../../tmp/servers/virsirnadb/810336405
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi16791gcttaggagttatccggccca21
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R9458.....................9478100
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R6268______...........g.._625561
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R975...ggt.........______98957
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 9458.....................9478100
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 6268______...........g.._625561
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 976...ggt.........______99057
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 9458.....................9478100
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 6268______...........g.._625561
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 975...ggt.........______98957
E04903.1 DNA coding measles vaccine peptide 9458.....................9478100
E04903.1 DNA coding measles vaccine peptide 6268______...........g.._625561
E04903.1 DNA coding measles vaccine peptide 975...ggt.........______98957
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir9458.....................9478100
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir6268______...........g.._625561
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir975...ggt.........______98957
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str9458.....................9478100
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str6268______...........g.._625561
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str975...ggt.........______98957
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,9458.....................9478100
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,6268______...........g.._625561
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,975...ggt.........______98957
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 9458.....................9478100
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 6268______...........g.._625561
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 975...ggt.........______98957
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 9458.....................9478100
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 6268______...........g.._625561
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 975...ggt.........______98957
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 9458.....................9478100
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 6268______...........g.._625561
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 975...ggt.........______98957
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 9458.....................9478100
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 6268______...........g.._625561
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 975...ggt.........______98957
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 9458.....................9478100
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 6268______...........g.._625561
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 975...ggt.........______98957
AB046218.1 Measles virus genomic RNA, complete sequence 9458.....................9478100
AB046218.1 Measles virus genomic RNA, complete sequence 6268______...........g.._625561
AB046218.1 Measles virus genomic RNA, complete sequence 975...ggt.........______98957
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy9458.....................9478100
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy9458.....................9478100
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy9458.....................9478100
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy9458.....................9478100
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy9458.....................9478100
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy9458.....................9478100
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy9458.....................9478100
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 9458.....................9478100
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 6268______...........g.._625561
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 975...ggt.........______98957
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 9458.....................9478100
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 6268______...........g.._625561
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 975...ggt.........______98957
AY730614.1 Measles virus strain Leningrad-4, complete genome 9458.....................9478100
AY730614.1 Measles virus strain Leningrad-4, complete genome 6268______...........g.._625561
AY730614.1 Measles virus strain Leningrad-4, complete genome 975...ggt.........______98957
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 9458.....................9478100
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 6268______..........ag.._625557
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 975...ggt.........______98957
DQ345721.1 Measles virus strain CAM-70, complete genome 9458.....................9478100
DQ345721.1 Measles virus strain CAM-70, complete genome 6268______...........g.._625561
DQ345721.1 Measles virus strain CAM-70, complete genome 975...ggt.........______98957
DQ345722.1 Measles virus strain CAM-70, complete genome 9458.....................9478100
DQ345722.1 Measles virus strain CAM-70, complete genome 6268______...........g.._625561
DQ345722.1 Measles virus strain CAM-70, complete genome 975...ggt.........______98957
DQ345723.1 Measles virus strain CAM-70, complete genome 9458.....................9478100
DQ345723.1 Measles virus strain CAM-70, complete genome 6268______...........g.._625561
DQ345723.1 Measles virus strain CAM-70, complete genome 975...ggt.........______98957
EF033071.1 Measles virus strain Changchun-47, complete genome 9458.....................9478100
EF033071.1 Measles virus strain Changchun-47, complete genome 6268______...........g.._625561
EF033071.1 Measles virus strain Changchun-47, complete genome 975...ggt.........______98957
EU293548.1 Measles virus isolate D-V/S, complete genome 9458.....................9478100
EU293548.1 Measles virus isolate D-V/S, complete genome 6268______...........g.._625561
EU293548.1 Measles virus isolate D-V/S, complete genome 975...ggt.........______98957
EU293549.1 Measles virus isolate D-CEF, complete genome 9458.....................9478100
EU293549.1 Measles virus isolate D-CEF, complete genome 6268______...........g.._625561
EU293549.1 Measles virus isolate D-CEF, complete genome 975...ggt.........______98957
EU293550.1 Measles virus isolate Davis87, complete genome 9458.....................9478100
EU293550.1 Measles virus isolate Davis87, complete genome 6268______...........g.._625561
EU293550.1 Measles virus isolate Davis87, complete genome 975...ggt.........______98957
EU293551.1 Measles virus isolate D-VI, complete genome 9458.....................9478100
EU293551.1 Measles virus isolate D-VI, complete genome 6268______...........g.._625561
EU293551.1 Measles virus isolate D-VI, complete genome 975...ggt.........______98957
EU293552.1 Measles virus isolate D-VII, complete genome 9458.....................9478100
EU293552.1 Measles virus isolate D-VII, complete genome 6268______...........g.._625561
EU293552.1 Measles virus isolate D-VII, complete genome 975...ggt.........______98957
AF266288.2 Measles virus strain Edmonston, complete genome 9458.....................9478100
AF266288.2 Measles virus strain Edmonston, complete genome 6268______...........g.._625561
AF266288.2 Measles virus strain Edmonston, complete genome 975...ggt.........______98957
NC_001498.1 Measles virus, complete genome 9458.....................9478100
NC_001498.1 Measles virus, complete genome 6268______...........g.._625561
NC_001498.1 Measles virus, complete genome 975...ggt.........______98957
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy9458................a....947895
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy6268______...........g.._625561
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy975...ggt.........______98957
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 9458............c........947895
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 6268______...........g.._625561
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 975...ggt.........______98957
DQ227319.1 Measles virus isolate 97-45881, complete genome 9458............c........947895
DQ227319.1 Measles virus isolate 97-45881, complete genome 6268______...........g.._625561
DQ227319.1 Measles virus isolate 97-45881, complete genome 975...ggt.........______98957
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome9458............c........947895
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome6268______...........g.._625561
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome975...ggt.........______98957
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 9458............c........947895
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 6269______...........g.._625661
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 975...ggt.........______98957
EU435017.1 Measles virus strain Shanghai-191, complete genome 9458......a..............947895
EU435017.1 Measles virus strain Shanghai-191, complete genome 6268______...........g.._625561
EU435017.1 Measles virus strain Shanghai-191, complete genome 975...ggt.........______98957
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 9458......a..............947895
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 6268______...........g.._625561
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 975...ggt.........______98957
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 9458......a..............947895
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 6268______...........g.._625561
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 975...ggt.........______98957
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 9458............c..a.....947890
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 6271____.t...........g.._625666
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 975...ggt.........______98957