../../tmp/servers/virsirnadb/201254371
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi16831ggacatcaaggagaaaattat21
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir9662.....................9682100
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir3265___..........._______325552
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir3473.........a.g.________348552
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str9662.....................9682100
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str3265___..........._______325552
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str3473.........a.g.________348552
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,9662.....................9682100
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,3265___..........._______325552
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,3473.........a.g.________348552
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy9662.....................9682100
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy3265___..........._______325552
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy15726____.........._______1573547
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy9662.....................9682100
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy3265___..........._______325552
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 9662.....................9682100
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 3265___..........._______325552
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 9662.....................9682100
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 3473.........a.g.________348552
EU293548.1 Measles virus isolate D-V/S, complete genome 9662.....................9682100
EU293548.1 Measles virus isolate D-V/S, complete genome 3265___..........._______325552
EU293548.1 Measles virus isolate D-V/S, complete genome 3473.........a.g.________348552
EU293549.1 Measles virus isolate D-CEF, complete genome 9662.....................9682100
EU293549.1 Measles virus isolate D-CEF, complete genome 3265___..........._______325552
EU293549.1 Measles virus isolate D-CEF, complete genome 3473.........a.g.________348552
EU293550.1 Measles virus isolate Davis87, complete genome 9662.....................9682100
EU293550.1 Measles virus isolate Davis87, complete genome 3265___..........._______325552
EU293550.1 Measles virus isolate Davis87, complete genome 3473.........a.g.________348552
EU293551.1 Measles virus isolate D-VI, complete genome 9662.....................9682100
EU293551.1 Measles virus isolate D-VI, complete genome 3265___..........._______325552
EU293551.1 Measles virus isolate D-VI, complete genome 3473.........a.g.________348552
EU293552.1 Measles virus isolate D-VII, complete genome 9662.....................9682100
EU293552.1 Measles virus isolate D-VII, complete genome 3265___..........._______325552
EU293552.1 Measles virus isolate D-VII, complete genome 3473.........a.g.________348552
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 9662.....................9682100
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 3265___..........._______325552
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 3473.........a.g.________348552
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 9662.....................9682100
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 3265___..........._______325552
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 3473.........a.g.________348552
NC_001498.1 Measles virus, complete genome 9662.....................9682100
NC_001498.1 Measles virus, complete genome 3265___..........._______325552
NC_001498.1 Measles virus, complete genome 3473.........a.g.________348552
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R9662................g....968295
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R3265___..........._______325552
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R3473.........a.g.________348552
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 9662................g....968295
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 3266___..........._______325652
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 3473.........a.g.________348552
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 9662................g....968295
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 3265___..........._______325552
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 3473.........a.g.________348552
E04903.1 DNA coding measles vaccine peptide 9662................g....968295
E04903.1 DNA coding measles vaccine peptide 3265___..........._______325552
E04903.1 DNA coding measles vaccine peptide 3473.........a.g.________348552
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 9662................g....968295
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 3265___..........._______325552
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 3473.........a.g.________348552
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 9662................g....968295
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 3265___..........._______325552
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 3473.........a.g.________348552
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 9662................g....968295
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 3265___..........._______325552
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 3473.........a.g.________348552
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 9662................g....968295
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 3265___..........._______325552
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 3473.........a.g.________348552
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 9662................g....968295
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 3265___..........._______325552
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 3473.........a.g.________348552
AB046218.1 Measles virus genomic RNA, complete sequence 9662................g....968295
AB046218.1 Measles virus genomic RNA, complete sequence 3265___..........._______325552
AB046218.1 Measles virus genomic RNA, complete sequence 3473.........a.g.________348552
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy9662................g....968295
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy3265___..........._______325552
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy9662................g....968295
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy3267_.t..........._______325557
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy9662................g....968295
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy3265___..........._______325552
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy9662................g....968295
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy3265___..........._______325552
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy9662................g....968295
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy3265___..........._______325552
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy9662................g....968295
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy3265___..........._______325552
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy3473.........a.g.________348552
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 9662................g....968295
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 3265___..........._______325552
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 3473.........a.g.________348552
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 9662................g....968295
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 3265___..........._______325552
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 3473.........a.g.________348552
AY730614.1 Measles virus strain Leningrad-4, complete genome 9662................g....968295
AY730614.1 Measles virus strain Leningrad-4, complete genome 3265___..........._______325552
AY730614.1 Measles virus strain Leningrad-4, complete genome 3473.........a.g.________348552
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 9662............a........968295
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 3265___..........._______325552
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 3473.........a.g.________348552
DQ227319.1 Measles virus isolate 97-45881, complete genome 9662............a........968295
DQ227319.1 Measles virus isolate 97-45881, complete genome 3265___..........._______325552
DQ227319.1 Measles virus isolate 97-45881, complete genome 3473.........a.g.________348552
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome9662............a........968295
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome3265___..........._______325552
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome3473.........a.g.________348552
DQ345721.1 Measles virus strain CAM-70, complete genome 9662................g....968295
DQ345721.1 Measles virus strain CAM-70, complete genome 3265___..........._______325552
DQ345721.1 Measles virus strain CAM-70, complete genome 3473.........a.g.________348552
DQ345722.1 Measles virus strain CAM-70, complete genome 9662................g....968295
DQ345722.1 Measles virus strain CAM-70, complete genome 3265___..........._______325552
DQ345722.1 Measles virus strain CAM-70, complete genome 3473.........a.g.________348552
DQ345723.1 Measles virus strain CAM-70, complete genome 9662................g....968295
DQ345723.1 Measles virus strain CAM-70, complete genome 3265___..........._______325552
DQ345723.1 Measles virus strain CAM-70, complete genome 3473.........a.g.________348552
EF033071.1 Measles virus strain Changchun-47, complete genome 9662................g....968295
EF033071.1 Measles virus strain Changchun-47, complete genome 3265___..........._______325552
EF033071.1 Measles virus strain Changchun-47, complete genome 3473.........a.g.________348552
EU435017.1 Measles virus strain Shanghai-191, complete genome 9662................g....968295
EU435017.1 Measles virus strain Shanghai-191, complete genome 3265___..........._______325552
EU435017.1 Measles virus strain Shanghai-191, complete genome 3473.........a.g.________348552
AF266288.2 Measles virus strain Edmonston, complete genome 9662................g....968295
AF266288.2 Measles virus strain Edmonston, complete genome 3265___..........._______325552
AF266288.2 Measles virus strain Edmonston, complete genome 3473.........a.g.________348552
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 9662..............g.g....968290
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 3265___..........._______325552
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 821..........___________83047
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 3473.........a.g.________348552
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 5407___.t.........c._____541952
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 9159_.........a.t._______917152