../../tmp/servers/virsirnadb/921856468
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18791gcccgctcctacctgcaatatcaagg26
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 97337..........................97362100
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 54822.........c..t.____________5480946
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 8920..........________________892938
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 60581..........________________6057238
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 65337________.c.........c._____6534942
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 51229_____.........c.__________5121938
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 56117___.t.........____________5610738
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 95866_.........g.______________9585638
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 61601_______.........__________6159334
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 94055____________........._____9404734
NC_009334.1 Human herpesvirus 4, complete genome 98249..........................98274100
NC_009334.1 Human herpesvirus 4, complete genome 164534_____..a.........g.t._____16451950
NC_009334.1 Human herpesvirus 4, complete genome 55003.........c..t.____________5499046
NC_009334.1 Human herpesvirus 4, complete genome 155620.........a..a.____________15563346
NC_009334.1 Human herpesvirus 4, complete genome 160063.t..........______________16005242
NC_009334.1 Human herpesvirus 4, complete genome 8868..........________________887738
NC_009334.1 Human herpesvirus 4, complete genome 60687..........________________6067838
NC_009334.1 Human herpesvirus 4, complete genome 82029_________.........._______8203838
NC_009334.1 Human herpesvirus 4, complete genome 134669_______.........t.ctc..g..13468753
NC_009334.1 Human herpesvirus 4, complete genome 160379....ttct........._________16036350
NC_009334.1 Human herpesvirus 4, complete genome 65454________.c.........c._____6546642
NC_009334.1 Human herpesvirus 4, complete genome 51410_____.........c.__________5140038
NC_009334.1 Human herpesvirus 4, complete genome 56298___.t.........____________5628838
NC_009334.1 Human herpesvirus 4, complete genome 94967____________........._____9495934
NC_009334.1 Human herpesvirus 4, complete genome 136740_____________.........____13673234
NC_009334.1 Human herpesvirus 4, complete genome 147836________________........._14784434
NC_009334.1 Human herpesvirus 4, complete genome 151338________........._________15133034