../../tmp/servers/virsirnadb/1593831538
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi17081ggacagagcccattacaatat21
NC_001526.2 Human papillomavirus type 16, complete genome 702.....................722100
NC_001526.2 Human papillomavirus type 16, complete genome 4370___________..........437947
NC_008184.1 Tursiops truncatus papillomavirus 2, complete genome 2283..t..c.t.aa..........230376
NC_002232.1 Rabbit oral papillomavirus, complete genome 5728___..c.a..........___574261
NC_004195.1 Bovine papillomavirus type 5, complete genome 1464___..........g.a..___147861
NC_004195.1 Bovine papillomavirus type 5, complete genome 7224..c.........gc.._____720961
NC_004195.1 Bovine papillomavirus type 5, complete genome 3776________.g.........c.378852
NC_010226.1 Canine papillomavirus 4, complete genome 1105______..g.a..........111961
NC_014326.1 Mus musculus papillomavirus type 1, complete genome 426___...g.........c.___44061
NC_003973.1 Psittacus erithacus timneh papillomavirus, complete genome 1709___..........._______169952
NC_003973.1 Psittacus erithacus timneh papillomavirus, complete genome 2887__________.........._287847
NC_014954.1 Human papillomavirus type 131, complete genome 3863_______...........___387352
NC_008188.1 Human papillomavirus type 103, complete genome 7063___.........cc..c..__704861
NC_010739.1 Ursus maritimus papillomavirus 1, complete genome 4298____...tgt.........._431361
NC_001690.1 Human papillomavirus type 48, complete genome 2153_________.........g..216452
NC_008519.1 Mastomys coucha papillomavirus 2, complete genome 3591__.........t.._______358052
NC_001524.1 European elk papillomavirus, complete genome 2019_____..........______202847
NC_001524.1 European elk papillomavirus, complete genome 3256_..........__________326547
NC_001693.1 Human papillomavirus type 60, complete genome 6350__.........._________635947
NC_006951.1 Erethizon dorsatum papillomavirus type 1, complete genome 2749_______..........____274047
NC_006951.1 Erethizon dorsatum papillomavirus type 1, complete genome 2828.c.a.........________284052
NC_001354.1 Human papillomavirus type 41, complete genome 414..........___________42347
NC_001458.1 Human papillomavirus type 63, complete genome 2064______..aa.t.........205057
NC_015268.1 Camelus dromedarius papillomavirus type 2, complete genome 5046______.a.........c.__505852