(son)-24, complete genome 2407.................t.....242995
EU306719.1 Hepatitis B virus clone 602(son)-23, complete genome 2424.................t.....244695
EU306720.1 Hepatitis B virus clone 602(son)-68, complete genome 2424.................t.....244695
EU306721.1 Hepatitis B virus clone 602(son)-1, complete genome 2424.................t.....244695
EU306722.1 Hepatitis B virus clone 6022-28-, complete genome 2424.................t.....244695
EU306723.1 Hepatitis B virus clone 6022-19, complete genome 2422.................t.....244495
EU306727.1 Hepatitis B virus clone 6022-5-, complete genome 2424.................t.....244695
EU306729.1 Hepatitis B virus clone 6022-33, complete genome 2424.................t.....244695
EU350409.1 Hepatitis B virus isolate BTO5856, complete genome 2424.................t.....244695
EU410079.1 Hepatitis B virus isolate ph109, complete genome 2424.................t.....244695
EU410080.1 Hepatitis B virus isolate ph76, complete genome 2424.................t.....244695
EU410081.1 Hepatitis B virus isolate ph80, complete genome 2424.................t.....244695
EU410082.1 Hepatitis B virus isolate ph81, complete genome 2430.................t.....245295
EU439005.1 Hepatitis B virus clone 6022-35 from China, complete genome 2424.................t.....244695
EU439006.1 Hepatitis B virus clone 602(S)-3 from China, complete genome 2423.................t.....244595
EU439007.1 Hepatitis B virus clone 602(S)-39 from China, complete genome 2408.................t.....243095
EU439015.1 Hepatitis B virus clone zgh-26 from China, complete genome 2424.................t.....244695
EU439016.1 Hepatitis B virus clone zgh-9 from China, complete genome 2337.................t.....235995
EU439018.1 Hepatitis B virus clone dzc-5 from China, complete genome 2424.................t.....244695
EU439019.1 Hepatitis B virus clone dzc-6 from China, complete genome 2423.................t.....244595
EU439020.1 Hepatitis B virus clone dzc-12 from China, complete genome 2424.................t.....244695
EU439021.1 Hepatitis B virus clone dzc-14 from China, complete genome 2424.................t.....244695
EU439022.1 Hepatitis B virus clone dzc-19 from China, complete genome 2424.................t.....244695
EU439023.1 Hepatitis B virus clone dzc-22 from China, complete genome 2424.................t.....244695
EU439024.1 Hepatitis B virus clone 220-42 from China, complete genome 2434.................t.....245695
AB365445.1 Hepatitis B virus DNA, complete genome, isolate: BOL1 2424.................t.....244695
AB365451.1 Hepatitis B virus DNA, complete genome, isolate: BOL196 2424.................t.....244695
AM410963.1 Hepatitis B virus complete genome, clone LB3Clone24 2430.................t.....245295
AB426467.1 Hepatitis B virus DNA, complete genome, clone: HBVFH0204 2424.................t.....244695
EU547559.1 Hepatitis B virus isolate MC02, complete genome 2391.................t.....241395
EU547560.1 Hepatitis B virus isolate MC03, complete genome 2425.................t.....244795
AB299858.1 Hepatitis B virus subtype adr DNA, complete genome, clone: HBVFH0204 2424.................t.....244695
EU554535.1 Hepatitis B virus isolate S472-20, complete genome 2424.................t.....244695
EU554536.1 Hepatitis B virus isolate S472-24, complete genome 2424.................t.....244695
EU554537.1 Hepatitis B virus isolate S541-13, complete genome 2424.................t.....244695
EU554538.1 Hepatitis B virus isolate S541-15, complete genome 2424.................t.....244695
EU554539.1 Hepatitis B virus isolate S541-21, complete genome 2424.................t.....244695
EU554541.1 Hepatitis B virus isolate S696-1, complete genome 2424.................t.....244695
EU554542.1 Hepatitis B virus isolate S696-4, complete genome 2424.................t.....244695
EU562215.1 Hepatitis B virus isolate 11, complete genome 2424.................t.....244695
EU562216.1 Hepatitis B virus isolate 13, complete genome 2424.................t.....244695
EU562217.1 Hepatitis B virus isolate 16, complete genome 2424.................t.....244695
EU562218.1 Hepatitis B virus isolate 7, complete genome 2424.................t.....244695
EU562219.1 Hepatitis B virus isolate 5, complete genome 2423.................t.....244595
EU560440.1 Hepatitis B virus isolate 1-S869, complete genome 2424.................t.....244695
EU560441.1 Hepatitis B virus isolate 4-S869, complete genome 2424.................t.....244695
EU570067.1 Hepatitis B virus isolate 18-S541, complete genome 2424.................t.....244695
EU570068.1 Hepatitis B virus isolate 26-S541, complete genome 2424.................t.....244695
EU570069.1 Hepatitis B virus isolate 1-B24, complete genome 2424.................t.....244695
EU570070.1 Hepatitis B virus isolate 2-B24, complete genome 2424.................t.....244695
EU570071.1 Hepatitis B virus isolate 4-B24, complete genome 2424.................t.....244695
EU579441.1 Hepatitis B virus isolate 12 genotype B, complete genome 2424.................t.....244695
EU579442.1 Hepatitis B virus isolate 6 genotype C, complete genome 2424.................t.....244695
EU579443.1 Hepatitis B virus isolate 2 genotype C, complete genome 2424.................t.....244695
EU595030.1 Hepatitis B virus isolate 6, complete genome 2425.................t.....244795
EU595031.1 Hepatitis B virus isolate 7, complete genome 2424.................t.....244695
EU589336.1 Hepatitis B virus isolate S1175-1, complete genome 2421.................t.....244395
EU589337.1 Hepatitis B virus isolate S710-2, complete genome 2418.................t.....244095
EU589340.1 Hepatitis B virus isolate S852-7, complete genome 2379.................t.....240195
EU589341.1 Hepatitis B virus isolate S852-10, complete genome 2379.................t.....240195
EU589342.1 Hepatitis B virus isolate S852-13, complete genome 2379.................t.....240195
EU589343.1 Hepatitis B virus isolate S852-15, complete genome 2378.................t.....240095
EU589345.1 Hepatitis B virus isolate S624-2, complete genome 2409.................t.....243195
EU487256.1 Hepatitis B virus isolate patient12, complete genome 2424.................t.....244695
EU487257.1 Hepatitis B virus isolate patient14, complete genome 2424.................t.....244695
EU414133.1 Hepatitis B virus strain 28058, complete genome 2430.................t.....245295
EU414135.1 Hepatitis B virus strain 28025, complete genome 2424.................t.....244695
EU414136.1 Hepatitis B virus strain 28052, complete genome 2424.................t.....244695
EU414137.1 Hepatitis B virus strain 28059, complete genome 2423.................t.....244595
EU414138.1 Hepatitis B virus strain 28129, complete genome 2424.................t.....244695
EU414139.1 Hepatitis B virus strain 28027, complete genome 2424.................t.....244695
EU414140.1 Hepatitis B virus strain 28050, complete genome 2424.................t.....244695
EU414141.1 Hepatitis B virus strain 28051, complete genome 2424.................t.....244695
EU414142.1 Hepatitis B virus strain 28004, complete genome 2424.................t.....244695
EU414143.1 Hepatitis B virus strain 28042, complete genome 2424.................t.....244695
EU670263.1 Hepatitis B virus isolate ph105, complete genome 2424.................t.....244695
EU717212.1 Hepatitis B virus isolate D26K-7, complete genome 2426.................t.....244895
EU330989.1 Hepatitis B virus isolate M84-74, complete genome 2424.................t.....244695
EU330990.1 Hepatitis B virus isolate M84-146, complete genome 2424.................t.....244695
EU330992.1 Hepatitis B virus isolate M85-6, complete genome 2424.................t.....244695
EU330993.1 Hepatitis B virus isolate M85-8, complete genome 2404.................t.....242695
EU330994.1 Hepatitis B virus isolate M85-10, complete genome 2424.................t.....244695
EU330995.1 Hepatitis B virus isolate M85-80, complete genome 2424.................t.....244695
EU330996.1 Hepatitis B virus isolate M85-81, complete genome 2424.................t.....244695
EU330997.1 Hepatitis B virus isolate M85-216, complete genome 2424.................t.....244695
EU330998.1 Hepatitis B virus isolate M85-1043, complete genome 2424.................t.....244695
EU330999.1 Hepatitis B virus isolate M85-1044, complete genome 2424.................t.....244695
EU331000.1 Hepatitis B virus isolate M85-1045, complete genome 2424.................t.....244695
EU331001.1 Hepatitis B virus isolate M85-1046, complete genome 2424.................t.....244695
EU796067.1 Hepatitis B virus strain 2164, complete genome 2424.................t.....244695
EU796068.1 Hepatitis B virus strain 3831, complete genome 2424.................t.....244695
EU796070.1 Hepatitis B virus strain 4460, complete genome 2424.................t.....244695
EU796072.1 Hepatitis B virus strain 5131, complete genome 2424.................t.....244695
EU871969.1 Hepatitis B virus isolate 6-024-1, complete genome 2424.................t.....244695
EU871970.1 Hepatitis B virus isolate 6-024-3, complete genome 2424...........a...........244695
EU871971.1 Hepatitis B virus isolate 6-024-5, complete genome 2424.................t.....244695
EU871975.1 Hepatitis B virus isolate 6-024A-8, complete genome 2424.................t.....244695
EU871976.1 Hepatitis B virus isolate 179-04-3, complete genome 2424.................t.....244695
EU871977.1 Hepatitis B virus isolate 252-2, complete genome 2424.................t.....244695
EU871980.1 Hepatitis B virus isolate 318-01-5, complete genome 2424.................t.....244695
EU871981.1 Hepatitis B virus isolate 318-95-3, complete genome 2424.................t.....244695
EU871982.1 Hepatitis B virus isolate 318-96-2, complete genome 2424.................t.....244695
EU871983.1 Hepatitis B virus isolate 318-97-2, complete genome 2424.................t.....244695
EU871984.1 Hepatitis B virus isolate 490-00-1, complete genome 2424.................t.....244695
EU871985.1 Hepatitis B virus isolate 490-00-3, complete genome 2424.................t.....244695
EU871986.1 Hepatitis B virus isolate 490-1, complete genome 2424.................t.....244695
EU871987.1 Hepatitis B virus isolate 490-01-1, complete genome 2424.................t.....244695
EU871988.1 Hepatitis B virus isolate 490-01-3, complete genome 2424.................t.....244695
EU871989.1 Hepatitis B virus isolate 490-03-3, complete genome 2424.................t.....244695
EU871990.1 Hepatitis B virus isolate 490-04-1, complete genome 2424.................t.....244695
EU871991.1 Hepatitis B virus isolate 490-04-3, complete genome 2424.................t.....244695
EU871992.1 Hepatitis B virus isolate 490-99-1, complete genome 2424.................t.....244695
EU871993.1 Hepatitis B virus isolate 490-99-2, complete genome 2424.................t.....244695
EU871994.1 Hepatitis B virus isolate 490A-3, complete genome 2424.................t.....244695
EU871995.1 Hepatitis B virus isolate 490A-4, complete genome 2424.................t.....244695
EU871996.1 Hepatitis B virus isolate 490A-6, complete genome 2424.................t.....244695
EU871997.1 Hepatitis B virus isolate 530-00-3, complete genome 2424.................t.....244695
EU871998.1 Hepatitis B virus isolate 530-00-5, complete genome 2424.................t.....244695
EU871999.1 Hepatitis B virus isolate 530-00-7, complete genome 2424.................t.....244695
EU872006.1 Hepatitis B virus isolate 318-92-1, complete genome 2329.................t.....235195
EU872007.1 Hepatitis B virus isolate 252-92-6, complete genome 2416.................t.....243895
EU872008.1 Hepatitis B virus isolate 252A-8, complete genome 2424.................t.....244695
EU872010.1 Hepatitis B virus isolate 252-92-3, complete genome 2403.................t.....242595
EU872012.1 Hepatitis B virus isolate 318-99-5, complete genome 2319.................t.....234195
EU872014.1 Hepatitis B virus isolate 490-96-3, complete genome 2369.................t.....239195
EU872015.1 Hepatitis B virus isolate 490-96-1, complete genome 2369.................t.....239195
EU872017.1 Hepatitis B virus isolate 530-00-6, complete genome 2329.................t.....235195
EU594382.1 Hepatitis B virus strain 3798-91, complete genome 2424.................t.....244695
EU594383.1 Hepatitis B virus strain 2000-00, complete genome 2430.................t.....245295
EU594384.1 Hepatitis B virus strain 1906-99, complete genome 2430.................t.....245295
EU594385.1 Hepatitis B virus strain 1898-98, complete genome 2430.................t.....245295
EU594386.1 Hepatitis B virus strain 644-00, complete genome 2430.................t.....245295
EU594387.1 Hepatitis B virus strain 3784-91, complete genome 2430.................t.....245295
EU594388.1 Hepatitis B virus strain 3782-91, complete genome 2430.................t.....245295
EU594389.1 Hepatitis B virus strain 4435-97, complete genome 2430.................t.....245295
EU594390.1 Hepatitis B virus strain 4625-97, complete genome 2430.................t.....245295
EU594391.1 Hepatitis B virus strain 4620-97, complete genome 2430.................t.....245295
EU594392.1 Hepatitis B virus strain 4600-97, complete genome 2430.................t.....245295
EU594393.1 Hepatitis B virus strain 4590-97, complete genome 2430.................t.....245295
EU594394.1 Hepatitis B virus strain 4512-97, complete genome 2430.................t.....245295
EU594395.1 Hepatitis B virus strain 4509-97, complete genome 2430.................t.....245295
EU594396.1 Hepatitis B virus strain 4383-97, complete genome 2424.................t.....244695
EU594397.1 Hepatitis B virus strain 4398-97, complete genome 2424.................t.....244695
EU594398.1 Hepatitis B virus strain 4496-97, complete genome 2424.................t.....244695
EU594399.1 Hepatitis B virus strain 4484-97, complete genome 2424.................t.....244695
EU594400.1 Hepatitis B virus strain 2009-02, complete genome 2424.................t.....244695
EU594401.1 Hepatitis B virus strain 1989-97, complete genome 2424.................t.....244695
EU594402.1 Hepatitis B virus strain 1988-02, complete genome 2424.................t.....244695
EU594403.1 Hepatitis B virus strain 1904-99, complete genome 2424.................t.....244695
EU594405.1 Hepatitis B virus strain 620-98, complete genome 2424.................t.....244695
EU594406.1 Hepatitis B virus strain 321-96, complete genome 2424.................t.....244695
EU594407.1 Hepatitis B virus strain 295-01, complete genome 2424.................t.....244695
EU594408.1 Hepatitis B virus strain 281-01, complete genome 2424.................t.....244695
EU594409.1 Hepatitis B virus strain 280-01, complete genome 2424.................t.....244695
EU594410.1 Hepatitis B virus strain 279-01, complete genome 2424.................t.....244695
EU594415.1 Hepatitis B virus strain 4374-97, complete genome 2424.................t.....244695
EU594416.1 Hepatitis B virus strain 4373-97, complete genome 2424.................t.....244695
EU594421.1 Hepatitis B virus strain 4658-97, complete genome 2424.................t.....244695
EU594422.1 Hepatitis B virus strain 4655-97, complete genome 2424.................t.....244695
EU594423.1 Hepatitis B virus strain 4652-97, complete genome 2424.................t.....244695
EU594424.1 Hepatitis B virus strain 4651-97, complete genome 2424.................t.....244695
EU594425.1 Hepatitis B virus strain 4635-97, complete genome 2424.................t.....244695
EU594426.1 Hepatitis B virus strain 4630-97, complete genome 2424.................t.....244695
EU594427.1 Hepatitis B virus strain 4628-97, complete genome 2424.................t.....244695
EU594428.1 Hepatitis B virus strain 4385-97, complete genome 2424.................t.....244695
EU594430.1 Hepatitis B virus strain 4565-97, complete genome 2424.................t.....244695
EU594431.1 Hepatitis B virus strain 4547-97, complete genome 2424.................t.....244695
EU594432.1 Hepatitis B virus strain 4545-97, complete genome 2424.................t.....244695
EU594433.1 Hepatitis B virus strain 4605-97, complete genome 2424.................t.....244695
EU594434.1 Hepatitis B virus strain 683-95, complete genome 2424.................t.....244695
EU594435.1 Hepatitis B virus strain 320-95, complete genome 2424.................t.....244695
EU594436.1 Hepatitis B virus strain 4550-97, complete genome 2424.................t.....244695
EU787434.1 Hepatitis B virus isolate 92, complete genome 2424.................t.....244695
EU787435.1 Hepatitis B virus isolate 114, complete genome 2424.................t.....244695
EU787436.1 Hepatitis B virus isolate 165, complete genome 2424.................t.....244695
EU787437.1 Hepatitis B virus isolate 17, complete genome 2424.................t.....244695
EU787438.1 Hepatitis B virus isolate 7, complete genome 2424.................t.....244695
EU787439.1 Hepatitis B virus isolate 89, complete genome 2424.................t.....244695
EU787440.1 Hepatitis B virus isolate W17, complete genome 2424.................t.....244695
EU787441.1 Hepatitis B virus isolate W32, complete genome 2424.................t.....244695
EU787442.1 Hepatitis B virus isolate W37, complete genome 2424.................t.....244695
EU787445.1 Hepatitis B virus isolate W51, complete genome 2424.................t.....244695
EU787446.1 Hepatitis B virus isolate W75, complete genome 2424.................t.....244695
EU787447.1 Hepatitis B virus isolate W46, complete genome 2424.................t.....244695
AB453979.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH1 2430.................t.....245295
AB453980.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH2 2430.................t.....245295
AB453981.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH3 2430.................t.....245295
AB453984.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH6 2430.................t.....245295
AB453986.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH8 2430.................t.....245295
AB453987.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH9 2430.................t.....245295
AB453988.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH10 2430.................t.....245295
AB453983.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH5 2430.................t.....245295
EU921418.1 Hepatitis B virus isolate 22.165.07, complete genome 2421.................t.....244395
EU919197.1 Hepatitis B virus isolate XJU, complete genome 2415.................t.....243795
EU939536.1 Hepatitis B virus isolate C3, complete genome 2424.................t.....244695
EU939537.1 Hepatitis B virus isolate C8, complete genome 2370.................t.....239295
EU939538.1 Hepatitis B virus isolate C9, complete genome 2424.................t.....244695
EU939540.1 Hepatitis B virus isolate C24, complete genome 2424.................t.....244695
EU939542.1 Hepatitis B virus isolate C26, complete genome 2424.................t.....244695
EU939543.1 Hepatitis B virus isolate C38, complete genome 2424.................t.....244695
EU939544.1 Hepatitis B virus isolate C39, complete genome 2424.................t.....244695
EU939545.1 Hepatitis B virus isolate C41, complete genome 2424.................t.....244695
EU939548.1 Hepatitis B virus isolate C46, complete genome 2424.................t.....244695
EU939549.1 Hepatitis B virus isolate C49, complete genome 2424.................t.....244695
EU939550.1 Hepatitis B virus isolate C55, complete genome 2424.................t.....244695
EU939552.1 Hepatitis B virus isolate C57, complete genome 2424.................t.....244695
EU939553.1 Hepatitis B virus isolate C60, complete genome 2424.................t.....244695
EU939554.1 Hepatitis B virus isolate C61, complete genome 2424.................t.....244695
EU939557.1 Hepatitis B virus isolate C65, complete genome 2412.................t.....243495
EU939560.1 Hepatitis B virus isolate C69, complete genome 2391.................t.....241395
EU939561.1 Hepatitis B virus isolate C70, complete genome 2424.................t.....244695
EU939563.1 Hepatitis B virus isolate C76, complete genome 2424.................t.....244695
EU939564.1 Hepatitis B virus isolate C77, complete genome 2424.................t.....244695
EU939565.1 Hepatitis B virus isolate C86, complete genome 2424.................t.....244695
EU939567.1 Hepatitis B virus isolate C91, complete genome 2424.................t.....244695
EU939568.1 Hepatitis B virus isolate C93, complete genome 2424.................t.....244695
EU939570.1 Hepatitis B virus isolate C103, complete genome 2424.................t.....244695
EU939571.1 Hepatitis B virus isolate C104, complete genome 2424.................t.....244695
EU939572.1 Hepatitis B virus isolate C105, complete genome 2424.................t.....244695
EU939573.1 Hepatitis B virus isolate C106, complete genome 2424.................t.....244695
EU939574.1 Hepatitis B virus isolate C109, complete genome 2396.................t.....241895
EU939575.1 Hepatitis B virus isolate C113, complete genome 2420.................t.....244295
EU939576.1 Hepatitis B virus isolate C115, complete genome 2394.................t.....241695
EU939578.1 Hepatitis B virus isolate C119, complete genome 2424.................t.....244695
EU939579.1 Hepatitis B virus isolate C120, complete genome 2424.................t.....244695
EU939580.1 Hepatitis B virus isolate B1, complete genome 2424.................t.....244695
EU939581.1 Hepatitis B virus isolate B16, complete genome 2424.................t.....244695
EU939584.1 Hepatitis B virus isolate B107, complete genome 2424.................t.....244695
EU939586.1 Hepatitis B virus isolate B142, complete genome 2424.................t.....244695
EU939587.1 Hepatitis B virus isolate C2, complete genome 2424.................t.....244695
EU939588.1 Hepatitis B virus isolate C173, complete genome 2424.................t.....244695
EU939589.1 Hepatitis B virus isolate C175, complete genome 2424.................t.....244695
EU939590.1 Hepatitis B virus isolate C127, complete genome 2424.................t.....244695
EU939591.1 Hepatitis B virus isolate C131, complete genome 2424.................t.....244695
EU939592.1 Hepatitis B virus isolate C141, complete genome 2424.................t.....244695
EU939593.1 Hepatitis B virus isolate C144, complete genome 2424.................t.....244695
EU939594.1 Hepatitis B virus isolate C146, complete genome 2424.................t.....244695
EU939595.1 Hepatitis B virus isolate C147, complete genome 2424.................t.....244695
EU939597.1 Hepatitis B virus isolate C151, complete genome 2424.................t.....244695
EU939598.1 Hepatitis B virus isolate C164, complete genome 2424.................t.....244695
EU939600.1 Hepatitis B virus isolate C176, complete genome 2424.................t.....244695
EU939603.1 Hepatitis B virus isolate C183, complete genome 2424.................t.....244695
EU939604.1 Hepatitis B virus isolate C192, complete genome 2424.................t.....244695
EU939606.1 Hepatitis B virus isolate C206, complete genome 2424.................t.....244695
EU939607.1 Hepatitis B virus isolate C207, complete genome 2424.................t.....244695
EU939608.1 Hepatitis B virus isolate C208, complete genome 2398.................t.....242095
EU939609.1 Hepatitis B virus isolate C209, complete genome 2424.................t.....244695
EU939610.1 Hepatitis B virus isolate C211, complete genome 2424.................t.....244695
EU939611.1 Hepatitis B virus isolate C212, complete genome 2424.................t.....244695
EU939612.1 Hepatitis B virus isolate C213, complete genome 2424.................t.....244695
EU939613.1 Hepatitis B virus isolate C214, complete genome 2424.................t.....244695
EU939614.1 Hepatitis B virus isolate C217, complete genome 2424.................t.....244695
EU939615.1 Hepatitis B virus isolate C226, complete genome 2424.................t.....244695
EU939617.1 Hepatitis B virus isolate C229, complete genome 2424.................t.....244695
EU939618.1 Hepatitis B virus isolate C230, complete genome 2424.................t.....244695
EU939619.1 Hepatitis B virus isolate C233, complete genome 2424.................t.....244695
EU939622.1 Hepatitis B virus isolate C124, complete genome 2424.................t.....244695
EU939625.1 Hepatitis B virus isolate C167, complete genome 2424..................a....244695
EU939626.1 Hepatitis B virus isolate D158, complete genome 2424.................t.....244695
EU939627.1 Hepatitis B virus isolate C15, complete genome 2424.................t.....244695
EU939628.1 Hepatitis B virus isolate C72, complete genome 2417.................t.....243995
EU939629.1 Hepatitis B virus isolate C95, complete genome 2424.................t.....244695
EU939630.1 Hepatitis B virus isolate C122, complete genome 2424.................t.....244695
EU939633.1 Hepatitis B virus isolate C181, complete genome 2424.................t.....244695
EU939634.1 Hepatitis B virus isolate C19, complete genome 2424.................t.....244695
EU939635.1 Hepatitis B virus isolate B125, complete genome 2361.................t.....238395
EU939638.1 Hepatitis B virus isolate C17, complete genome 2424.....a.................244695
EU939639.1 Hepatitis B virus isolate C28, complete genome 2424.................t.....244695
EU939640.1 Hepatitis B virus isolate C239, complete genome 2424.................t.....244695
EU939641.1 Hepatitis B virus isolate D18, complete genome 2370.................t.....239295
EU939642.1 Hepatitis B virus isolate D20, complete genome 2424.................t.....244695
EU939643.1 Hepatitis B virus isolate D32, complete genome 2424.................t.....244695
EU939644.1 Hepatitis B virus isolate D36, complete genome 2424.................t.....244695
EU939647.1 Hepatitis B virus isolate D90, complete genome 2424.................t.....244695
EU939650.1 Hepatitis B virus isolate D103, complete genome 2395..................t....241795
EU939651.1 Hepatitis B virus isolate D104, complete genome 2424.................t.....244695
EU939652.1 Hepatitis B virus isolate D107, complete genome 2424.................t.....244695
EU939653.1 Hepatitis B virus isolate D109, complete genome 2424.................t.....244695
EU939655.1 Hepatitis B virus isolate D116, complete genome 2424.................t.....244695
EU939656.1 Hepatitis B virus isolate D117, complete genome 2424.................t.....244695
EU939658.1 Hepatitis B virus isolate D142, complete genome 2424.................t.....244695
EU939662.1 Hepatitis B virus isolate C62, complete genome 2424.................t.....244695
EU939663.1 Hepatitis B virus isolate C74, complete genome 2424.................t.....244695
EU939666.1 Hepatitis B virus isolate C150, complete genome 2424.................t.....244695
EU939669.1 Hepatitis B virus isolate C185, complete genome 2424.................t.....244695
EU939673.1 Hepatitis B virus isolate C219, complete genome 2424.................t.....244695
EU939675.1 Hepatitis B virus isolate C235, complete genome 2424.................t.....244695
EU939676.1 Hepatitis B virus isolate D54, complete genome 2424.................t.....244695
EU939679.1 Hepatitis B virus isolate D134, complete genome 2424.................t.....244695
EU939680.1 Hepatitis B virus isolate C186, complete genome 2424.................t.....244695
EU939681.1 Hepatitis B virus isolate D146, complete genome 2424.................t.....244695
AB367392.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 1, derived 2424.................t.....244695
AB367394.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 3/Adefovir-2424.................t.....244695
AB367395.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 4, derived 2424.................t.....244695
AB367396.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 5, derived 2424.................t.....244695
AB367397.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 6, derived 2424.................t.....244695
AB367398.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 7/Adefovir-2424.................t.....244695
AB367399.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 8/Adefovir-2424.................t.....244695
AB367400.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 9, derived 2424.................t.....244695
AB367402.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 11, derived2424.................t.....244695
AB367403.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 12/Adefovir2424.................t.....244695
AB367404.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 13/Adefovir2424.................t.....244695
AB367408.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 17/Adefovir2391.................t.....241395
AB367409.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 18, derived2379.................t.....240195
AB367410.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 19/Adefovir2424.................t.....244695
AB367411.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 20, derived2424.................t.....244695
AB367412.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 21, derived2424.................t.....244695
AB367413.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 22/Adefovir2391.................t.....241395
AB367414.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 23/Adefovir2424.................t.....244695
AB367415.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 24/Adefovir2439.................t.....246195
AB367416.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 25, derived2424.................t.....244695
AB367417.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 26, derived2424.................t.....244695
AB367418.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 27/Adefovir2424.................t.....244695
AB367420.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 29, derived2424...................c...244695
AB367423.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 32/Adefovir2424.................t.....244695
AB367424.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 33, derived2424.................t.....244695
AB367425.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 34/Adefovir2388.................t.....241095
AB367428.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 37/Adefovir2370.................t.....239295
AB367430.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 39/Adefovir2412.................t.....243495
AB367432.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 41, derived2424.................t.....244695
AB367434.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 43/Adefovir2424.................t.....244695
FJ151413.1 Hepatitis B virus strain FD-36-5, complete genome 1936.................t.....195895
AB367802.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 16 2385.................t.....240795
AB367803.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 13 2424.................t.....244695
FJ032331.1 Hepatitis B virus isolate S193-1 from China, complete genome 2424.................t.....244695
FJ032336.1 Hepatitis B virus isolate S462-4 from China, complete genome 2424.................t.....244695
FJ032337.1 Hepatitis B virus isolate S462-5 from China, complete genome 2424.................t.....244695
FJ032338.1 Hepatitis B virus isolate S462-7 from China, complete genome 2424.................t.....244695
FJ032339.1 Hepatitis B virus isolate S462-9 from China, complete genome 2424.................t.....244695
FJ032340.1 Hepatitis B virus isolate S529-1 from China, complete genome 2424.................t.....244695
FJ032341.1 Hepatitis B virus isolate S529-6 from China, complete genome 2424.................t.....244695
FJ032345.1 Hepatitis B virus isolate S696-3 from China, complete genome 2424.................t.....244695
FJ032346.1 Hepatitis B virus isolate S732-3 from China, complete genome 2424.................t.....244695
FJ032349.1 Hepatitis B virus isolate S734-1 from China, complete genome 2424.................t.....244695
FJ032350.1 Hepatitis B virus isolate S943-1 from China, complete genome 2424.................t.....244695
FJ032351.1 Hepatitis B virus isolate S943-5 from China, complete genome 2424.................t.....244695
FJ032352.1 Hepatitis B virus isolate S1026-3 from China, complete genome 2424.................t.....244695
FJ032353.1 Hepatitis B virus isolate S1026-4 from China, complete genome 2424.................t.....244695
FJ032354.1 Hepatitis B virus isolate S1026-7 from China, complete genome 2424.................t.....244695
FJ032355.1 Hepatitis B virus isolate S1030-8 from China, complete genome 2424.................t.....244695
FJ032356.1 Hepatitis B virus isolate S1030-9 from China, complete genome 2424.................t.....244695
FJ032357.1 Hepatitis B virus isolate S1607-8 from China, complete genome 2424.................t.....244695
FJ032358.1 Hepatitis B virus isolate S1607-10 from China, complete genome 2424.................t.....244695
FJ032359.1 Hepatitis B virus isolate S1634-1 from China, complete genome 2424.................t.....244695
FJ032360.1 Hepatitis B virus isolate S1634-2 from China, complete genome 2424.................t.....244695
FJ032361.1 Hepatitis B virus isolate S1634-7 from China, complete genome 2424.................t.....244695
FJ023642.1 Hepatitis B virus isolate C2_C04-1257 S protein (S) and core protein 2424.................t.....244695
FJ023666.1 Hepatitis B virus isolate I2_M04-1907, complete genome 2424...................c...244695
FJ023672.1 Hepatitis B virus isolate I2_M04-2305, complete genome 2424...................c...244695
FJ023674.1 Hepatitis B virus isolate I2/C2_C04-0790 S protein (S) and core prote2424.................t.....244695
FJ023631.1 Hepatitis B virus isolate B2_C04-1213 S protein (S) and core protein 2424.................t.....244695
FJ023632.1 Hepatitis B virus isolate B4_C04-0254 S protein (S) and core protein 2424.................t.....244695
FJ023633.1 Hepatitis B virus isolate B4_C04-0583 S protein (S) and core protein 2424.................t.....244695
FJ023634.1 Hepatitis B virus isolate B4_C04-1358 S protein (S) and core protein 2424.................t.....244695
FJ023635.1 Hepatitis B virus isolate B4_M04-0467 S protein (S) and core protein 2424.................t.....244695
FJ023636.1 Hepatitis B virus isolate B4_M04-0876 S protein (S) and core protein 2424.................t.....244695
FJ023638.1 Hepatitis B virus isolate B5_M04-0465 S protein (S) and core protein 2424.................t.....244695
FJ023639.1 Hepatitis B virus isolate C2_C04-0968 S protein (S) and core protein 2424.................t.....244695
FJ023640.1 Hepatitis B virus isolate C2_C04-1206 S protein (S) and core protein 2397.................t.....241995
FJ023641.1 Hepatitis B virus isolate C2_C04-1237 S protein (S) and core protein 2424.................t.....244695
FJ023643.1 Hepatitis B virus isolate C2_C04-1306 S protein (S) and core protein 2424.................t.....244695
FJ023644.1 Hepatitis B virus isolate C2_C04-1318 S protein (S) and core protein 2424.................t.....244695
FJ023645.1 Hepatitis B virus isolate C2_M04-0071 S protein (S) and core protein 2424.................t.....244695
FJ023647.1 Hepatitis B virus isolate C2_M04-0214 S protein (S) and core protein 2424.................t.....244695
FJ023648.1 Hepatitis B virus isolate C2_M04-0273 S protein (S) and core protein 2424.................t.....244695
FJ023649.1 Hepatitis B virus isolate C2_M04-0289 S protein (S) and core protein 2424.................t.....244695
FJ023650.1 Hepatitis B virus isolate C2_M04-0341 S protein (S) and core protein 2424.................t.....244695
FJ023651.1 Hepatitis B virus isolate C2_M04-0391 S protein (S) and core protein 2403.................t.....242595
FJ023652.1 Hepatitis B virus isolate C2_M04-0648 S protein (S) and core protein 2367.................t.....238995
FJ023653.1 Hepatitis B virus isolate C2_M04-0909 S protein (S) and core protein 2424.................t.....244695
FJ023654.1 Hepatitis B virus isolate C2_C04-1412 S protein (S) and core protein 2424.................t.....244695
FJ023655.1 Hepatitis B virus isolate C2_M04-0754 S protein (S) and core protein 2394.................t.....241695
FJ023656.1 Hepatitis B virus isolate C2_M04-0938 S protein (S) and core protein 2424.................t.....244695
FJ023657.1 Hepatitis B virus isolate C2_M04-0987 S protein (S) and core protein 2424.................t.....244695
FJ023658.1 Hepatitis B virus isolate C2_M04-1116 S protein (S) and core protein 2424.................t.....244695
FJ386574.1 Hepatitis B virus isolate 1743, complete genome 2424.................t.....244695
FJ386575.1 Hepatitis B virus isolate 1745, complete genome 2424.................t.....244695
FJ386576.1 Hepatitis B virus isolate 1746, complete genome 2424.................t.....244695
FJ386577.1 Hepatitis B virus isolate 1747, complete genome 2424.................t.....244695
FJ386578.1 Hepatitis B virus isolate 1748, complete genome 2424.................t.....244695
FJ386579.1 Hepatitis B virus isolate 1762, complete genome 2424.................t.....244695
FJ386580.1 Hepatitis B virus isolate 1763, complete genome 2424.................t.....244695
FJ386581.1 Hepatitis B virus isolate 1764, complete genome 2424.................t.....244695
FJ386582.1 Hepatitis B virus isolate 1765, complete genome 2424.................t.....244695
FJ386583.1 Hepatitis B virus isolate 1780, complete genome 2424.................t.....244695
FJ386584.1 Hepatitis B virus isolate 1798, complete genome 2424.................t.....244695
FJ386585.1 Hepatitis B virus isolate 1800, complete genome 2424.................t.....244695
FJ386586.1 Hepatitis B virus isolate 1811, complete genome 2424.................t.....244695
FJ386587.1 Hepatitis B virus isolate 1812, complete genome 2424.................t.....244695
FJ386588.1 Hepatitis B virus isolate 1828, complete genome 2424.................t.....244695
FJ386589.1 Hepatitis B virus isolate 1830, complete genome 2424.................t.....244695
FJ386590.1 Hepatitis B virus isolate 1841, complete genome 2424.................t.....244695
FJ386591.1 Hepatitis B virus isolate 1869, complete genome 2424.................t.....244695
FJ386594.1 Hepatitis B virus isolate 1878, complete genome 2409.................t.....243195
FJ386595.1 Hepatitis B virus isolate 1879, complete genome 2424.................t.....244695
FJ386596.1 Hepatitis B virus isolate 1887, complete genome 2424.................t.....244695
FJ386597.1 Hepatitis B virus isolate 1888, complete genome 2424.................t.....244695
FJ386598.1 Hepatitis B virus isolate 1889, complete genome 2424.................t.....244695
FJ386599.1 Hepatitis B virus isolate 1892, complete genome 2424.................t.....244695
FJ386601.1 Hepatitis B virus isolate 1912, complete genome 2424.................t.....244695
FJ386602.1 Hepatitis B virus isolate 1914, complete genome 2424.................t.....244695
FJ386603.1 Hepatitis B virus isolate 1949, complete genome 2424.................t.....244695
FJ386604.1 Hepatitis B virus isolate 1950, complete genome 2424.................t.....244695
FJ386605.1 Hepatitis B virus isolate 1965, complete genome 2424.................t.....244695
FJ386606.1 Hepatitis B virus isolate 1966, complete genome 2424.................t.....244695
FJ386607.1 Hepatitis B virus isolate 1967, complete genome 2424.................t.....244695
FJ386609.1 Hepatitis B virus isolate 1999, complete genome 2424.................t.....244695
FJ386610.1 Hepatitis B virus isolate 2000, complete genome 2424.................t.....244695
FJ386612.1 Hepatitis B virus isolate 2019, complete genome 2424.................t.....244695
FJ386613.1 Hepatitis B virus isolate 2039, complete genome 2424.................t.....244695
FJ386614.1 Hepatitis B virus isolate 2040, complete genome 2424....................t..244695
FJ386618.1 Hepatitis B virus isolate 2111, complete genome 2424.................t.....244695
FJ386619.1 Hepatitis B virus isolate 2119, complete genome 2424.................t.....244695
FJ386620.1 Hepatitis B virus isolate 2121, complete genome 2424.................t.....244695
FJ386623.1 Hepatitis B virus isolate 2165, complete genome 2424.................t.....244695
FJ386625.1 Hepatitis B virus isolate 2190, complete genome 2424.................t.....244695
FJ386626.1 Hepatitis B virus isolate 2205, complete genome 2424.................t.....244695
FJ386627.1 Hepatitis B virus isolate 2242, complete genome 2424.................t.....244695
FJ386628.1 Hepatitis B virus isolate 2255, complete genome 2424.................t.....244695
FJ386629.1 Hepatitis B virus isolate 2286, complete genome 2400.................t.....242295
FJ386631.1 Hepatitis B virus isolate 2359, complete genome 2424.................t.....244695
FJ386632.1 Hepatitis B virus isolate 2370, complete genome 2424.................t.....244695
FJ386634.1 Hepatitis B virus isolate 2392, complete genome 2424.................t.....244695
FJ386635.1 Hepatitis B virus isolate 2399, complete genome 2424.................t.....244695
FJ386636.1 Hepatitis B virus isolate 1813, complete genome 2424.................t.....244695
FJ386637.1 Hepatitis B virus isolate 2151, complete genome 2424.................t.....244695
FJ386638.1 Hepatitis B virus isolate 2015, complete genome 2424.................t.....244695
FJ386639.1 Hepatitis B virus isolate 1929, complete genome 2424.................t.....244695
FJ386640.1 Hepatitis B virus isolate 2168, complete genome 2391.................t.....241395
FJ386641.1 Hepatitis B virus isolate 2236, complete genome 2388.................t.....241095
FJ386642.1 Hepatitis B virus isolate 1829, complete genome 2424.................t.....244695
FJ386643.1 Hepatitis B virus isolate 2493, complete genome 2370.................t.....239295
FJ386644.1 Hepatitis B virus isolate S737, complete genome 2424.................t.....244695
FJ386645.1 Hepatitis B virus isolate S897, complete genome 2397.................t.....241995
FJ386647.1 Hepatitis B virus isolate 2400, complete genome 2424.................t.....244695
FJ386649.1 Hepatitis B virus isolate 2422, complete genome 2424.................t.....244695
FJ386650.1 Hepatitis B virus isolate 2468, complete genome 2424.................t.....244695
FJ386651.1 Hepatitis B virus isolate 2476, complete genome 2424.................t.....244695
FJ386653.1 Hepatitis B virus isolate S3, complete genome 2424.................t.....244695
FJ386655.1 Hepatitis B virus isolate S121, complete genome 2424.................t.....244695
FJ386657.1 Hepatitis B virus isolate S165, complete genome 2424.................t.....244695
FJ386658.1 Hepatitis B virus isolate S185, complete genome 2424.................t.....244695
FJ386659.1 Hepatitis B virus isolate S219, complete genome 2424.................t.....244695
FJ386662.1 Hepatitis B virus isolate S269, complete genome 2424.................t.....244695
FJ386663.1 Hepatitis B virus isolate S307, complete genome 2424.................t.....244695
FJ386664.1 Hepatitis B virus isolate S310, complete genome 2424.................t.....244695
FJ386665.1 Hepatitis B virus isolate S359, complete genome 2424.................t.....244695
FJ386666.1 Hepatitis B virus isolate S367, complete genome 2424.................t.....244695
FJ386667.1 Hepatitis B virus isolate S379, complete genome 2424.................t.....244695
FJ386668.1 Hepatitis B virus isolate S395, complete genome 2424.................t.....244695
FJ386671.1 Hepatitis B virus isolate S586, complete genome 2424.................t.....244695
FJ386672.1 Hepatitis B virus isolate S606, complete genome 2424.................t.....244695
FJ386675.1 Hepatitis B virus isolate S734, complete genome 2424.................t.....244695
FJ386676.1 Hepatitis B virus isolate S1055, complete genome 2424.................t.....244695
FJ386678.1 Hepatitis B virus isolate S1147, complete genome 2424.................t.....244695
FJ386684.1 Hepatitis B virus isolate S1554, complete genome 2424.................t.....244695
FJ386685.1 Hepatitis B virus isolate S1568, complete genome 2424.................t.....244695
FJ386686.1 Hepatitis B virus isolate S1572, complete genome 2424.................t.....244695
FJ386687.1 Hepatitis B virus isolate S1600, complete genome 2424.................t.....244695
FJ386688.1 Hepatitis B virus isolate S1632, complete genome 2424.................t.....244695
FJ386689.1 Hepatitis B virus isolate S1649, complete genome 2424.................t.....244695
EU835240.1 Hepatitis B virus isolate IND-DIB112, complete genome 2424.................t.....244695
FJ518810.1 Hepatitis B virus strain 6898, complete genome 2424.................t.....244695
FJ518812.1 Hepatitis B virus strain 6923, complete genome 2424.................t.....244695
FJ518813.1 Hepatitis B virus strain 6945, complete genome 2424.................t.....244695
FM199976.1 Hepatitis B virus complete genome, strain 45082 2430.................t.....245295
FM199977.1 Hepatitis B virus complete genome, strain 45088 2430.................t.....245295
FM199978.1 Hepatitis B virus complete genome, strain 49136 2430.................t.....245295
FM199979.1 Hepatitis B virus complete genome, strain 49224 2430.................t.....245295
FM199980.1 Hepatitis B virus complete genome, strain 49244 2430.................t.....245295
FM199981.1 Hepatitis B virus complete genome, strain 49263 2430.................t.....245295
FJ787436.1 Hepatitis B virus isolate S129-6, complete genome 2423.................t.....244595
FJ787437.1 Hepatitis B virus isolate S129-9, complete genome 2424.................t.....244695
FJ787439.1 Hepatitis B virus isolate S157-4, complete genome 2424.................t.....244695
FJ787441.1 Hepatitis B virus isolate S157-9, complete genome 2424.................t.....244695
FJ787442.1 Hepatitis B virus isolate S171-4, complete genome 2424.................t.....244695
FJ787443.1 Hepatitis B virus isolate S171-5, complete genome 2424.................t.....244695
FJ787444.1 Hepatitis B virus isolate S208-1, complete genome 2424.................t.....244695
FJ787445.1 Hepatitis B virus isolate S425-2, complete genome 2424.................t.....244695
FJ787446.1 Hepatitis B virus isolate S425-20, complete genome 2424.................t.....244695
FJ787447.1 Hepatitis B virus isolate S461-2, complete genome 2424.................t.....244695
FJ787448.1 Hepatitis B virus isolate S461-3, complete genome 2334.................t.....235695
FJ787450.1 Hepatitis B virus isolate S627-2, complete genome 2277.................t.....229995
FJ787453.1 Hepatitis B virus isolate S1049-3, complete genome 2424.................t.....244695
FJ787454.1 Hepatitis B virus isolate S1049-4, complete genome 2424.................t.....244695
FJ787455.1 Hepatitis B virus isolate S1092-3, complete genome 2424.................t.....244695
FJ787456.1 Hepatitis B virus isolate S1092-4, complete genome 2424.................t.....244695
FJ787458.1 Hepatitis B virus isolate S1248-9, complete genome 2424.................t.....244695
FJ787461.1 Hepatitis B virus isolate S1357-2, complete genome 2424.................t.....244695
FJ787462.1 Hepatitis B virus isolate S1357-3, complete genome 2424.................t.....244695
FJ787463.1 Hepatitis B virus isolate S1357-6, complete genome 2424.................t.....244695
FJ787464.1 Hepatitis B virus isolate S1371-3, complete genome 2424.................t.....244695
FJ787465.1 Hepatitis B virus isolate S1371-5, complete genome 2424.................t.....244695
FJ787466.1 Hepatitis B virus isolate S1371-11, complete genome 2424.................t.....244695
FJ787467.1 Hepatitis B virus isolate S1371-16, complete genome 2424.................t.....244695
FJ787468.1 Hepatitis B virus isolate S1426-1, complete genome 2424.................t.....244695
FJ787469.1 Hepatitis B virus isolate S1426-3, complete genome 2424.................t.....244695
FJ787470.1 Hepatitis B virus isolate S1538-4, complete genome 2424..................a....244695
FJ787471.1 Hepatitis B virus isolate S1538-6, complete genome 2424..................a....244695
FJ787473.1 Hepatitis B virus isolate S1732-2, complete genome 2252.................t.....227495
FJ787474.1 Hepatitis B virus isolate S1732-6, complete genome 2260.................t.....228295
FJ787478.1 Hepatitis B virus isolate S65-2, complete genome 2407.................t.....242995
FJ787479.1 Hepatitis B virus isolate S157-7, complete genome 2424.................t.....244695
FJ787480.1 Hepatitis B virus isolate S425-16, complete genome 2424.................t.....244695
FJ787481.1 Hepatitis B virus isolate S852-2, complete genome 2379.................t.....240195
FJ787486.1 Hepatitis B virus isolate S2235-2, complete genome 2424.................t.....244695
FJ787490.1 Hepatitis B virus isolate LHZ-1, complete genome 2397.................t.....241995
AB493827.1 Hepatitis B virus DNA, complete genome, isolate: 25UC 2424.................t.....244695
AB493828.1 Hepatitis B virus DNA, complete genome, isolate: 33UC 2428.................t.....245095
AB493829.1 Hepatitis B virus DNA, complete genome, isolate: P14 2424.................t.....244695
AB493831.1 Hepatitis B virus DNA, complete genome, isolate: P48 2287.................t.....230995
AB493832.1 Hepatitis B virus DNA, complete genome, isolate: P19 2424.................t.....244695
AB493833.1 Hepatitis B virus DNA, complete genome, isolate: P9 2424.................t.....244695
AB493834.1 Hepatitis B virus DNA, complete genome, isolate: P18 2424.................t.....244695
AB493835.1 Hepatitis B virus DNA, complete genome, isolate: P30 2424.................t.....244695
AB493842.1 Hepatitis B virus DNA, complete genome, isolate: 31UC 2424.................t.....244695
AB493843.1 Hepatitis B virus DNA, complete genome, isolate: 32UC 2428.................t.....245095
AB493844.1 Hepatitis B virus DNA, complete genome, isolate: 43UC 2330.................t.....235295
AB493846.1 Hepatitis B virus DNA, complete genome, isolate: 17UC 2421.................t.....244395
FJ349296.1 Hepatitis B virus strain 29-OYE-10, complete genome 2421.................t.....244395
AB362932.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon2424.................t.....244695
AB362933.1 Hepatitis B virus C gene for core protein, complete cds, clone: B1_JP2424...................c...244695
GQ205440.1 Hepatitis B virus isolate Bc, complete genome 2424.................t.....244695
GQ205441.1 Hepatitis B virus isolate Cc, complete genome 2424.................t.....244695
AP011084.1 Hepatitis B virus DNA, complete genome, strain: B0503341(PTK)F 2424.................t.....244695
AP011085.1 Hepatitis B virus DNA, complete genome, strain: B0612746(JKT)F 2424.................t.....244695
AP011086.1 Hepatitis B virus DNA, complete genome, strain: B0503233(BJS)F 2424.................t.....244695
AP011087.1 Hepatitis B virus DNA, complete genome, strain: B0607171(KDR)F 2424.................t.....244695
AP011088.1 Hepatitis B virus DNA, complete genome, strain: B0503213(MKS)F 2424.................t.....244695
AP011089.1 Hepatitis B virus DNA, complete genome, strain: B0607154(KDR)F 2424.................t.....244695
AP011090.1 Hepatitis B virus DNA, complete genome, strain: B0714189(WBK)F 2424.................t.....244695
AP011091.1 Hepatitis B virus DNA, complete genome, strain: B0714202(BMA)F 2424.................t.....244695
AP011092.1 Hepatitis B virus DNA, complete genome, strain: B0715677(MMR)F 2424.................t.....244695
AP011093.1 Hepatitis B virus DNA, complete genome, strain: B0308839(DPS)F 2424.................t.....244695
AP011095.1 Hepatitis B virus DNA, complete genome, strain: B0503138(KPG)F 2424.................t.....244695
AP011096.1 Hepatitis B virus DNA, complete genome, strain: B0714157(WBK)F 2424.................t.....244695
AP011097.1 Hepatitis B virus DNA, complete genome, strain: C0503296(PTK)F 2424.................t.....244695
AP011098.1 Hepatitis B virus DNA, complete genome, strain: C0714154(WBK)F 2424.................t.....244695
AP011099.1 Hepatitis B virus DNA, complete genome, strain: C0503222(MND)F 2424.................t.....244695
AP011100.1 Hepatitis B virus DNA, complete genome, strain: C0607174(THN)F 2424.................t.....244695
AP011101.1 Hepatitis B virus DNA, complete genome, strain: C0715697(TNT)F 2424.................t.....244695
AP011104.1 Hepatitis B virus DNA, complete genome, strain: C0309374(DPS)F 2424.................t.....244695
AP011105.1 Hepatitis B virus DNA, complete genome, strain: C0309392(DPS)F 2424.................t.....244695
AP011106.1 Hepatitis B virus DNA, complete genome, strain: C0503236(BJS)F 2424.................t.....244695
AP011107.1 Hepatitis B virus DNA, complete genome, strain: C0503463(MTR)F 2424.................t.....244695
AP011108.1 Hepatitis B virus DNA, complete genome, strain: C0503133(DIL)F 2424.................t.....244695
GQ227692.1 Hepatitis B virus isolate Z3-1, complete genome 2424.................t.....244695
GQ227694.1 Hepatitis B virus isolate Z31-2, complete genome 2424.................t.....244695
GQ227695.1 Hepatitis B virus isolate Z31-5, complete genome 2424.................t.....244695
GQ227696.1 Hepatitis B virus isolate Z31-6, complete genome 2424.................t.....244695
GQ227697.1 Hepatitis B virus isolate Z3-2, complete genome 2424.................t.....244695
GQ259588.1 Hepatitis B virus isolate Z31-22, complete genome 2424.................t.....244695
GQ184323.1 Hepatitis B virus isolate ZADGM1121, complete genome 2430.................t.....245295
GQ184324.1 Hepatitis B virus isolate ZADGM1122, complete genome 2430.................t.....245295
GQ184325.1 Hepatitis B virus isolate ZADGM50, complete genome 2407.................t.....242995
GQ184326.1 Hepatitis B virus isolate ZADGM501, complete genome 2421.................t.....244395
FJ899762.1 Hepatitis B virus isolate C9-3, complete genome 2423.................t.....244595
FJ899763.1 Hepatitis B virus isolate C9-4, complete genome 2424.................t.....244695
FJ899764.1 Hepatitis B virus isolate C9-12, complete genome 2424.................t.....244695
FJ899766.1 Hepatitis B virus isolate C25-2, complete genome 2315.................t.....233795
FJ899767.1 Hepatitis B virus isolate C26-2, complete genome 2424.................t.....244695
FJ899769.1 Hepatitis B virus isolate C76-3, complete genome 2424.................t.....244695
FJ899770.1 Hepatitis B virus isolate C76-4, complete genome 2424.................t.....244695
FJ899771.1 Hepatitis B virus isolate C76-5, complete genome 2424.................t.....244695
FJ899772.1 Hepatitis B virus isolate C113-3, complete genome 2313.................t.....233595
FJ899773.1 Hepatitis B virus isolate C113-6, complete genome 2280.................t.....230295
FJ899774.1 Hepatitis B virus isolate C120-5, complete genome 2424.................t.....244695
FJ899775.1 Hepatitis B virus isolate C120-6, complete genome 2424.................t.....244695
FJ899776.1 Hepatitis B virus isolate C122-7, complete genome 2424.................t.....244695
FJ899777.1 Hepatitis B virus isolate C127-10, complete genome 2424.................t.....244695
FJ899778.1 Hepatitis B virus isolate C173-1, complete genome 2424.................t.....244695
FJ899779.1 Hepatitis B virus isolate C185-1, complete genome 2424.................t.....244695
FJ899780.1 Hepatitis B virus isolate C185-2, complete genome 2433.................t.....245595
FJ899781.1 Hepatitis B virus isolate C185-3, complete genome 2433.................t.....245595
FJ899782.1 Hepatitis B virus isolate C185-6, complete genome 2433.................t.....245595
FJ899783.1 Hepatitis B virus isolate C207-1, complete genome 2424.................t.....244695
FJ899792.1 Hepatitis B virus isolate D146-1, complete genome 2424.................t.....244695
FJ899796.1 Hepatitis B virus isolate C76-1, complete genome 2424.................t.....244695
AB485808.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IT 2424.................t.....244695
GQ414522.1 Hepatitis B virus strain GTA_CT, complete genome 1057.................t.....107995
GQ377514.1 Hepatitis B virus isolate J8, complete genome 2424.................t.....244695
GQ377515.1 Hepatitis B virus isolate J9, complete genome 2424.................t.....244695
GQ377516.1 Hepatitis B virus isolate J10, complete genome 2424.................t.....244695
GQ377517.1 Hepatitis B virus isolate J12, complete genome 2424.................t.....244695
GQ377519.1 Hepatitis B virus isolate J16, complete genome 2424.................t.....244695
GQ377520.1 Hepatitis B virus isolate J18, complete genome 2424.................t.....244695
GQ377522.1 Hepatitis B virus isolate J20, complete genome 2424.................t.....244695
GQ377523.1 Hepatitis B virus isolate J21, complete genome 2424.................t.....244695
GQ377524.1 Hepatitis B virus isolate J23, complete genome 2424.................t.....244695
GQ377525.1 Hepatitis B virus isolate J24, complete genome 2424.................t.....244695
GQ377526.1 Hepatitis B virus isolate J27, complete genome 2424.................t.....244695
GQ377527.1 Hepatitis B virus isolate J28, complete genome 2424.................t.....244695
GQ377528.1 Hepatitis B virus isolate J29, complete genome 2424.................t.....244695
GQ377529.1 Hepatitis B virus isolate J34, complete genome 2424.................t.....244695
GQ377530.1 Hepatitis B virus isolate J35, complete genome 2424.................t.....244695
GQ377531.1 Hepatitis B virus isolate J36, complete genome 2424.................t.....244695
GQ377532.1 Hepatitis B virus isolate J37, complete genome 2424.................t.....244695
GQ377533.1 Hepatitis B virus isolate J39, complete genome 2424.................t.....244695
GQ377534.1 Hepatitis B virus isolate J41, complete genome 2424.................t.....244695
GQ377535.1 Hepatitis B virus isolate J45, complete genome 2424.................t.....244695
GQ377536.1 Hepatitis B virus isolate J47, complete genome 2424.................t.....244695
GQ377537.1 Hepatitis B virus isolate J48, complete genome 2424.................t.....244695
GQ377538.1 Hepatitis B virus isolate J52, complete genome 2424.................t.....244695
GQ377539.1 Hepatitis B virus isolate J53, complete genome 2424.................t.....244695
GQ377540.1 Hepatitis B virus isolate J57, complete genome 2424.................t.....244695
GQ377541.1 Hepatitis B virus isolate J58, complete genome 2424.................t.....244695
GQ377542.1 Hepatitis B virus isolate J61, complete genome 2424.................t.....244695
GQ377544.1 Hepatitis B virus isolate J69, complete genome 2424.................t.....244695
GQ377545.1 Hepatitis B virus isolate J76, complete genome 2424.................t.....244695
GQ377546.1 Hepatitis B virus isolate J77, complete genome 2424.................t.....244695
GQ377547.1 Hepatitis B virus isolate J78, complete genome 2424.................t.....244695
GQ377548.1 Hepatitis B virus isolate J79, complete genome 2424.................t.....244695
GQ377549.1 Hepatitis B virus isolate J80, complete genome 2424.................t.....244695
GQ377551.1 Hepatitis B virus isolate J82, complete genome 2424.................t.....244695
GQ377552.1 Hepatitis B virus isolate J83, complete genome 2424.................t.....244695
GQ377553.1 Hepatitis B virus isolate J84, complete genome 2424.................t.....244695
GQ377554.1 Hepatitis B virus isolate J85, complete genome 2424.................t.....244695
GQ377555.1 Hepatitis B virus isolate J86, complete genome 2424.................t.....244695
GQ377556.1 Hepatitis B virus isolate J87, complete genome 2424.....a.................244695
GQ377557.1 Hepatitis B virus isolate J88, complete genome 2424.................t.....244695
GQ377558.1 Hepatitis B virus isolate J89, complete genome 2424.................t.....244695
GQ377559.1 Hepatitis B virus isolate J92, complete genome 2424.................t.....244695
GQ377560.1 Hepatitis B virus isolate J93, complete genome 2424.................t.....244695
GQ377561.1 Hepatitis B virus isolate J96, complete genome 2424.................t.....244695
GQ377562.1 Hepatitis B virus isolate J97, complete genome 2424.................t.....244695
GQ377563.1 Hepatitis B virus isolate J98, complete genome 2424.................t.....244695
GQ377564.1 Hepatitis B virus isolate J99, complete genome 2424.................t.....244695
GQ377565.1 Hepatitis B virus isolate J100, complete genome 2424.................t.....244695
GQ377566.1 Hepatitis B virus isolate J101, complete genome 2424.................t.....244695
GQ377568.1 Hepatitis B virus isolate J103, complete genome 2424.................t.....244695
GQ377569.1 Hepatitis B virus isolate J105, complete genome 2424.................t.....244695
GQ377570.1 Hepatitis B virus isolate J110, complete genome 2424.................t.....244695
GQ377571.1 Hepatitis B virus isolate J112, complete genome 2424.................t.....244695
GQ377572.1 Hepatitis B virus isolate J113, complete genome 2424.................t.....244695
GQ377573.1 Hepatitis B virus isolate J114, complete genome 2424.................t.....244695
GQ377574.1 Hepatitis B virus isolate J115, complete genome 2424.................t.....244695
GQ377575.1 Hepatitis B virus isolate J116, complete genome 2424.................t.....244695
GQ377576.1 Hepatitis B virus isolate J117, complete genome 2424.................t.....244695
GQ377577.1 Hepatitis B virus isolate J118, complete genome 2424.................t.....244695
GQ377578.1 Hepatitis B virus isolate J125, complete genome 2424.................t.....244695
GQ377579.1 Hepatitis B virus isolate J126, complete genome 2424.................t.....244695
GQ377580.1 Hepatitis B virus isolate J127, complete genome 2424.................t.....244695
GQ377581.1 Hepatitis B virus isolate J129, complete genome 2424.................t.....244695
GQ377582.1 Hepatitis B virus isolate J131, complete genome 2424.................t.....244695
GQ377583.1 Hepatitis B virus isolate J132, complete genome 2424.................t.....244695
GQ377584.1 Hepatitis B virus isolate J133, complete genome 2424.................t.....244695
GQ377585.1 Hepatitis B virus isolate J134, complete genome 2424.................t.....244695
GQ377587.1 Hepatitis B virus isolate J138, complete genome 2424.................t.....244695
GQ377588.1 Hepatitis B virus isolate J141, complete genome 2424.................t.....244695
GQ377589.1 Hepatitis B virus isolate J145, complete genome 2424.................t.....244695
GQ377590.1 Hepatitis B virus isolate J147, complete genome 2424.................t.....244695
GQ377591.1 Hepatitis B virus isolate J148, complete genome 2424.................t.....244695
GQ377593.1 Hepatitis B virus isolate J150, complete genome 2424.................t.....244695
GQ377594.1 Hepatitis B virus isolate J152, complete genome 2424.................t.....244695
GQ377595.1 Hepatitis B virus isolate J155, complete genome 2424.................t.....244695
GQ377596.1 Hepatitis B virus isolate J156, complete genome 2424.................t.....244695
GQ377597.1 Hepatitis B virus isolate J157, complete genome 2424.................t.....244695
GQ377598.1 Hepatitis B virus isolate J158, complete genome 2424.................t.....244695
GQ377599.1 Hepatitis B virus isolate J160, complete genome 2424.................t.....244695
GQ377600.1 Hepatitis B virus isolate J161, complete genome 2424.................t.....244695
GQ377601.1 Hepatitis B virus isolate J164, complete genome 2424.................t.....244695
GQ377602.1 Hepatitis B virus isolate J165, complete genome 2424.................t.....244695
GQ377603.1 Hepatitis B virus isolate J166, complete genome 2424.................t.....244695
GQ377604.1 Hepatitis B virus isolate J168, complete genome 2424.................t.....244695
GQ377606.1 Hepatitis B virus isolate J171, complete genome 2424.................t.....244695
GQ377608.1 Hepatitis B virus isolate J174, complete genome 2424.................t.....244695
GQ377610.1 Hepatitis B virus isolate J177, complete genome 2424.................t.....244695
GQ377612.1 Hepatitis B virus isolate J180, complete genome 2424.................t.....244695
GQ377613.1 Hepatitis B virus isolate J181, complete genome 2424.................t.....244695
GQ377614.1 Hepatitis B virus isolate J185, complete genome 2424.................t.....244695
GQ377615.1 Hepatitis B virus isolate J186, complete genome 2424.................t.....244695
GQ377616.1 Hepatitis B virus isolate J192, complete genome 2424.................t.....244695
GQ377617.1 Hepatitis B virus isolate J193, complete genome 2424.................t.....244695
GQ377618.1 Hepatitis B virus isolate J194, complete genome 2424.................t.....244695
GQ377619.1 Hepatitis B virus isolate J195, complete genome 2424.................t.....244695
GQ377623.1 Hepatitis B virus isolate J208, complete genome 2424.....................g.244695
GQ377624.1 Hepatitis B virus isolate J221, complete genome 2424.................t.....244695
GQ377625.1 Hepatitis B virus isolate J222, complete genome 2424.................t.....244695
GQ377626.1 Hepatitis B virus isolate J225, complete genome 2424.................t.....244695
GQ377627.1 Hepatitis B virus isolate J231, complete genome 2424.................t.....244695
GQ377628.1 Hepatitis B virus isolate J232, complete genome 2424.................t.....244695
GQ377629.1 Hepatitis B virus isolate J234, complete genome 2424.................t.....244695
GQ377630.1 Hepatitis B virus isolate J236, complete genome 2424.................t.....244695
GQ377631.1 Hepatitis B virus isolate J239, complete genome 2424.................t.....244695
GQ377632.1 Hepatitis B virus isolate J240, complete genome 2424.................t.....244695
GQ377633.1 Hepatitis B virus isolate J241, complete genome 2424.................t.....244695
GQ377634.1 Hepatitis B virus isolate J242, complete genome 2424.................t.....244695
GQ377635.1 Hepatitis B virus isolate J245, complete genome 2424.................t.....244695
GQ377636.1 Hepatitis B virus isolate J248, complete genome 2424.................t.....244695
GQ377637.1 Hepatitis B virus isolate J249, complete genome 2424.................t.....244695
GQ377638.1 Hepatitis B virus isolate J250, complete genome 2424.................t.....244695
GQ377639.1 Hepatitis B virus isolate J251, complete genome 2424.................t.....244695
GQ377640.1 Hepatitis B virus isolate J253, complete genome 2424.................t.....244695
GQ377641.1 Hepatitis B virus isolate J254, complete genome 2424.................t.....244695
GQ377642.1 Hepatitis B virus isolate J256, complete genome 2424.................t.....244695
GQ377643.1 Hepatitis B virus isolate J258, complete genome 2424.................t.....244695
GQ377644.1 Hepatitis B virus isolate J294, complete genome 2424.................t.....244695
GQ872210.1 Hepatitis B virus, complete genome 2424.................t.....244695
GQ872211.1 Hepatitis B virus, complete genome 2424.................t.....244695
GQ475305.1 Hepatitis B virus isolate KOR1CHB, complete genome 2424.................t.....244695
GQ475306.1 Hepatitis B virus isolate KOR2CHB, complete genome 2424.................t.....244695
GQ475307.1 Hepatitis B virus isolate KOR3CHB, complete genome 2424.................t.....244695
GQ475308.1 Hepatitis B virus isolate KOR4CHB, complete genome 2424.................t.....244695
GQ475309.1 Hepatitis B virus isolate KOR5CHB, complete genome 2424.................t.....244695
GQ475310.1 Hepatitis B virus isolate KOR6CHB, complete genome 2424.................t.....244695
GQ475311.1 Hepatitis B virus isolate KOR7CHB, complete genome 2424.................t.....244695
GQ475312.1 Hepatitis B virus isolate KOR8CHB, complete genome 2424.................t.....244695
GQ475313.1 Hepatitis B virus isolate KOR9CHB, complete genome 2424.................t.....244695
GQ475314.1 Hepatitis B virus isolate KOR10CHB, complete genome 2424.................t.....244695
GQ475315.1 Hepatitis B virus isolate KOR11CHB, complete genome 2424.................t.....244695
GQ475316.1 Hepatitis B virus isolate KOR12CHB, complete genome 2424.................t.....244695
GQ475317.1 Hepatitis B virus isolate KOR13CHB, complete genome 2424.................t.....244695
GQ475318.1 Hepatitis B virus isolate KOR14CHB, complete genome 2424.................t.....244695
GQ475319.1 Hepatitis B virus isolate KOR15CHB, complete genome 2424.................t.....244695
GQ475320.1 Hepatitis B virus isolate KOR16CHB, complete genome 2424.................t.....244695
GQ475322.1 Hepatitis B virus isolate KOR18LC, complete genome 2424.................t.....244695
GQ475323.1 Hepatitis B virus isolate KOR19LC, complete genome 2340.................t.....236295
GQ475324.1 Hepatitis B virus isolate KOR20LC, complete genome 2424.................t.....244695
GQ475327.1 Hepatitis B virus isolate KOR23LC, complete genome 2424.................t.....244695
GQ475328.1 Hepatitis B virus isolate KOR24LC, complete genome 2424.................t.....244695
GQ475329.1 Hepatitis B virus isolate KOR25LC, complete genome 2424.................t.....244695
GQ475330.1 Hepatitis B virus isolate KOR26LC, complete genome 2424.................t.....244695
GQ475331.1 Hepatitis B virus isolate KOR27LC, complete genome 2424.................t.....244695
GQ475332.1 Hepatitis B virus isolate KOR28LC, complete genome 2424.................t.....244695
GQ475333.1 Hepatitis B virus isolate KOR29LC, complete genome 2370.................t.....239295
GQ475334.1 Hepatitis B virus isolate KOR30LC, complete genome 2424.................t.....244695
GQ475335.1 Hepatitis B virus isolate KOR31LC, complete genome 2397.................t.....241995
GQ475336.1 Hepatitis B virus isolate KOR32LC, complete genome 2424.................t.....244695
GQ475337.1 Hepatitis B virus isolate KOR33LC, complete genome 2424.................t.....244695
GQ475338.1 Hepatitis B virus isolate KOR34LC, complete genome 2424.................t.....244695
GQ475339.1 Hepatitis B virus isolate KOR35HCC, complete genome 2424.................t.....244695
GQ475340.1 Hepatitis B virus isolate KOR36HCC, complete genome 2424.................t.....244695
GQ475342.1 Hepatitis B virus isolate KOR38HCC, complete genome 2424.................t.....244695
GQ475344.1 Hepatitis B virus isolate KOR40HCC, complete genome 2424.................t.....244695
GQ475345.1 Hepatitis B virus isolate KOR41HCC, complete genome 2424.................t.....244695
GQ475346.1 Hepatitis B virus isolate KOR42HCC, complete genome 2424.................t.....244695
GQ475347.1 Hepatitis B virus isolate KOR43HCC, complete genome 2424.................t.....244695
GQ475348.1 Hepatitis B virus isolate KOR44HCC, complete genome 2424.................t.....244695
GQ475349.1 Hepatitis B virus isolate KOR45HCC, complete genome 2424.................t.....244695
GQ475350.1 Hepatitis B virus isolate KOR46HCC, complete genome 2424.................t.....244695
GQ475351.1 Hepatitis B virus isolate KOR47HCC, complete genome 2424.................t.....244695
GQ475353.1 Hepatitis B virus isolate KOR49HCC, complete genome 2361.................t.....238395
GQ475354.1 Hepatitis B virus isolate KOR50HCC, complete genome 2424.................t.....244695
GQ475355.1 Hepatitis B virus isolate KOR51HCC, complete genome 2424.................t.....244695
GQ475356.1 Hepatitis B virus isolate KOR52HCC, complete genome 2424.................t.....244695
GQ475357.1 Hepatitis B virus isolate KOR53HCC, complete genome 2424.................t.....244695
AB471848.1 Hepatitis B virus DNA, complete genome, isolate: F1S-F 2424.................t.....244695
AB471849.1 Hepatitis B virus DNA, complete genome, isolate: F1S-C2 2424.................t.....244695
AB471850.1 Hepatitis B virus DNA, complete genome, isolate: F1S-C1 2424.................t.....244695
AB471851.1 Hepatitis B virus DNA, complete genome, isolate: F2NK-F 2424.................t.....244695
AB471852.1 Hepatitis B virus DNA, complete genome, isolate: F2S-C2 2424.................t.....244695
AB471853.1 Hepatitis B virus DNA, complete genome, isolate: F2S-C3 2424.................t.....244695
AB471854.1 Hepatitis B virus DNA, complete genome, isolate: F5M-F 2424.................t.....244695
AB471855.1 Hepatitis B virus DNA, complete genome, isolate: F5M-C 2424.................t.....244695
AB471856.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C1 2424.................t.....244695
AB471857.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C2 2424.................t.....244695
AF043560.2 Hepatitis B virus isolate BA2, complete genome 2430.................t.....245295
AF043580.2 Hepatitis B virus isolate BA3, complete genome 2430.................t.....245295
FN594768.1 Hepatitis B virus complete genome, isolate bne272 2465.................t.....248795
FN594769.1 Hepatitis B virus complete genome, isolate bne281 2424.................t.....244695
FN594770.1 Hepatitis B virus complete genome, isolate bne367 2424.................t.....244695
FN594771.1 Hepatitis B virus complete genome, isolate bne442 2424.................t.....244695
GU357842.1 Hepatitis B virus isolate C4371, complete genome 2424.................t.....244695
GU357843.1 Hepatitis B virus isolate Y580, complete genome 2424.................t.....244695
GU357846.1 Hepatitis B virus isolate Y10, complete genome 2424.................t.....244695
GU385774.1 Hepatitis B virus isolate C2-Shanghai, complete genome 2424.................t.....244695
GU721029.1 Hepatitis B virus isolate CMCL107, complete genome 2424.................t.....244695
GU451682.1 Hepatitis B virus isolate pLL-EGFP, complete genome 2424.................t.....244695
AB549213.1 Hepatitis B virus DNA, complete genome, clone: G-C-F 2430.................t.....245295
FN545828.1 Hepatitis B virus complete genome, strain 34015 2430.................t.....245295
FN545829.1 Hepatitis B virus complete genome, strain 34028 2430.................t.....245295
FN545831.1 Hepatitis B virus complete genome, strain 42002 2430.................t.....245295
FN545833.1 Hepatitis B virus complete genome, strain 42063 2430.................t.....245295
FN545834.1 Hepatitis B virus complete genome, strain 42064 2430.................t.....245295
FN545835.1 Hepatitis B virus complete genome, strain 42096 2430.................t.....245295
FN545836.1 Hepatitis B virus complete genome, strain 42128 2430.................t.....245295
FN545837.1 Hepatitis B virus complete genome, strain 42145 2421.................t.....244395
FN545838.1 Hepatitis B virus complete genome, strain 42202 2430.................t.....245295
AB555497.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA37 2424.................t.....244695
AB540582.1 HBV genotype B DNA, complete genome, strain: B0901189(NT15) 2424.................t.....244695
AB540583.1 HBV genotype C DNA, complete genome, strain: C0901177(NT3) 2424.................t.....244695
AB540584.1 HBV genotype C DNA, complete genome, strain: C0901190(NT16) 2424.................t.....244695
AB540585.1 HBV genotype C DNA, complete genome, strain: C0901192(NT18) 2424.................t.....244695
HM146131.1 Hepatitis B virus isolate TCGA5889, complete genome 2304.................t.....232695
AB480036.2 Hepatitis B virus DNA, complete genome, strain: 06-17 2430.................t.....245295
AB480038.2 Hepatitis B virus DNA, complete genome, strain: 06-23 2430.................t.....245295
AB480039.2 Hepatitis B virus DNA, complete genome, strain: 06-27 2430.................t.....245295
AB480040.2 Hepatitis B virus DNA, complete genome, strain: 06-44 2430.................t.....245295
AB480041.2 Hepatitis B virus DNA, complete genome, strain: 06-51 2430.................t.....245295
FR714494.1 Hepatitis B virus complete genome, isolate NS052, X/C recombinant 2424...................c...244695
FR714497.1 Hepatitis B virus complete genome, isolate QP046, X/C recombinant 2424...................c...244695
FR714498.1 Hepatitis B virus complete genome, isolate QQB36, X/C recombinant 2424.................t.....244695
FR714503.1 Hepatitis B virus complete genome, isolate TZ306, X/C recombinant 2424...................c...244695
FR714505.1 Hepatitis B virus complete genome, isolate XW233, X/C recombinant 2424.................t.....244695
GU177079.1 Hepatitis B virus isolate DN171, complete genome 2430.................t.....245295
AB554016.1 HBV genotype D DNA, complete genome, isolate: TRF08226 2421.................t.....244395
AB554017.1 HBV genotype B DNA, complete genome, isolate: NMB09010 2424.................t.....244695
AB554019.1 HBV genotype C DNA, complete genome, isolate: NMB09122 2424.................t.....244695
AB554020.1 HBV genotype C DNA, complete genome, isolate: NMB09124 2424.................t.....244695
AB554022.1 HBV genotype C DNA, complete genome, isolate: GRS08325 2424...................c...244695
AB554023.1 HBV genotype D DNA, complete genome, isolate: GRS08457 2421.................t.....244395
AB554024.1 HBV genotype D DNA, complete genome, isolate: GRS08538 2421.................t.....244395
HQ684848.1 Hepatitis B virus isolate HBVJSTZ1, complete genome 2424.................t.....244695
HQ236014.1 Hepatitis B virus isolate RS1, complete genome 2424.................t.....244695
JF412801.1 Hepatitis B virus isolate HBVJSTZ3, complete genome 2424.................t.....244695
AB583679.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8134 2424.................t.....244695
AB583680.1 Hepatitis B virus DNA, complete genome, isolate: Pkst7912 2424.................t.....244695
JF440017.1 Hepatitis B virus isolate FOL496, complete genome 599.................t.....62195
JF491447.1 Hepatitis B virus isolate QH-13, complete genome 2424.................t.....244695
JF491448.1 Hepatitis B virus isolate QH-29, complete genome 2424.................t.....244695
JF491449.1 Hepatitis B virus isolate QH-32, complete genome 2424.................t.....244695
JF491450.1 Hepatitis B virus isolate QH-33, complete genome 2424.................t.....244695
JF491451.1 Hepatitis B virus isolate QH-35, complete genome 2424.................t.....244695
JF491452.1 Hepatitis B virus isolate QH-53, complete genome 2424.................t.....244695
JF491453.1 Hepatitis B virus isolate QH-90, complete genome 2424.................t.....244695
JF491454.1 Hepatitis B virus isolate QH-79, complete genome 2424.................t.....244695
JF491455.1 Hepatitis B virus isolate Tibet-31, complete genome 2424.................t.....244695
JF491456.1 Hepatitis B virus isolate Tibet-53, complete genome 2424.................t.....244695
X04615.1 Hepatitis B virus genome, subtype ayr 2424.................t.....244695
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 2424...............r.t.....244691
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 2424..............s..t.....244691
AB073857.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry48 2424...................c.._244591
AY741797.1 Hepatitis B virus isolate IR-IPI-21, complete genome 2427_................t.....244891
AY741798.1 Hepatitis B virus isolate IR-IPI-P4, complete genome 2430_................t.....245191
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 2424.................t..m..244691
AJ627215.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 06115 2424.................t...._244591
AJ627216.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 17707 2424.................t...._244591
AJ627218.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21116 2424.................t...._244591
AM180624.1 Hepatitis B virus complete genome, isolate CAE168 2430................mt.....245291
DQ922651.1 Hepatitis B virus strain F0691, complete genome 2426.................t...._244791
DQ991753.2 Hepatitis B virus isolate Irish-13, complete genome 2181.................t...._220291
EU871974.1 Hepatitis B virus isolate 6-024A-1, complete genome 2424.................t...._244591
EU939541.1 Hepatitis B virus isolate C25, complete genome 2425_................t.....244691
EU939558.1 Hepatitis B virus isolate C66, complete genome 2394.................t...._241591
EU939562.1 Hepatitis B virus isolate C75, complete genome 2424.................t...._244591
EU939583.1 Hepatitis B virus isolate B31, complete genome 2382.................t...._240391
EU939605.1 Hepatitis B virus isolate C200, complete genome 2424.................t...._244591
EU939621.1 Hepatitis B virus isolate C94, complete genome 2424.................t...._244591
FJ023637.1 Hepatitis B virus isolate B5_M04-0013 S protein (S) and core protein 2424.....m...........t.....244691
FJ386630.1 Hepatitis B virus isolate 2336, complete genome 2424.................t...._244591
FN545825.1 Hepatitis B virus complete genome, strain 29137 2430..w..............t.....245291
FN545832.1 Hepatitis B virus complete genome, strain 42048 2430.................t..m..245291
AB555501.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA65 2424.................t...._244591
AY167094.1 Hepatitis B virus isolate IIb, complete genome 2424.................t..n..244691
D00329.1HPBADW1 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl2424.................t.c...244691
M32138.1HPBHBVAA Hepatitis B virus variant HBV-alpha1, complete genome 2426..a..............t.....244891
L27106.1HPBMUT Hepatitis B virus mutant complete genome 2429...............g.t.....245191
X75665.1 Human hepatitis virus (genotype C, HMA) preS1, preS2, S, C, X, antige2424.................t.c...244691
X75656.1 Human hepatitis virus (genotype C, Cha) preS1, preS2, S, C, X, antige2424.................t.c...244691
X52939.1 Hepatitis B virus genome with a pre X orf 2297.....a...........t.....231991
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 2419.................t.c...244191
D23677.1HPBA1HKK2 Hepatitis B virus (A1-HBVKK2) complete genome sequence 2416.................t.c...243891
D23679.1HPBA3HMS2 Hepatitis B virus (A3-HBVMS2) complete genome sequence 2424.................t.c...244691
S75184.1 S...preS2 [hepatitis B virus HBV, host=human plasma Nis 0859434, Geno2424...............g.t.....244691
X97848.1 Hepatitis B virus (patient 2) complete genome 2426............t....t.....244891
X97850.1 Hepatitis B virus (patient 4) complete genome 2426...............g.t.....244891
X98073.1 Hepatitis B virus complete genome with insertion in core promoter (no2435.................t..t..245791
X98072.1 Hepatitis B virus complete genome with insertion in core promoter 2435.................t..t..245791
X98074.1 Hepatitis B virus complete genome with insertion in core promoter, 762359.................t..t..238191
X98075.1 Hepatitis B virus complete genome with insertion in core promoter, 192633.................t..t..265591
X98076.1 Hepatitis B virus complete genome with insertion in core promoter, 332096.................t..t..211891
D28880.1 Hepatitis B virus DNA, complete genome, strain Fukuoka Red Cross HBV 2424...............g.t.....244691
AB014363.1 Hepatitis B virus genomic DNA, complete sequence, isolate 04D04HCC 2424...............g.t.....244691
AB014387.1 Hepatitis B virus genomic DNA, complete sequence, isolate 28Y10HCC 2379.................t..a..240191
AB014394.1 Hepatitis B virus genomic DNA, complete sequence, isolate 35Y17HCC 2424.....a...........t.....244691
AB014371.1 Hepatitis B virus genomic DNA, complete sequence, isolate 12D12HCC 2430...............g.t.....245291
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 2424.................t.c...244691
AB014383.1 Hepatitis B virus genomic DNA, complete sequence, isolate 24Y06HCC 2424.................t.c...244691
AB014384.1 Hepatitis B virus genomic DNA, complete sequence, isolate 25Y07HCC 2424.................t.c...244691
AB014386.1 Hepatitis B virus genomic DNA, complete sequence, isolate 27Y09HCC 2223...............g.t.....224591
AB014397.1 Hepatitis B virus genomic DNA, complete sequence, isolate 38Y20HCC 2394.....a...........t.....241691
AB014398.1 Hepatitis B virus genomic DNA, complete sequence, isolate 39Y21HCC 2376...............g.t.....239891
AF143302.1 Hepatitis B virus clone HD1402, complete genome 527.........t.......t.....54991
AF143303.1 Hepatitis B virus clone HD1406, complete genome 527.........t.......t.....54991
AF143308.1 Hepatitis B virus clone WB1254, complete genome 617.................t..t..63991
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 1057.................t.c...107991
AB033554.1 Hepatitis B virus DNA, complete genome, isolate:RTB299 2424.................t..a..244691
AB010290.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-2 2424.................t.c...244691
AB010291.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-3 2424.................t.c...244691
AF121239.1 Hepatitis B virus isolate HBV/1303, complete genome 2424...............g.t.....244691
AF121240.1 Hepatitis B virus isolate HBV/11066, complete genome 2424...............g.t.....244691
AF121241.1 Hepatitis B virus isolate HBV/1758, complete genome 2424...............g.t.....244691
AF121242.1 Hepatitis B virus isolate HBV/1218, complete genome 2424...............g.t.....244691
AF121248.1 Hepatitis B virus isolate HBV/139-1, complete genome 2424.................t..a..244691
AF121250.1 Hepatitis B virus isolate HBV/6395, complete genome 2424.....a...........t.....244691
AF241407.1 Hepatitis B virus isolate 11141, complete genome 2424.................t.c...244691
AF241408.1 Hepatitis B virus isolate 14118, complete genome 2424.................t.c...244691
AF241409.1 Hepatitis B virus isolate 6871, complete genome 2424.................t.c...244691
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 2424...............g.t.....244691
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 2424...............g.t.....244691
AB048704.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2424.................t.c...244691
AB048705.1 Hepatitis B virus DNA, complete genome, serotype:ayw 2424.................t.c...244691
AF363962.1 Hepatitis B virus strain G683-2, complete genome 604.................t..t..62691
AF363963.1 Hepatitis B virus strain G683-3, complete genome 604.................t..t..62691
AF461362.1 Hepatitis B virus isolate FH10, compete genome 2466.................t..t..248891
AF461043.1 Hepatitis B virus, complete genome 2424.................t.c...244691
AB073821.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi20 2424.................t..a..244691
AB073830.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH57 2424.................t..t..244691
AB073838.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ho7 2424.................t.c...244691
AB073839.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw174 2424.....a...........t.....244691
AB073846.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry565 2424.................t.c...244691
AB073848.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HUS 2424.................t.c...244691
AB073849.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na101 2424...........a.......c...244691
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 2424...............g.t.....244691
AF537371.1 Hepatitis B virus clone 3.4, complete genome 2430.................t...g.245291
AF537372.1 Hepatitis B virus clone 4B, complete genome 2430.....a...........t.....245291
AY161150.1 Hepatitis B virus clone S6.1 complete genome 2424.....a...........t.....244691
AY161151.1 Hepatitis B virus clone S6.2, complete genome 2424.....a...........t.....244691
AY161152.1 Hepatitis B virus clone S6.3, complete genome 2424.....a...........t.....244691
AY161153.1 Hepatitis B virus clone S6.4 complete genome 2424.....a...........t.....244691
AY161154.1 Hepatitis B virus clone S6.5, complete genome 2424.....a...........t.....244691
AY161155.1 Hepatitis B virus clone S6.6, complete genome 2424.....a...........t.....244691
AY161156.1 Hepatitis B virus clone S6.7, complete genome 2424.....a...........t.....244691
AY217374.1 Hepatitis B virus isolate 595, complete genome 2411.....a...........t.....243391
AY217355.1 Hepatitis B virus isolate A6-2, complete genome 2424.................t..t..244691
AY217356.1 Hepatitis B virus isolate A9-2, complete genome 2424.................t..t..244691
AY217361.1 Hepatitis B virus isolate 582-2, complete genome 2424.....a...........t.....244691
AY217362.1 Hepatitis B virus isolate 582-4, complete genome 2424.................t..t..244691
AY217363.1 Hepatitis B virus isolate 582-1, complete genome 2425.................t..t..244791
AY217364.1 Hepatitis B virus isolate 586, complete genome 2358.................t..t..238091
AY206373.1 Hepatitis B virus strain FMU002 complete genome 2274.................t..t..229691
AY206378.1 Hepatitis B virus strain FMU007 complete genome 2390...............g.t.....241291
AY206381.1 Hepatitis B virus strain FMU010 complete genome 2426.....a...........t.....244891
AY206386.1 Hepatitis B virus strain FMU015 complete genome 2426................gt.....244891
AY206390.1 Hepatitis B virus strain FMU019 complete genome 2426.................t..t..244891
AY206392.1 Hepatitis B virus strain FMU021 complete genome 2426..a..............t.....244891
AY220697.1 Hepatitis B virus strain GYF634, complete genome 2426.....a...........t.....244891
AY220699.1 Hepatitis B virus strain MH15, complete genome 2426.....a...........t.....244891
AY220700.1 Hepatitis B virus strain MH534978, complete genome 2426.....a...........t.....244891
AY220702.1 Hepatitis B virus strain WJQ650, complete genome 2426...............g.t.....244891
AY233293.1 Hepatitis B virus isolate 12 complete genome 2424...............g.t.....244691
AY167091.1 Hepatitis B virus isolate Ic, complete genome 2439.................t.c...246191
AY167092.1 Hepatitis B virus isolate Id, complete genome 2388.....a...........t.....241091
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 2424.....a...........t.....244691
AB105172.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 2 2424.................t.c...244691
AY236160.1 Hepatitis B virus isolate 1A, complete genome 604.....a...........t.....62691
AY236162.1 Hepatitis B virus isolate 23 A, complete genome 604...............g.t.....62691
AY236164.1 Hepatitis B virus isolate 30, complete genome 604.....a...........t.....62691
AB111113.1 Hepatitis B virus DNA, complete genome, clone: HS-6 2424.................t..t..244691
AB115418.1 Hepatitis B virus DNA, complete genome, with deletion in Pre-S2 2379.................t.c...240191
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 2424...............g.t.....244691
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 2430.................t..a..245291
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 2430.................t.c...245291
AY596103.1 Hepatitis B virus isolate Ia-2, complete genome 2424...............g.t.....244691
AY596105.1 Hepatitis B virus isolate Ia-5, complete genome 2424.................t..t..244691
AY596109.1 Hepatitis B virus isolate II-1, complete genome 2424.................t..t..244691
AY596111.1 Hepatitis B virus isolate Ia-3, complete genome 2424.................t.c...244691
AB120308.1 Hepatitis B virus DNA, complete genome, strain:Ehime-full 20:IM 820822424..a..............t.....244691
AB176643.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NK1 2380.....a...........t.....240291
AY741794.1 Hepatitis B virus isolate IR-IPI-50, complete genome 2426...............g.t.....244891
AY641563.1 Hepatitis B virus isolate He52, complete genome 2424.....a...........t.....244691
AB113877.1 Hepatitis B virus DNA, complete genome, strain:HCC-3-TT 2424.................t..t..244691
AY902768.1 Hepatitis B virus isolate MTB166, complete genome 2423......gg...............244591
AY902769.1 Hepatitis B virus isolate MTB009, complete genome 2423......gg...............244591
AY902770.1 Hepatitis B virus isolate MTB012, complete genome 2423......gg...............244591
AY902772.1 Hepatitis B virus isolate MTB158, complete genome 2423......gg...............244591
AY902773.1 Hepatitis B virus isolate MTB159, complete genome 2423......gg...............244591
AY902774.1 Hepatitis B virus isolate MTB160, complete genome 2423......gg...............244591
AY902776.1 Hepatitis B virus isolate MTB163, complete genome 2423......gg...............244591
AY902777.1 Hepatitis B virus isolate MTB004, complete genome 2423......gg...............244591
AB205121.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF720-1 2427.................t.c...244991
AY903452.1 Hepatitis B virus serotype adw2, complete genome 2424.....a...........t.....244691
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 2391.................t.c...241391
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 2424...............g.t.....244691
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 2424...............g.t.....244691
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 2424..............c..t.....244691
DQ089771.1 Hepatitis B virus isolate HK1629, complete genome 2424...............g.t.....244691
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 2424.................t.c...244691
DQ089780.1 Hepatitis B virus isolate HK947, complete genome 2424..a..............t.....244691
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 2424.......g.........t.....244691
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 2424.................t.c...244691
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 2424...............g.t.....244691
DQ089804.1 Hepatitis B virus isolate HK262, complete genome 2424.................t.c...244691
AY862866.1 Hepatitis B virus clone Q312, complete genome 2426............a....t.....244891
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 2424.................t.c...244691
AB119252.1 Hepatitis B virus DNA, complete genome, strain:Ehime14:BD No7,20020822424..a..............t.....244691
AB119253.1 Hepatitis B virus DNA, complete genome, strain:Ehime15:BD No27,H12.012424..a..............t.....244691
AB119256.1 Hepatitis B virus DNA, complete genome, strain:Ehime18:Iyo 529246 2424.................t.c...244691
DQ304547.1 Hepatitis B virus isolate LT4 clone 1, complete genome 604...............g.t.....62691
DQ304548.1 Hepatitis B virus isolate LT4 clone 2, complete genome 604...............g.t.....62691
DQ304549.1 Hepatitis B virus isolate LT4 clone 3, complete genome 604...............g.t.....62691
DQ304550.1 Hepatitis B virus isolate LT4 clone 4, complete genome 604...............g.t.....62691
DQ304551.1 Hepatitis B virus isolate LT4 clone 5, complete genome 604...............g.t.....62691
DQ329356.1 Hepatitis B virus isolate LT1 clone 1, complete genome 599.....a...........t.....62191
DQ329357.1 Hepatitis B virus isolate LT1 clone 2, complete genome 599.....a...........t.....62191
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 2403.....a...........t.....242591
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 2424..............a..t.....244691
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 2430.................t..t..245291
AB210818.1 Hepatitis B virus DNA, complete genome, strain:Ehime 21-NM 2424.......g.........t.....244691
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 2424.................t.c...244691
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 2424.................t.c...244691
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 2424.................t.c...244691
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 2424.................t.c...244691
DQ478900.1 Hepatitis B virus isolate CHN-H172, complete genome 2424.................tt....244691
DQ486021.1 Hepatitis B virus isolate LT13, complete genome 604.....a...........t.....62691
DQ486022.1 Hepatitis B virus isolate LT11, complete genome 604.....a...........t.....62691
DQ486025.1 Hepatitis B virus isolate LT12, complete genome 604..a..............t.....62691
DQ788725.1 Hepatitis B virus clone S1, complete genome 2430..a..............t.....245291
DQ788726.1 Hepatitis B virus clone S15, complete genome 2324.........t.......t.....234691
DQ788727.1 Hepatitis B virus clone S18, complete genome 2345.........t.......t.....236791
DQ788728.1 Hepatitis B virus clone S24, complete genome 2334.........t.......t.....235691
DQ788729.1 Hepatitis B virus clone L1, complete genome 2345.........t.......t.....236791
DQ922649.1 Hepatitis B virus strain B0024, complete genome 2426..............a..t.....244891
DQ975272.1 Hepatitis B virus strain C1248, complete genome 2426.................t.c...244891
DQ975274.1 Hepatitis B virus strain F0885, complete genome 2426....c............t.....244891
AB246341.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN35 2424.................t.c...244691
AB246342.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN56 2424.................t.c...244691
AB246343.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN57 2424.................t.c...244691
AB270539.1 Hepatitis B virus DNA, complete genome, isolate: MGL200F 2424.....a...........t.....244691
AB270540.1 Hepatitis B virus DNA, complete genome, isolate: MGL241F 2403...........a.......c...242591
AB270541.1 Hepatitis B virus DNA, complete genome, isolate: MGL47F 2424...............g.t.....244691
EF103283.1 Hepatitis B virus isolate Ran105, complete genome 2424.....a...........t.....244691
EF103285.1 Hepatitis B virus isolate Ran128, complete genome 2424..a..............t.....244691
EF137803.1 Hepatitis B virus strain JH4-1896-A, complete genome 2424.....a...........t.....244691
AB195945.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-1 2424..............c..t.....244691
DQ993682.1 Hepatitis B virus isolate patient 479, complete genome 2424.................g..t..244691
DQ993685.1 Hepatitis B virus isolate patient 554, complete genome 2424...........g.....t.....244691
DQ993711.1 Hepatitis B virus isolate 221-1120-Nature1.1-unSero, complete genome 2424................ct.....244691
AB302095.1 Hepatitis B virus DNA, complete genome, clone: Bj_39 2424.................t.c...244691
EF494380.1 Hepatitis B virus isolate TW836 genotype B, complete genome 2424...........a.....t.....244691
EF494382.1 Hepatitis B virus isolate TWD347 genotype B, complete genome 2417................ct.....243991
AB300361.1 Hepatitis B virus DNA, complete genome, isolate: patient3 2424..a..............t.....244691
AB300369.1 Hepatitis B virus DNA, complete genome, isolate: patient11 2424..a..............t.....244691
AB300370.1 Hepatitis B virus DNA, complete genome, isolate: patient12 2367...........a.......c...238991
AB300371.1 Hepatitis B virus DNA, complete genome, isolate: patient13 2436.................t.c...245891
AB368295.1 Hepatitis B virus DNA, complete genome, Genotype B, Subgenotype B4, c2424.....a...........t.....244691
AB368296.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c2424................gt.....244691
AB287314.1 Hepatitis B virus DNA, complete genome, isolate: Alaska433 2424.................t.c...244691
AB287315.1 Hepatitis B virus DNA, complete genome, isolate: Alaska419 2424.................t.c...244691
AB287316.1 Hepatitis B virus DNA, complete genome, isolate: Alaska427 2424.................t.c...244691
AB287317.1 Hepatitis B virus DNA, complete genome, isolate: Alaska416 2424.................t.c...244691
AB287318.1 Hepatitis B virus DNA, complete genome, isolate: Alaska2 2424.................t.c...244691
AB287321.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-2 2424...............g...c...244691
AB287324.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-5 2424.................t.c...244691
AB287327.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A53 2424.................t.c...244691
AB330371.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ23H2430.................t..t..245291
EU158263.1 Hepatitis B virus isolate G108, complete genome 2424.................t.c...244691
EU306670.1 Hepatitis B virus clone 110-33, complete genome 2400.....a...........t.....242291
EU306724.1 Hepatitis B virus clone 6022-2-, complete genome 2424.................t..t..244691
EU306726.1 Hepatitis B virus clone 6022-12-, complete genome 2424.................t..t..244691
EU306728.1 Hepatitis B virus clone 6022-43, complete genome 2424.................t..t..244691
EU439008.1 Hepatitis B virus clone 6023-27 from China, complete genome 2439.................t..t..246191
AB365452.1 Hepatitis B virus DNA, complete genome, isolate: BOL577 2425.................t.c...244791
EU547561.1 Hepatitis B virus isolate MC04, complete genome 2425...............g.t.....244791
EU439009.1 Hepatitis B virus clone 6023-33 from China, complete genome 2377.................t..t..239991
EU554540.1 Hepatitis B virus isolate S304-10, complete genome 2424.....a...........t.....244691
EU560438.1 Hepatitis B virus isolate 2-B74, complete genome 2424...............g.t.....244691
EU560439.1 Hepatitis B virus isolate 7-B74, complete genome 2424.....a...........t.....244691
EU570072.1 Hepatitis B virus isolate 1-B74, complete genome 2424.....a...........t.....244691
EU747320.1 Hepatitis B virus isolate V51, complete genome 2430.................t..t..245291
EU717211.1 Hepatitis B virus isolate D23K-6, complete genome 2426...............g.t.....244891
EU796066.1 Hepatitis B virus strain 0477, complete genome 2424...............g.t.....244691
EU796069.1 Hepatitis B virus strain 4364, complete genome 2424.....a...........t.....244691
EU796071.1 Hepatitis B virus strain 5051, complete genome 2424.....a...........t.....244691
EU871978.1 Hepatitis B virus isolate 252-95-2, complete genome 2424.................t..t..244691
EU871979.1 Hepatitis B virus isolate 252-95-4, complete genome 2424.................t..t..244691
EU872000.1 Hepatitis B virus isolate 530-92-2, complete genome 2424..a..............t.....244691
EU872001.1 Hepatitis B virus isolate 530-92-8, complete genome 2424..a..............t.....244691
EU872002.1 Hepatitis B virus isolate 530-97-1, complete genome 2424..a..............t.....244691
EU872003.1 Hepatitis B virus isolate 530-97-2, complete genome 2424..a..............t.....244691
EU872004.1 Hepatitis B virus isolate 530-97-3, complete genome 2424..a..............t.....244691
EU872005.1 Hepatitis B virus isolate 179-96-1, complete genome 2366..............c..t.....238891
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 2430.....a...........t.....245291
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 2430.....a...........t.....245291
EU872013.1 Hepatitis B virus isolate 318-99-6, complete genome 2409.....a...........t.....243191
EU594404.1 Hepatitis B virus strain 1901-98, complete genome 2424...........a.....t.....244691
EU787443.1 Hepatitis B virus isolate w40, complete genome 2424...............g.t.....244691
AB453982.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH4 2430.................t..a..245291
EU921419.1 Hepatitis B virus isolate 22.252.07, complete genome 2421.................t.c...244391
EU939546.1 Hepatitis B virus isolate C44, complete genome 2424.....a...........t.....244691
EU939551.1 Hepatitis B virus isolate C56, complete genome 2424.....a...........t.....244691
EU939555.1 Hepatitis B virus isolate C63, complete genome 2424.................t..t..244691
EU939556.1 Hepatitis B virus isolate C64, complete genome 2415...............g.t.....243791
EU939559.1 Hepatitis B virus isolate C67, complete genome 2424.................t..a..244691
EU939566.1 Hepatitis B virus isolate C88, complete genome 2424.................t..a..244691
EU939569.1 Hepatitis B virus isolate C102, complete genome 2424...............g.t.....244691
EU939585.1 Hepatitis B virus isolate B126, complete genome 2424.....a...........t.....244691
EU939596.1 Hepatitis B virus isolate C149, complete genome 2424..............c..t.....244691
EU939601.1 Hepatitis B virus isolate C177, complete genome 2424.....a...........t.....244691
EU939602.1 Hepatitis B virus isolate C179, complete genome 2424.................t..t..244691
EU939616.1 Hepatitis B virus isolate C228, complete genome 2424.................t..t..244691
EU939620.1 Hepatitis B virus isolate B140, complete genome 2424.................t..a..244691
EU939631.1 Hepatitis B virus isolate C123, complete genome 2424.................t..t..244691
EU939632.1 Hepatitis B virus isolate C130, complete genome 2407.................t..t..242991
EU939637.1 Hepatitis B virus isolate C13, complete genome 2424..............c..t.....244691
EU939645.1 Hepatitis B virus isolate D38, complete genome 2424.................t..t..244691
EU939646.1 Hepatitis B virus isolate D88, complete genome 2424.................t..t..244691
EU939648.1 Hepatitis B virus isolate D96, complete genome 2424..a..............t.....244691
EU939649.1 Hepatitis B virus isolate D98, complete genome 2424.................t..t..244691
EU939654.1 Hepatitis B virus isolate D115, complete genome 2424.................t..t..244691
EU939659.1 Hepatitis B virus isolate D165, complete genome 2424...............g.t.....244691
EU939660.1 Hepatitis B virus isolate C34, complete genome 2397.....a...........t.....241991
EU939661.1 Hepatitis B virus isolate C40, complete genome 2424..a..............t.....244691
EU939664.1 Hepatitis B virus isolate C85, complete genome 2424.................t..t..244691
EU939667.1 Hepatitis B virus isolate C171, complete genome 2424...............g.t.....244691
EU939668.1 Hepatitis B virus isolate C182, complete genome 2424.....a...........t.....244691
EU939670.1 Hepatitis B virus isolate C189, complete genome 2424...............g.t.....244691
EU939672.1 Hepatitis B virus isolate C215, complete genome 2424.....a...........t.....244691
EU939674.1 Hepatitis B virus isolate C232, complete genome 2424..a..............t.....244691
EU366129.2 Hepatitis B virus isolate BA92, complete genome 2430.....a...........t.....245291
AB367405.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 14/Adefovir2376..a..............t.....239891
AB367407.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 16/Adefovir2424.................t.c...244691
AB367421.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 30, derived2424................ct.....244691
AB367422.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 31/Adefovir2424.................t.c...244691
AB367427.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 36/Adefovir2424...............g.t.....244691
AB367431.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 40, derived2424...............g.t.....244691
AB367800.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 24 2424.................t.c...244691
AB367804.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 6 2424...............g.t.....244691
FJ032334.1 Hepatitis B virus isolate S445-3 from China, complete genome 2424..a..............t.....244691
FJ032335.1 Hepatitis B virus isolate S459-2 from China, complete genome 2423.....a...........t.....244591
FJ032342.1 Hepatitis B virus isolate S659-2 from China, complete genome 2424.................t.c...244691
FJ032343.1 Hepatitis B virus isolate S659-4 from China, complete genome 2418.................t.c...244091
FJ023659.1 Hepatitis B virus isolate I1_M04-0469, complete genome 2424.................t.c...244691
FJ023660.1 Hepatitis B virus isolate I1_M04-3692, complete genome 2424.................t.c...244691
FJ023661.1 Hepatitis B virus isolate I1_M05-0592, complete genome 2424.................t.c...244691
FJ023663.1 Hepatitis B virus isolate I1_M04-3979, complete genome 2424.................t.c...244691
FJ023664.1 Hepatitis B virus isolate I2_M04-0026, complete genome 2424.................t.c...244691
FJ023667.1 Hepatitis B virus isolate I2_M04-2742, complete genome 2424.................t.c...244691
FJ023669.1 Hepatitis B virus isolate I2_M04-3665, complete genome 2424.................t.c...244691
FJ023670.1 Hepatitis B virus isolate I2_M04-3724, complete genome 2424.................t.c...244691
FJ023671.1 Hepatitis B virus isolate I2_M04-3733, complete genome 2424.................t.c...244691
FJ023673.1 Hepatitis B virus isolate I2_M04-4997, complete genome 2424.................t.c...244691
FJ023676.1 Hepatitis B virus isolate I1/I2_M04-2531 S protein (S) and core prote2424.................t.c...244691
FJ023646.1 Hepatitis B virus isolate C2_M04-0201 S protein (S) and core protein 2424.......g.........t.....244691
FJ386592.1 Hepatitis B virus isolate 1870, complete genome 2424.................t..t..244691
FJ386593.1 Hepatitis B virus isolate 1877, complete genome 2406...............g.t.....242891
FJ386600.1 Hepatitis B virus isolate 1893, complete genome 2424.....a...........t.....244691
FJ386617.1 Hepatitis B virus isolate 2093, complete genome 2424.....a...........t.....244691
FJ386621.1 Hepatitis B virus isolate 2123, complete genome 2424.................t..t..244691
FJ386622.1 Hepatitis B virus isolate 2135, complete genome 2424...............g.t.....244691
FJ386646.1 Hepatitis B virus isolate 1716, complete genome 2424.................t..t..244691
FJ386652.1 Hepatitis B virus isolate 2518, complete genome 2424.....a...........t.....244691
FJ386660.1 Hepatitis B virus isolate S221, complete genome 2424.................t.c...244691
FJ386661.1 Hepatitis B virus isolate S251, complete genome 2424................ct.....244691
FJ386669.1 Hepatitis B virus isolate S411, complete genome 2424.....a...........t.....244691
FJ386670.1 Hepatitis B virus isolate S454, complete genome 2424..a..............t.....244691
FJ386673.1 Hepatitis B virus isolate S633, complete genome 2424.....a...........t.....244691
FJ386674.1 Hepatitis B virus isolate S659, complete genome 2424.................t.c...244691
FJ386679.1 Hepatitis B virus isolate S1217, complete genome 2424...............g.t.....244691
FJ386680.1 Hepatitis B virus isolate S1244, complete genome 2424.................t...g.244691
FJ386681.1 Hepatitis B virus isolate S1336, complete genome 2424..a..............t.....244691
FJ386682.1 Hepatitis B virus isolate S1416, complete genome 2424.................t..t..244691
FJ386683.1 Hepatitis B virus isolate S1450, complete genome 2424..a..............t.....244691
EU835241.1 Hepatitis B virus isolate IND-DIB24, complete genome 2424.................t.c...244691
FJ518811.1 Hepatitis B virus strain ZXJ, complete genome 2419.................t..t..244191
FJ787438.1 Hepatitis B virus isolate S129-8, complete genome 2425.................t..t..244791
FJ787440.1 Hepatitis B virus isolate S157-6, complete genome 2401.................t..t..242391
FJ787449.1 Hepatitis B virus isolate S567-3, complete genome 2424................ct.....244691
FJ787451.1 Hepatitis B virus isolate S627-3, complete genome 2424.................t..t..244691
FJ787452.1 Hepatitis B virus isolate S955-2, complete genome 2424.................t...g.244691
FJ787457.1 Hepatitis B virus isolate S1248-4, complete genome 2424.................tt....244691
FJ787459.1 Hepatitis B virus isolate S1348-1, complete genome 2424.................t..t..244691
FJ787460.1 Hepatitis B virus isolate S1348-4, complete genome 2416.................t..t..243891
FJ787472.1 Hepatitis B virus isolate S1732-1, complete genome 2416.....a...........t.....243891
FJ787475.1 Hepatitis B virus isolate CX-2, complete genome 2427.....a...........t.....244991
FJ787476.1 Hepatitis B virus isolate CX-3, complete genome 2424.....a...........t.....244691
FJ787482.1 Hepatitis B virus isolate S1158-7, complete genome 2394...............g.t.....241691
FJ787483.1 Hepatitis B virus isolate S1158-8, complete genome 2394...............g.t.....241691
FJ787484.1 Hepatitis B virus isolate S1348-3, complete genome 2424.................t..t..244691
FJ787485.1 Hepatitis B virus isolate S1656-8, complete genome 2394...............g.t.....241691
FJ787487.1 Hepatitis B virus isolate DMY-1, complete genome 2373...............g.t.....239591
FJ787488.1 Hepatitis B virus isolate DMY-5, complete genome 2370...............g.t.....239291
FJ787489.1 Hepatitis B virus isolate DMY-6, complete genome 2370...............g.t.....239291
AB493830.1 Hepatitis B virus DNA, complete genome, isolate: P41 2427......t..........t.....244991
AB493836.1 Hepatitis B virus DNA, complete genome, isolate: P57 2425......t..........t.....244791
AB493837.1 Hepatitis B virus DNA, complete genome, isolate: 03UC 2424.................t.c...244691
AB493838.1 Hepatitis B virus DNA, complete genome, isolate: 06UC 2424.................t.c...244691
AB493839.1 Hepatitis B virus DNA, complete genome, isolate: 08UC 2328.................t.c...235091
AB493840.1 Hepatitis B virus DNA, complete genome, isolate: 16UC 2424.................t.c...244691
AB493841.1 Hepatitis B virus DNA, complete genome, isolate: 29UC 2423.................t.c...244591
AB493845.1 Hepatitis B virus DNA, complete genome, isolate: 07UC 2402.....a...........t.....242491
AB493847.1 Hepatitis B virus DNA, complete genome, isolate: 05UC 2424.................t.c...244691
AB493848.1 Hepatitis B virus DNA, complete genome, isolate: P7 2400.....a...........t.....242291
AP011094.1 Hepatitis B virus DNA, complete genome, strain: B0503102(DIL)F 2424.....a...........t.....244691
AP011102.1 Hepatitis B virus DNA, complete genome, strain: C0610090(BIK)F 2424.................t.c...244691
AP011103.1 Hepatitis B virus DNA, complete genome, strain: C0610316(JYP)F 2424.................t.c...244691
GQ227693.1 Hepatitis B virus isolate Z31-1, complete genome 2424................gt.....244691
FJ899761.1 Hepatitis B virus isolate C9-1, complete genome 2424...............g.t.....244691
FJ899765.1 Hepatitis B virus isolate C9-13, complete genome 2424...............g.t.....244691
FJ899768.1 Hepatitis B virus isolate C56-7, complete genome 2424.....a...........t.....244691
FJ899784.1 Hepatitis B virus isolate C215-3, complete genome 2424.....a...........t.....244691
FJ899785.1 Hepatitis B virus isolate C215-5, complete genome 2424.....a...........t.....244691
FJ899786.1 Hepatitis B virus isolate C215-7, complete genome 2424.....a...........t.....244691
FJ899787.1 Hepatitis B virus isolate C215-9, complete genome 2424.....a...........t.....244691
FJ899788.1 Hepatitis B virus isolate C226-1, complete genome 2424.....a...........t.....244691
FJ899789.1 Hepatitis B virus isolate C226-3, complete genome 2424.....a...........t.....244691
FJ899790.1 Hepatitis B virus isolate C232-2, complete genome 2424..a..............t.....244691
FJ899791.1 Hepatitis B virus isolate C232-6, complete genome 2424..a..............t.....244691
FJ899795.1 Hepatitis B virus isolate C122-9, complete genome 2369.................t..t..239191
AB485809.1 Hepatitis B virus DNA, complete genome, isolate: FEP1 2403...............g.t.....242591
AB485810.1 Hepatitis B virus DNA, complete genome, isolate: FEP2 2424...............g.t.....244691
GQ377521.1 Hepatitis B virus isolate J19, complete genome 2424..a..............t.....244691
GQ377550.1 Hepatitis B virus isolate J81, complete genome 2424.................t..t..244691
GQ377567.1 Hepatitis B virus isolate J102, complete genome 2424.................t..t..244691
GQ377607.1 Hepatitis B virus isolate J172, complete genome 2424.................t..a..244691
GQ377609.1 Hepatitis B virus isolate J176, complete genome 2424.................t.c...244691
GQ377611.1 Hepatitis B virus isolate J179, complete genome 2424..a..............t.....244691
GQ377620.1 Hepatitis B virus isolate J197, complete genome 2424.................t.c...244691
GQ377621.1 Hepatitis B virus isolate J206, complete genome 2424.................t..t..244691
GQ377622.1 Hepatitis B virus isolate J207, complete genome 2424.....a...........t.....244691
GQ475325.1 Hepatitis B virus isolate KOR21LC, complete genome 2418.....a...........t.....244091
GU357844.1 Hepatitis B virus isolate W29, complete genome 2424.................t.c...244691
GU357845.1 Hepatitis B virus isolate Y1021, complete genome 2424.................t..t..244691
FN545839.1 Hepatitis B virus complete genome, strain 42266 2376.....a...........t.....239891
HM153811.1 Hepatitis B virus, complete genome 2424.................t..t..244691
FR714490.1 Hepatitis B virus complete genome, isolate DL706, X/C recombinant 2424.................t.c...244691
FR714491.1 Hepatitis B virus complete genome, isolate GM012, X/C recombinant 2424.................t.c...244691
FR714492.1 Hepatitis B virus complete genome, isolate GY235, X/C recombinant 2424.................t.c...244691
FR714493.1 Hepatitis B virus complete genome, isolate NA167, X/C recombinant 2424.................t.c...244691
FR714496.1 Hepatitis B virus complete genome, isolate QL523, X/C recombinant 2424.................t.c...244691
FR714499.1 Hepatitis B virus complete genome, isolate TF051, X/C recombinant 2424.................t.c...244691
FR714500.1 Hepatitis B virus complete genome, isolate TX164, X/C recombinant 2424.................t.c...244691
FR714501.1 Hepatitis B virus complete genome, isolate TX327, X/C recombinant 2424.................t.c...244691
FR714502.1 Hepatitis B virus complete genome, isolate TZ087, X/C recombinant 2424.................t.c...244691
FR714504.1 Hepatitis B virus complete genome, isolate WL339, X/C recombinant 2424.................t.c...244691
FR714506.1 Hepatitis B virus complete genome, isolate YL204, X/C recombinant 2424.................t.c...244691
AB560661.1 HBV genotype C DNA, complete genome, isolate: 58PU 2424.................t.c...244691
AB560662.1 HBV genotype C DNA, complete genome, isolate: 60PU 2424.................t.c...244691
AB554014.1 HBV genotype C DNA, complete genome, isolate: TRF08029 2424.................t.c...244691
AB554015.1 HBV genotype C DNA, complete genome, isolate: TRF08111 2424.................t.c...244691
AB554018.1 HBV genotype C DNA, complete genome, isolate: NMB09075 2424.................t.c...244691
AB554021.1 HBV genotype C DNA, complete genome, isolate: GRS08298 2424.................t.c...244691
AB554025.1 HBV genotype C DNA, complete genome, isolate: MRK89073 2424.................t.c...244691
AB562462.1 Hepatitis B virus DNA, complete genome, isolate: HPA184_07 2424.................t.c...244691
AB562463.1 Hepatitis B virus DNA, complete genome, isolate: HPC017_07 2424.................t.c...244691
HQ236015.1 Hepatitis B virus isolate RS2, complete genome 2424.................t..a..244691
HQ236016.1 Hepatitis B virus isolate RS3, complete genome 2424.................t..a..244691
AB583681.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8216 2424.....a...........t.....244691
HQ231877.1 Hepatitis B virus isolate B3-1, complete genome 2424.................t.c...244691
HQ231878.1 Hepatitis B virus isolate B3-2, complete genome 2424.................t.c...244691
HQ231879.1 Hepatitis B virus isolate B3-4, complete genome 2424.................t.c...244691
HQ231880.1 Hepatitis B virus isolate B3-5, complete genome 2424.................t.c...244691
HQ231881.1 Hepatitis B virus isolate B3-6, complete genome 2424.................t.c...244691
HQ231882.1 Hepatitis B virus isolate B3-7, complete genome 2424.................t.c...244691
HQ231883.1 Hepatitis B virus isolate B3-8, complete genome 2424.................t.c...244691
HQ231884.1 Hepatitis B virus isolate B3-9, complete genome 2424.................t.c...244691
HQ231885.1 Hepatitis B virus isolate B3-10, complete genome 2424.................t.c...244691
AB602818.1 HBV genotype B DNA, complete genome, isolate: AH-2 2424.................t.c...244691
EU787444.1 Hepatitis B virus isolate W41, complete genome 2424.................t...__244486
AY741795.1 Hepatitis B virus isolate IR-IPI-Hi, complete genome 2427_..............g.t.....244886
AY741796.1 Hepatitis B virus isolate IR-IPI-P3, complete genome 2427_..............g.t.....244886
AB555496.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA31 2424.................t..___244382
Z72479.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes2425..a..............t.c...244786
D50521.1 Hepatitis B virus clone HBV-ASA-FH1 genomic DNA, complete sequence 2424......gg...a...........244686
D50522.1 Hepatitis B virus clone HBV-ASA-FH2 genomic DNA, complete sequence 2424......gg...a...........244686
AB010292.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-4 2424.................t.ct..244686
AB073842.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw11 2424.................t.ct..244686
AB073855.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry34 2424.................t.ct..244686
AY163869.1 Hepatitis B virus isolate FMClx-1, complete genome 2426.................tg.t..244886
AY163870.1 Hepatitis B virus isolate FMU001, complete genome 2426.................tg.t..244886
AY161158.1 Hepatitis B virus clone S7.2 complete genome 2424..g..a...........t.....244686
AY238972.1 Hepatitis B virus defective isolate FMU023, complete genome 1577.................t.ct..159986
AY206387.1 Hepatitis B virus strain FMU016 complete genome 2364.................t.ct..238686
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 2424.....a..........ct.....244686
DQ089785.1 Hepatitis B virus isolate HK1386, complete genome 2424..a..............t.c...244686
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 610...............g.t.c...63286
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 610...............g.t.c...63286
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 610...............g.t.c...63286
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 610...............g.t.c...63286
DQ463793.1 Hepatitis B virus isolate 462-4_1979, complete genome 2424.................t.ct..244686
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 2424...............g.t.c...244686
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 2424.................t.ct..244686
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 2400............c._________241356
DQ995802.1 Hepatitis B virus isolate H293-16, complete genome 2424.....a..........ct.....244686
EF494377.1 Hepatitis B virus isolate TW1138 genotype C, complete genome 2391...............g.t.c...241386
EF494378.1 Hepatitis B virus isolate TW1244 genotype C, complete genome 2424.....a.g.........t.....244686
AB287320.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-1 2424...............g.t.c...244686
AB330372.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ22H2430......c..........t..t..245286
EU306725.1 Hepatitis B virus clone 6022-17, complete genome 2481...............ggt.....250386
EU547558.1 Hepatitis B virus isolate MC01, complete genome 2425......gg.........t.....244786
EU547562.1 Hepatitis B virus isolate MC05, complete genome 2424.................t.ca..244686
EU570073.1 Hepatitis B virus isolate 8-S698, complete genome 2424..a.............ct.....244686
EU570074.1 Hepatitis B virus isolate 11-S698, complete genome 2424..a.............ct.....244686
EU570075.1 Hepatitis B virus isolate 11-S142, complete genome 2424......gg.........t.....244686
EU589335.1 Hepatitis B virus isolate S142-5, complete genome 2424......gg.........t.....244686
EU939599.1 Hepatitis B virus isolate C172, complete genome 2421.................t.ca..244386
EU939623.1 Hepatitis B virus isolate C126, complete genome 2424.....a..........ct.....244686
EU939624.1 Hepatitis B virus isolate C138, complete genome 2388.....ac..........t.....241086
EU939636.1 Hepatitis B virus isolate C11, complete genome 2424.....a...........t.c...244686
AB367401.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 10/Adefovir2424.................t.ca..244686
AB367429.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 38, derived2385.................t.ca..240786
AB367433.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 42/Adefovir2370......gg.........t.....239286
FJ032344.1 Hepatitis B virus isolate S659-5 from China, complete genome 2424......gg.........t.....244686
FJ023665.1 Hepatitis B virus isolate I2_M04-0033, complete genome 2424...............g.t.c...244686
FJ023675.1 Hepatitis B virus isolate I1/I2_M04-3739 S protein (S) and core prote2424.................t.ct..244686
FJ386608.1 Hepatitis B virus isolate 1998, complete genome 2424.................t.ca..244686
FJ386648.1 Hepatitis B virus isolate 2419, complete genome 2424.....a..........tt.....244686
FJ386656.1 Hepatitis B virus isolate S142, complete genome 2424......gg.........t.....244686
EU835242.1 Hepatitis B virus isolate IND-DIB30, complete genome 2424..a..............t.c...244686
GQ167301.1 Hepatitis B virus isolate ZADGM452, complete genome 2430.....a..........ct.....245286
GQ167302.1 Hepatitis B virus isolate ZADGM4521, complete genome 2430.....a..........ct.....245286
GQ184322.1 Hepatitis B virus isolate ZADGM4522, complete genome 2430.....a..........ct.....245286
FJ899793.1 Hepatitis B virus isolate C122-2, complete genome 2369.................t.ct..239186
FJ899794.1 Hepatitis B virus isolate C122-3, complete genome 2369.................t.ct..239186
GQ377586.1 Hepatitis B virus isolate J135, complete genome 2424...............g.t.c...244686
AB555499.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA62 2436.................t.ct..245886
AB555500.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA64 2424................cg.c...244686
FR714495.1 Hepatitis B virus complete genome, isolate QB062, X/C recombinant 2424..a..............t.c...244686
AB270550.1 Hepatitis B virus DNA, complete genome, isolate: MGL247F 2424.................t.____244278
AB073858.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Shin 2424...........a...g.t.c...244682
DQ993695.1 Hepatitis B virus isolate patient 373, complete genome 2430______...........t.....244669
EU872016.1 Hepatitis B virus isolate 490A-1, complete genome 2429______...........t.....244569
AY781177.1 Hepatitis B virus strain BG21, complete genome 2424............ca.ct..c...244678
AY781178.1 Hepatitis B virus strain G12, complete genome 2424............ca.ct..c...244678
AY781179.1 Hepatitis B virus strain GIII_14, complete genome 2424............ca.ct..c...244678
AY781180.1 Hepatitis B virus strain GIII_15, complete genome 2424............ca.ct..c...244678
AY781181.1 Hepatitis B virus strain GIII_16, complete genome 2424............ca.ct..c...244678
AY781182.1 Hepatitis B virus strain GIII_17, complete genome 2424............ca.ct..c...244678
X69798.1 Hepatitis B virus, subtype adw4 genes 2424............ca.ctt.c...244673
X75657.1 Human hepatitis virus (genotype E, Bas) preS1, preS2, S, C, X, antige2424............ca.ctt.c...244673
X75664.1 Human hepatitis virus (genotype E, Kou) preS1, preS2, S, C, X, antige2424............ca.ctt.c...244673
X75663.1 Human hepatitis virus (genotype F, 9203) preS1, preS2, S, C, X, and P2424............ca.ctt.c...244673
X75658.1 Human hepatitis virus (genotype F, Fou) preS1, preS2, S, C, X, antige2424............ca.ctt.c...244673
U46935.1HBU46935 Hepatitis B virus complete genome 2424............ca.ctt.c...244673
AJ131567.1 Hepatitis B virus complete genome, isolate gor97 611............ca.ctt.c...63373
AJ131568.1 Hepatitis B virus complete genome, isolate gib824 611............ca.ctt.c...63373
AJ131569.1 Hepatitis B virus complete genome, isolate gib759 611............ca.ctt.c...63373
AJ131571.1 Hepatitis B virus complete genome, isolate gib645 611............ca.ctt.c...63373
AJ131572.1 Hepatitis B virus complete genome, isolate gib160 611............ca.ctt.c...63373
AJ131573.1 Hepatitis B virus complete genome, isolate gib153 611............ca.ctt.c...63373
AJ131575.1 Hepatitis B virus complete genome, isolate chimp82 611............ca.ctt.c...63373
AJ131570.1 Hepatitis B virus complete genome, isolate gib731 375............ca.ctt.a...39773
AJ131574.1 Hepatitis B virus complete genome, isolate gib151 611............ca.ctt.c...63373
AB032431.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV/E-Ch1952424............ca.ctt.c...244673
AB032432.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch2562424............ca.ctt.c...244673
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch2582424............ca.ctt.c...244673
AF193863.1 Orangutan hepadnavirus strain Somad, complete genome 2424............ca.ctt.c...244673
AF193864.1 Orangutan hepadnavirus strain Papa, complete genome 2424............ca.ctt.c...244673
AF222322.1 Hepatitis B virus isolate CH109, complete genome 2426............ca.ctt.c...244873
AF222323.1 Hepatitis B virus isolate CH926, complete genome 2426............ca.ctt.c...244873
AF242585.1 Hepatitis B virus isolate CHIMP_2, complete genome 2424............ca.ctt.c...244673
AF242586.1 Hepatitis B virus isolate CHIMP_4, complete genome 2424............ca.ctt.c...244673
AB046525.1 Hepatitis B virus genomic DNA, complete sequence, isolate:PttHBV-ChBa2391............ca.ctt.c...241373
AB036905.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-2424............ca.ctt.c...244673
AB036906.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-2415............ca.ctt.c...243773
AB036907.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-2415............ca.ctt.c...243773
AB036909.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-2424............ca.ctt.c...244673
AB036910.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036911.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036912.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036913.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036914.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036915.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036916.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036917.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036918.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2338............ca.ctt.c...236073
AB036919.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB036920.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AF305327.1 Hepatitis B virus isolate CB0376, complete genome 2426............ca.ctt.c...244873
AB037927.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Makiko 2424............ca.ctt.c...244673
AB037928.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Yohko 2424............ca.ctt.c...244673
AF223962.1 Hepatitis B virus strain C-1858 isolate sa4, complete genome 2424............ca.ctt.c...244673
AF223963.1 Hepatitis B virus strain C-1858 isolate sa11, complete genome 2424............ca.ctt.c...244673
AF223964.1 Hepatitis B virus strain C-1858 isolate sa14, complete genome 2424............ca.ctt.c...244673
AF223965.1 Hepatitis B virus strain C-1858 isolate sa16, complete genome 2424............ca.ctt.c...244673
AB059661.1 Hepatitis B virus DNA, complete genome, clone:US2065 2424............ca.ctt.c...244673
AB064315.1 Hepatitis B virus DNA, complete genome, clone:US1122 2415............ca.ctt.c...243773
AB064316.1 Hepatitis B virus DNA, complete genome, clone:US2573 2424............ca.ctt.c...244673
AY077736.1 Hepatitis B virus isolate G26, complete genome 2424............ca.ctt.c...244673
AY077735.1 Hepatitis B virus isolate G25, complete genome 2424............ca.ctt.c...244673
AY090454.1 Hepatitis B virus strain 1853Nic, complete genome 2427............ca.ctt.c...244973
AY090455.1 Hepatitis B virus strain 1889Nic, complete genome 2427............ca.gtt.c...244973
AY090456.1 Hepatitis B virus strain 1980Nic, complete genome 2373............ca.ctt.c...239573
AY090457.1 Hepatitis B virus strain 2928Nic, complete genome 2427............ca.ctt.c...244973
AY090458.1 Hepatitis B virus strain 70H, complete genome 2427............ca.ctt.c...244973
AY090460.1 Hepatitis B virus strain LAS2523, complete genome 2427............ca.ctt.c...244973
AY090461.1 Hepatitis B virus strain 1116Sal, complete genome 2427............ca.ctt.c...244973
AB091255.1 Hepatitis B virus DNA, complete genome, isplate:ABI-129 2424............ca.ctt.c...244673
AB091256.1 Hepatitis B virus DNA, complete genome, isplate:ABI-212 2424............ca.ctt.c...244673
AB106564.1 Hepatitis B virus DNA, complete genome, isolate:HBV-GA325 2424............ca.ctt.c...244673
AY330912.1 Hepatitis B virus isolate Osang complete genome 2424............ca.ctt.c...244673
AY330914.1 Hepatitis B virus isolate Wendy complete genome 2430............ca.ctt.c...245273
AY330915.1 Hepatitis B virus isolate Happy complete genome 2424............ca.ctt.c...244673
AY330916.1 Hepatitis B virus isolate Tbblack complete genome 2424............ca.ctt.c...244673
AY330917.1 Hepatitis B virus isolate Crazywoman complete genome 2424............ca.ctt.c...244673
AY179734.1 Hepatitis B virus genotype F isolate BA9, complete genome 2424............ca.ctt.c...244673
AY179735.1 Hepatitis B virus genotype F isolate BA10, complete genome 2424............ca.ctt.c...244673
AY311369.1 Hepatitis B virus isolate BD4139, complete genome 2424............ca.ctt.c...244673
AY311370.1 Hepatitis B virus isolate BD14999, complete genome 2424............ca.ctt.c...244673
AB116549.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM5 2424............ca.ctt.c...244673
AB116550.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM6 2424............ca.ctt.c...244673
AB116551.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ2 2424............ca.ctt.c...244673
AB116552.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ4 2424............ca.ctt.c...244673
AB166850.1 Hepatitis B virus DNA, complete genome, isolate: HBV-BL592 2424............ca.ctt.c...244673
AY781183.1 Hepatitis B virus strain GII_11, complete genome 2424............ca.ctt.c...244673
AY781184.1 Hepatitis B virus strain GII_8, complete genome 2424............ca.ctt.c...244673
AY781185.1 Hepatitis B virus strain GI_19, complete genome 2424............ca.ctt.c...244673
AY781186.1 Hepatitis B virus strain MGI, complete genome 2424............ca.ctt.c...244673
AY781187.1 Hepatitis B virus strain SG_III, complete genome 2424............ca.ctt.c...244673
AY739674.1 Hepatitis B virus clone A1-33, complete genome 2424............ca.ctt.c...244673
AY739675.1 Hepatitis B virus clone A1-35, complete genome 2424............ca.ctt.c...244673
AY738144.1 Hepatitis B virus clone B3, complete genome 2424............ca.ctt.c...244673
AY738145.1 Hepatitis B virus clone B5, complete genome 2424............ca.ctt.c...244673
AY738146.1 Hepatitis B virus clone B9, complete genome 2424............ca.ctt.c...244673
AY738147.1 Hepatitis B virus clone B11, complete genome 2424............ca.ctt.c...244673
AB179747.1 Hepatitis B virus (genotype H) genomic DNA, complete genome, isolate:2400............c._________241356
AB179747.1 Hepatitis B virus (genotype H) genomic DNA, complete genome, isolate:2424............ca.ctt.c...244673
AB205129.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758-2 2424............ca.ctt.c...244673
AP007261.1 HBV genotype H DNA, complete genome, isolate: HB-JI260F 2403............c._________241656
AP007261.1 HBV genotype H DNA, complete genome, isolate: HB-JI260F 2427............ca.ctt.c...244973
AP007262.1 HBV genotype E DNA, complete genome, isolate: HB-JI411F 2424............ca.ctt.c...244673
AY935700.1 Hepatitis B virus isolate TH-HBV-012, complete genome 2424............ca.ctt.c...244673
AB205188.1 Hepatitis B virus DNA, complete genome, isolate: HBV-GA283 2409............ca.ctt.c...243173
AB205189.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G138 2424............ca.ctt.c...244673
AB205190.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G123 2424............ca.ctt.c...244673
AB205191.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G166 2424............ca.ctt.c...244673
AB205192.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758 2424............ca.ctt.c...244673
AB214516.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BL597 2424............ca.ctt.c...244673
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 2400............c._________241356
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 2424............ca.ctt.c...244673
AB194948.1 Hepatitis B virus DNA, complete genome, isolate: CMR936 2424............ca.ctt.c...244673
DQ060822.1 Hepatitis B virus isolate 8510-91, complete genome 2424............ca.ctt.c...244673
DQ060823.1 Hepatitis B virus isolate 8504-91, complete genome 2424............ca.ctt.c...244673
DQ060824.1 Hepatitis B virus isolate 0121-20, complete genome 2424............ca.ctt.c...244673
DQ060825.1 Hepatitis B virus isolate 0262-09, complete genome 2424............ca.ctt.c...244673
DQ060826.1 Hepatitis B virus isolate 0433-20, complete genome 2424............ca.ctt.c...244673
DQ060827.1 Hepatitis B virus isolate 0317-04, complete genome 2424............ca.ctt.c...244673
DQ060828.1 Hepatitis B virus isolate 0443-03, complete genome 2424............ca.ctt.c...244673
DQ060829.1 Hepatitis B virus isolate 0350-03, complete genome 2424............ca.ctt.c...244673
DQ060830.1 Hepatitis B virus isolate 235-01, complete genome 2424............ca.ctt.c...244673
AB201287.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds2424............ca.ctt.c...244673
AB201288.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds2424............ca.ctt.c...244673
AB201289.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds2424............ca.ctt.c...244673
AB201290.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds2424............ca.ctt.c...244673
AB205010.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IM806-2 2400............c._________241356
AB205010.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IM806-2 2424............ca.ctt.c...244673
AB219529.1 Hepatitis B virus DNA, complete genome, isolate:UK1 2412............ca.ctt.c...243473
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 2238............c._________225156
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 2262............ca.ctt.c...228473
AB219532.1 Hepatitis B virus DNA, complete genome, isolate:UK4 2250............ca.ctt.c...227273
AB219533.1 Hepatitis B virus DNA, complete genome, isolate:UK5 2430............ca.ctt.c...245273
AM117394.1 Hepatitis B virus, isolate CHIMP_DJA, complete genome 2423............ca.ctt.c...244573
AM117395.1 Hepatitis B virus, isolate CHIMP_MAK, complete genome 2423............ca.ctt.c...244573
AM117396.1 Hepatitis B virus, isolate CHIMP_BAT, complete genome 2423............ca.ctt.c...244573
AM117397.1 Hepatitis B virus, isolate CHIMP_ED, complete genome 2423............ca.ctt.c...244573
AM117397.1 Hepatitis B virus, isolate CHIMP_ED, complete genome 1700__............_________168952
DQ899142.1 Hepatitis B virus isolate Warao152, complete genome 2424............ca.ctt.c...244673
DQ899143.1 Hepatitis B virus isolate Warao189, complete genome 2424............ca.ctt.c...244673
DQ899144.1 Hepatitis B virus isolate Japreira75, complete genome 2424............ca.ctt.c...244673
DQ899145.1 Hepatitis B virus isolate Japreira76, complete genome 2424............ca.ctt.c...244673
DQ899146.1 Hepatitis B virus isolate Japreira80, complete genome 2424............ca.ctt.c...244673
DQ899147.1 Hepatitis B virus isolate Japreira116, complete genome 2424............ca.ctt.c...244673
DQ899148.1 Hepatitis B virus isolate Yanomami114, complete genome 2424............ca.ctt.c...244673
DQ899149.1 Hepatitis B virus isolate Piaroa3019, complete genome 2424............ca.ctt.c...244673
DQ899150.1 Hepatitis B virus isolate Colombia8, complete genome 2424............ca.ctt.c...244673
EF157291.1 Hepatitis B virus isolate B3586-YKH94, complete genome 2400............c._________241356
EF157291.1 Hepatitis B virus isolate B3586-YKH94, complete genome 2424............ca.ctt.c...244673
AB275308.1 Hepatitis B virus DNA, complete genome, genotype: H 2400............c._________241356
AB275308.1 Hepatitis B virus DNA, complete genome, genotype: H 2424............ca.ctt.c...244673
AB266536.1 Hepatitis B virus DNA, complete genome, isolate: HB-JAIW05 2400............c._________241356
AB266536.1 Hepatitis B virus DNA, complete genome, isolate: HB-JAIW05 2424............ca.ctt.c...244673
AB298362.1 HBV genotype H DNA, complete genome, isolate: HBV ST0404 2400............c._________241356
AB298362.1 HBV genotype H DNA, complete genome, isolate: HBV ST0404 2424............ca.ctt.c...244673
AB274969.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB320 2424............ca.ctt.c...244673
AB274970.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB291 2424............ca.ctt.c...244673
AB274971.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB295 2424............ca.ctt.c...244673
AB274972.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB250 2369............ca.ctt.c...239173
AB274973.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB18 2418............ca.ctt.c...244073
AB274974.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB60 2424............ca.ctt.c...244673
AB274975.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB241 2424............ca.ctt.c...244673
AB274976.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB382 2424............ca.ctt.c...244673
AB274977.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB183 2424............ca.ctt.c...244673
AB274978.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB261 2424............ca.ctt.c...244673
AB274979.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB302 2424............ca.ctt.c...244673
AB274980.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB90 2424............ca.ctt.c...244673
AB274981.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB331 2424............ca.ctt.a...244673
AB274982.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB130 2424............ca.ctt.a...244673
AB274983.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB85 2425............ca.ctt.c...244773
EU239217.1 Hepatitis B virus isolate G2451, complete genome 2424............ca.ctt.c...244673
EU239218.1 Hepatitis B virus isolate BD2, complete genome 2424............ca.ctt.c...244673
EU239219.1 Hepatitis B virus isolate PW3, complete genome 2424............ca.ctt.c...244673
EU239220.1 Hepatitis B virus isolate PW5, complete genome 2424............ca.ctt.c...244673
EU239221.1 Hepatitis B virus isolate PW1, complete genome 2424............ca.ctt.c...244673
EU239222.1 Hepatitis B virus isolate PW2, complete genome 2424............ca.ctt.c...244673
EU239223.1 Hepatitis B virus isolate PW4, complete genome 2424............ca.ctt.c...244673
EU239224.1 Hepatitis B virus isolate BD1, complete genome 2424............ca.ctt.c...244673
EU239226.1 Hepatitis B virus isolate PW6, complete genome 2424............ca.ctt.c...244673
D00220.2HPBVCG Hepatitis B virus DNA, complete genome, strain: LSH 2424............ca.ctt.c...244673
AM494689.1 Hepatitis B virus complete genome, isolate CAR006 2412............ca.ctt.c...243473
AM494690.1 Hepatitis B virus complete genome, isolate CAR008 2424............ca.ctt.c...244673
AM494692.1 Hepatitis B virus complete genome, isolate CAR026 2424............ca.ctt.c...244673
AM494693.1 Hepatitis B virus complete genome, isolate CAR039 2424............ca.ctt.c...244673
AM494694.1 Hepatitis B virus complete genome, isolate CAR047 2424............ca.ctt.c...244673
AM494695.1 Hepatitis B virus complete genome, isolate CAR053 2424............ca.ctt.c...244673
AM494696.1 Hepatitis B virus complete genome, isolate CAR060 2424............ca.ctt.c...244673
AM494697.1 Hepatitis B virus complete genome, isolate CAR063 2424............ca.ctt.c...244673
AM494698.1 Hepatitis B virus complete genome, isolate CAR066 2403............ca.ctt.c...242573
AM494699.1 Hepatitis B virus complete genome, isolate CAR082 2424............ca.ctt.c...244673
AM494700.1 Hepatitis B virus complete genome, isolate CAR083 2424............ca.ctt.c...244673
AM494701.1 Hepatitis B virus complete genome, isolate CAR097 2424............ca.ctt.c...244673
AM494702.1 Hepatitis B virus complete genome, isolate CAR106 2424............ca.ctt.c...244673
AM494704.1 Hepatitis B virus complete genome, isolate CAR112 2424............ca.ctt.c...244673
AM494705.1 Hepatitis B virus complete genome, isolate CAR115 2424............ca.ctt.c...244673
AM494706.1 Hepatitis B virus complete genome, isolate CAR131 2424............ca.ctt.c...244673
AM494707.1 Hepatitis B virus complete genome, isolate CAR137 2424............ca.ctt.c...244673
AM494708.1 Hepatitis B virus complete genome, isolate CAR138 2424............ca.ctt.c...244673
AM494709.1 Hepatitis B virus complete genome, isolate CAR143 2424............ca.ctt.c...244673
AM494710.1 Hepatitis B virus complete genome, isolate CAR144 2424............ca.ctt.c...244673
AM494711.1 Hepatitis B virus complete genome, isolate CAR146 2421............ca.ctt.c...244373
AM494712.1 Hepatitis B virus complete genome, isolate CAR150 2421............ca.ctt.c...244373
AM494713.1 Hepatitis B virus complete genome, isolate CAR154 2424............ca.ctt.c...244673
AM494715.1 Hepatitis B virus complete genome, isolate CAR171 2424............ca.ctt.c...244673
AM494717.1 Hepatitis B virus complete genome, isolate CAR187 2424............ca.ctt.c...244673
AB353764.1 Hepatitis B virus DNA, complete genome, isolate: HBDI03 2400............c._________241356
AB353764.1 Hepatitis B virus DNA, complete genome, isolate: HBDI03 2424............ca.ctt.c...244673
AB365447.1 Hepatitis B virus DNA, complete genome, isolate: BOL51 2423............ca.ctt.c...244573
AB365449.1 Hepatitis B virus DNA, complete genome, isolate: BOL93 2424............ca.ctt.c...244673
AB365450.1 Hepatitis B virus DNA, complete genome, isolate: BOL102 2424............ca.ctt.c...244673
AB365453.1 Hepatitis B virus DNA, complete genome, isolate: BOL584 2436............ca.ctt.c...245873
EU670261.1 Hepatitis B virus isolate 499, complete genome 2344............ca.ctt.c...236673
EU670262.1 Hepatitis B virus isolate 549, complete genome 2424............ca.ctt.c...244673
AB375159.1 Hepatitis B virus DNA, complete genome, strain: MEX8-H 2424............ca.ctt.c...244673
AB375160.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-H 2424............ca.ctt.c...244673
AB375161.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32 2424............ca.ctt.c...244673
AB375162.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-H 2424............ca.ctt.c...244673
AB375163.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-H 2424............ca.ctt.c...244673
AB375164.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-H 2424............ca.ctt.c...244673
FM209512.1 Hepatitis B virus complete genome, isolate G15 2424............ca.ctg.c...244673
FM209513.1 Hepatitis B virus complete genome, isolate G18 2424............ca.ctt.c...244673
FM209514.1 Hepatitis B virus complete genome, isolate G50 2424............ca.ctt.c...244673
FM209515.1 Hepatitis B virus complete genome, isolate G51 2424............ca.ctt.c...244673
FM209516.1 Hepatitis B virus complete genome, isolate G56 2424............ca.ctt.c...244673
FJ798095.1 Hepatitis B virus isolate ggcam19, complete genome 2424............ca.ctt.c...244673
FJ798096.1 Hepatitis B virus isolate ggcam7, complete genome 2424............ca.ctt.c...244673
FJ798097.1 Hepatitis B virus isolate ggcam22, complete genome 2424............ca.ctt.c...244673
FJ798098.1 Hepatitis B virus isolate cpzcam17, complete genome 2424............ca.ctt.c...244673
FJ798099.1 Hepatitis B virus isolate cpzcam6, complete genome 2424............ca.ctt.c...244673
FJ657519.1 Hepatitis B virus isolate BA110, complete genome 2424............ca.ctt.c...244673
FJ657522.1 Hepatitis B virus isolate BA116, complete genome 2424............ca.ctt.c...244673
FJ657528.1 Hepatitis B virus isolate BA108, complete genome 2424............ca.ctt.c...244673
FJ657529.1 Hepatitis B virus isolate BA109, complete genome 2424............ca.ctt.c...244673
FN594748.1 Hepatitis B virus complete genome, isolate bne6 2424............ca.ctt.c...244673
FN594749.1 Hepatitis B virus complete genome, isolate bne8 2424............ca.ctt.c...244673
FN594750.1 Hepatitis B virus complete genome, isolate bne12 2424............ca.ctt.c...244673
FN594751.1 Hepatitis B virus complete genome, isolate bne52H 2424............ca.ctt.c...244673
FN594752.1 Hepatitis B virus complete genome, isolate bne134 2424............ca.ctt.c...244673
FN594753.1 Hepatitis B virus complete genome, isolate bne137 2409............ca.gtt.c...243173
FN594754.1 Hepatitis B virus complete genome, isolate bne200 2404............ca.gtt.c...242673
FN594755.1 Hepatitis B virus complete genome, isolate bne241 2424............ca.ctt.c...244673
FN594756.1 Hepatitis B virus complete genome, isolate bne250 2424............ca.ctt.c...244673
FN594757.1 Hepatitis B virus complete genome, isolate bne305 2409............ca.ctt.c...243173
FN594758.1 Hepatitis B virus complete genome, isolate bne341 2424............ca.ctt.c...244673
FN594759.1 Hepatitis B virus complete genome, isolate bne342 2424............ca.ctt.c...244673
FN594760.1 Hepatitis B virus complete genome, isolate bne362 2424............ca.ctt.c...244673
FN594761.1 Hepatitis B virus complete genome, isolate bne385 2424............ca.ctt.c...244673
FN594762.1 Hepatitis B virus complete genome, isolate bne439 2424............ca.ctt.c...244673
FN594763.1 Hepatitis B virus complete genome, isolate bne446 2424............ca.ctt.c...244673
FN594764.1 Hepatitis B virus complete genome, isolate bne9439 2424............ca.ctt.c...244673
FN594766.1 Hepatitis B virus complete genome, isolate bne9449 2424............ca.ctt.c...244673
FN594767.1 Hepatitis B virus complete genome, isolate bne127 2424............ca.ctt.c...244673
DQ776247.2 Hepatitis B virus isolate BA54, complete genome 2424............ca.ctt.c...244673
EU366116.2 Hepatitis B virus isolate BA61, complete genome 2424............ca.ctt.c...244673
EU366118.2 Hepatitis B virus isolate BA67, complete genome 2424............ca.ctt.c...244673
EU366132.2 Hepatitis B virus isolate BA95, complete genome 2424............ca.ctt.c...244673
EU366133.2 Hepatitis B virus isolate BA96, complete genome 2424............ca.ctt.c...244673
FN545821.1 Hepatitis B virus complete genome, strain 29122 2424............ca.ctt.c...244673
FN545822.1 Hepatitis B virus complete genome, strain 29134 2424............ca.ctt.c...244673
FN545823.1 Hepatitis B virus complete genome, strain 29135 2424............ca.ctg.c...244673
FN545824.1 Hepatitis B virus complete genome, strain 29136 2369............ca.ctt.c...239173
FN545827.1 Hepatitis B virus complete genome, strain 34011 2412............ca.ctt.c...243473
FN545841.1 Hepatitis B virus complete genome, strain 42349 2424............ca.ctt.c...244673
FN545842.1 Hepatitis B virus complete genome, strain 42366 2424............ca.ctt.c...244673
HM066946.2 Hepatitis B virus isolate MX-HBV-0114, complete genome 2424............ca.ctt.c...244673
HM117850.2 Hepatitis B virus isolate MX-HBV-0153, complete genome 2424............ca.ctt.c...244673
HM117851.2 Hepatitis B virus isolate MX-HBV-0201, complete genome 2424............ca.ctt.c...244673
AB516393.1 HBV genotype H DNA, complete genome, isolate: 904MEXM 2424............ca.ctt.c...244673
AB516394.1 HBV genotype H DNA, complete genome, isolate: MEX912M 2424............ca.ctt.c...244673
AB516395.1 HBV genotype H DNA, complete genome, isolate: MEX914M 2424............ca.ctt.c...244673
HM622135.1 Hepatitis B virus isolate HCUCH5, complete genome 2424............ca.ctt.c...244673
HM627320.1 Hepatitis B virus isolate HCUCH21, complete genome 2424............ca.ctt.c...244673
HQ378247.1 Hepatitis B virus isolate IRL-2009, complete genome 2424............ca.ctt.c...244673
AB036908.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:2415............___________242652
AB059659.1 Hepatitis B virus DNA, complete genome, clone:US10 2424............___________243552
AY090459.1 Hepatitis B virus strain 7768H, complete genome 2427............___________243852
AB086397.1 Hepatitis B virus X, C genes for X protein, core protein, complete c2424............___________243552
AY330913.1 Hepatitis B virus isolate Tamang complete genome 2424............___________243552
AB116654.1 Hepatitis B virus DNA, complete genome, clone:JPNTAKA 2424............___________243552
AB219534.1 Hepatitis B virus DNA, complete genome, isolate:UK6 2394............___________240552
AB274984.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB109 2424............___________243552
AB274985.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB145 2418............___________242952
EU239225.1 Hepatitis B virus isolate PW7, complete genome 2422............___________243352
AM494691.1 Hepatitis B virus complete genome, isolate CAR024 2424............___________243552
AM494703.1 Hepatitis B virus complete genome, isolate CAR107 2424............___________243552
AM494714.1 Hepatitis B virus complete genome, isolate CAR165 2424............___________243552
AB365446.1 Hepatitis B virus DNA, complete genome, isolate: BOL3 2424............___________243552
AB365448.1 Hepatitis B virus DNA, complete genome, isolate: BOL71 2426............___________243752
AB486012.1 Hepatitis B virus DNA, complete genome, clone: JRB34 2424............___________243552
FJ657525.1 Hepatitis B virus isolate BA107, complete genome 2424............___________243552
FN594765.1 Hepatitis B virus complete genome, isolate bne9447 2424............___________243552