../../tmp/servers/virsirnadb/1034282979
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi14961gcttaagagggagataacatt21
NC_007377.1 Influenza A virus (A/Korea/426/68(H2N2)) segment 7, complete sequence331.....................351100
V01099.1 Influenza A virus (A/PR/8/1934(H1N1)) ORF1 and ORF2, genomic RNA 331...c.................35195
NC_007367.1 Influenza A virus (A/New York/392/2004(H3N2)) segment 7, complete seq332_.................g..35190
NC_004909.1 Influenza A virus (A/Hong Kong/1073/99(H9N2)) segment 6, complete seq1274___...........cc...__128966
NC_007372.1 Influenza A virus (A/New York/392/2004(H3N2)) segment 2, complete seq557_____.a.t..........__57057
NC_007364.1 Influenza A virus (A/Goose/Guangdong/1/96(H5N1)), complete genome 773___________..........78247
J02151.1FLAP1M0X Influenza A virus (A/Puerto Rico/8/34(H1N1)) polymerase 1 gen934_________..........__94347
NC_004910.1 Influenza A virus (A/Hong Kong/1073/99(H9N2)) segment 1, complete seq592____.........________60042
NC_007380.1 Influenza A virus (A/Korea/426/68(H2N2)) segment 8, complete sequence455____.........________46342
NC_007370.1 Influenza A virus (A/New York/392/2004(H3N2)) segment 8, complete seq481____.........________48942
J02150.1FLANSMCB Influenza A virus (A/Puerto Rico/8/34(H1N1)) segment 8, compl481____.........________48942