../../tmp/servers/virsirnadb/779278938
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18801gatggagtagatttgcctccctggt25
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 97383.........................97407100
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 76466__.t..cc..c.........a.___7648560
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 67210_____________..........t.6722144
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 103058______________.........._10306740
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 112113_______________..........11210440
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 45491___________..ac........._4547944
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 54784____________.g.........c.5477244
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 56032____________.c.........__5602240
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 125255____________.g.........__12524540
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 13434____________.........____1344236
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 16507____________.........____1651536
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 19580____________.........____1958836
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 22653____________.........____2266136
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 25726____________.........____2573436
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 28799____________.........____2880736
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 31872____________.........____3188036
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 34945____________.........____3495336
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 119141______.........__________11914936
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 123138______________.........__12314636
NC_009334.1 Human herpesvirus 4, complete genome 98295.........................98319100
NC_009334.1 Human herpesvirus 4, complete genome 158437___________............._15842552
NC_009334.1 Human herpesvirus 4, complete genome 151611________...gc..........__15159752
NC_009334.1 Human herpesvirus 4, complete genome 76582__.t..cc..c.........a.___7660160
NC_009334.1 Human herpesvirus 4, complete genome 150379______________...........15038944
NC_009334.1 Human herpesvirus 4, complete genome 131393________.c.........t..___13140648
NC_009334.1 Human herpesvirus 4, complete genome 67327_____________..........t.6733844
NC_009334.1 Human herpesvirus 4, complete genome 103970______________.........._10397940
NC_009334.1 Human herpesvirus 4, complete genome 113024_______________..........11301540
NC_009334.1 Human herpesvirus 4, complete genome 165445_______________..........16545440
NC_009334.1 Human herpesvirus 4, complete genome 45671___________..ac........._4565944
NC_009334.1 Human herpesvirus 4, complete genome 54965____________.g.........c.5495344
NC_009334.1 Human herpesvirus 4, complete genome 135728_________.t.........t.___13574044
NC_009334.1 Human herpesvirus 4, complete genome 56213____________.c.........__5620340
NC_009334.1 Human herpesvirus 4, complete genome 126163____________.g.........__12615340
NC_009334.1 Human herpesvirus 4, complete genome 4254_______________........._424636
NC_009334.1 Human herpesvirus 4, complete genome 13381____________.........____1338936
NC_009334.1 Human herpesvirus 4, complete genome 16451____________.........____1645936
NC_009334.1 Human herpesvirus 4, complete genome 19521____________.........____1952936
NC_009334.1 Human herpesvirus 4, complete genome 22591____________.........____2259936
NC_009334.1 Human herpesvirus 4, complete genome 25661____________.........____2566936
NC_009334.1 Human herpesvirus 4, complete genome 28731____________.........____2873936
NC_009334.1 Human herpesvirus 4, complete genome 31801____________.........____3180936
NC_009334.1 Human herpesvirus 4, complete genome 34871____________.........____3487936
NC_009334.1 Human herpesvirus 4, complete genome 65157________________.........6516536
NC_009334.1 Human herpesvirus 4, complete genome 120049______.........__________12005736
NC_009334.1 Human herpesvirus 4, complete genome 124046______________.........__12405436
NC_009334.1 Human herpesvirus 4, complete genome 166240______________.........__16623236