../../tmp/servers/virsirnadb/1479012871
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18721gcatcgtggtcaaggaggttccaac25
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 96980.........................97004100
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 118508___............tc..______11852356
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 46389_____...a.tc.........____4637452
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 81110_______..g.........a.____8112348
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 113394___..t.........t.________11338148
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 99821______..........t._______9981044
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 107305_____..........__________10731440
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 55427_.c..ag........._________5544148
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 90220___.g.g.c........._______9020648
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 90249___.g.g.c........._______9023548
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 90276_____.g.a........._______9026444
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 102940_..cg.........___________10295244
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 106478____.........c.c.________10646644
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 109469_______.........ca.._____10945744
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 122725__.........gt..__________12273744
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 91717__.c.........____________9170740
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 93135_____.........a._________9312540
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 51084_____________.........___5109236
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 53243______.........__________5325136
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 103473.........________________10348136
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 118335_____________.........___11834336
NC_009334.1 Human herpesvirus 4, complete genome 97892..........g............g.9791692
NC_009334.1 Human herpesvirus 4, complete genome 119416___............tc..______11943156
NC_009334.1 Human herpesvirus 4, complete genome 89582_..........._____________8959244
NC_009334.1 Human herpesvirus 4, complete genome 46570_____...a.tc.........____4655552
NC_009334.1 Human herpesvirus 4, complete genome 114305___..t.........t.________11429248
NC_009334.1 Human herpesvirus 4, complete genome 136882____.........a..a._______13686948
NC_009334.1 Human herpesvirus 4, complete genome 100733______..........t._______10072244
NC_009334.1 Human herpesvirus 4, complete genome 108216_____..........__________10822540
NC_009334.1 Human herpesvirus 4, complete genome 55608_.c..ag........._________5562248
NC_009334.1 Human herpesvirus 4, complete genome 91132___.g.g.c........._______9111848
NC_009334.1 Human herpesvirus 4, complete genome 86273_______..ga........._____8628544
NC_009334.1 Human herpesvirus 4, complete genome 103852_..cg.........___________10386444
NC_009334.1 Human herpesvirus 4, complete genome 107389____.........c.c.________10737744
NC_009334.1 Human herpesvirus 4, complete genome 110380_______.........ca.._____11036844
NC_009334.1 Human herpesvirus 4, complete genome 123633__.........gt..__________12364544
NC_009334.1 Human herpesvirus 4, complete genome 92629__.c.........____________9261940
NC_009334.1 Human herpesvirus 4, complete genome 94047_____.........a._________9403740
NC_009334.1 Human herpesvirus 4, complete genome 146857____________.a.........__14686740
NC_009334.1 Human herpesvirus 4, complete genome 165229________.a.........______16521940
NC_009334.1 Human herpesvirus 4, complete genome 51265_____________.........___5127336
NC_009334.1 Human herpesvirus 4, complete genome 53424______.........__________5343236
NC_009334.1 Human herpesvirus 4, complete genome 81963________________.........8195536
NC_009334.1 Human herpesvirus 4, complete genome 104385.........________________10439336
NC_009334.1 Human herpesvirus 4, complete genome 119243_____________.........___11925136
NC_009334.1 Human herpesvirus 4, complete genome 166728_........._______________16672036
NC_009334.1 Human herpesvirus 4, complete genome 169709_........._______________16971736