../../tmp/servers/virsirnadb/1631668248
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi16821ggaggagacacacacctgtat21
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R9796.....................9816100
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R5777.t.........._________578852
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R2233..........___________224247
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R6172..........___________618147
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 9796.....................9816100
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 5777.t.........._________578852
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 2234..........___________224347
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 6172..........___________618147
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 9796.....................9816100
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 5777.t.........._________578852
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 2233..........___________224247
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 6172..........___________618147
E04903.1 DNA coding measles vaccine peptide 9796.....................9816100
E04903.1 DNA coding measles vaccine peptide 5777.t.........._________578852
E04903.1 DNA coding measles vaccine peptide 2233..........___________224247
E04903.1 DNA coding measles vaccine peptide 6172..........___________618147
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir9796.....................9816100
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir5777.t.........._________578852
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str9796.....................9816100
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str5777.t.........._________578852
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,9796.....................9816100
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,5777.t.........._________578852
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 9796.....................9816100
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 5777.t.........._________578852
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 2233..........___________224247
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 6172..........___________618147
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 9796.....................9816100
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 5777.t.........._________578852
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 2233..........___________224247
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 6172..........___________618147
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 9796.....................9816100
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 5777.t.........._________578852
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 2233..........___________224247
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 6172..........___________618147
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 9796.....................9816100
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 5777.t.........._________578852
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 2233..........___________224247
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 6172..........___________618147
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 9796.....................9816100
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 5777.t.........._________578852
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 2233..........___________224247
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 6172..........___________618147
AB046218.1 Measles virus genomic RNA, complete sequence 9796.....................9816100
AB046218.1 Measles virus genomic RNA, complete sequence 5777.t.........._________578852
AB046218.1 Measles virus genomic RNA, complete sequence 2233..........___________224247
AB046218.1 Measles virus genomic RNA, complete sequence 6172..........___________618147
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy9796.....................9816100
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy2233..........___________224247
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy6172..........___________618147
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy9796.....................9816100
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy2233..........___________224247
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy9796.....................9816100
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy4884___.a.c.........c.___489857
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy9796.....................9816100
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy2233..........___________224247
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy6172..........___________618147
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy9796.....................9816100
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy2233..........___________224247
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy6172..........___________618147
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy9796.....................9816100
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy2233..........___________224247
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy6172..........___________618147
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy9796.....................9816100
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy2233..........___________224247
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy6172..........___________618147
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 9796.....................9816100
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 5777.t.........._________578852
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 2233..........___________224247
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 6172..........___________618147
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 9796.....................9816100
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 5777.t.........._________578852
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 2233..........___________224247
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 6172..........___________618147
AY730614.1 Measles virus strain Leningrad-4, complete genome 9796.....................9816100
AY730614.1 Measles virus strain Leningrad-4, complete genome 5777.t.........._________578852
AY730614.1 Measles virus strain Leningrad-4, complete genome 2233..........___________224247
AY730614.1 Measles virus strain Leningrad-4, complete genome 6172..........___________618147
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 9796.....................9816100
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 5777............_________578857
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 4884___.a.c........._____489652
DQ345721.1 Measles virus strain CAM-70, complete genome 9796.....................9816100
DQ345721.1 Measles virus strain CAM-70, complete genome 5777.t.........._________578852
DQ345721.1 Measles virus strain CAM-70, complete genome 2233..........___________224247
DQ345721.1 Measles virus strain CAM-70, complete genome 6172..........___________618147
DQ345722.1 Measles virus strain CAM-70, complete genome 9796.....................9816100
DQ345722.1 Measles virus strain CAM-70, complete genome 5777.t.........._________578852
DQ345722.1 Measles virus strain CAM-70, complete genome 2233..........___________224247
DQ345722.1 Measles virus strain CAM-70, complete genome 6172..........___________618147
DQ345723.1 Measles virus strain CAM-70, complete genome 9796.....................9816100
DQ345723.1 Measles virus strain CAM-70, complete genome 5777.t.........._________578852
DQ345723.1 Measles virus strain CAM-70, complete genome 2233..........___________224247
DQ345723.1 Measles virus strain CAM-70, complete genome 6172..........___________618147
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 9796.....................9816100
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 5778.t.........._________578952
EF033071.1 Measles virus strain Changchun-47, complete genome 9796.....................9816100
EF033071.1 Measles virus strain Changchun-47, complete genome 5777.t.........._________578852
EF033071.1 Measles virus strain Changchun-47, complete genome 2233..........___________224247
EF033071.1 Measles virus strain Changchun-47, complete genome 6172..........___________618147
EU435017.1 Measles virus strain Shanghai-191, complete genome 9796.....................9816100
EU435017.1 Measles virus strain Shanghai-191, complete genome 5777.t.........._________578852
EU435017.1 Measles virus strain Shanghai-191, complete genome 2233..........___________224247
EU435017.1 Measles virus strain Shanghai-191, complete genome 6172..........___________618147
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 9796.....................9816100
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 5777.t.........._________578852
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 4884___.a.c.........c.___489857
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 9796.....................9816100
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 5777.t.........._________578852
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 4884___.a.c.........c.___489857
AF266288.2 Measles virus strain Edmonston, complete genome 9796.....................9816100
AF266288.2 Measles virus strain Edmonston, complete genome 5777.t.........._________578852
AF266288.2 Measles virus strain Edmonston, complete genome 2233..........___________224247
AF266288.2 Measles virus strain Edmonston, complete genome 6172..........___________618147
NC_001498.1 Measles virus, complete genome 9796.....................9816100
NC_001498.1 Measles virus, complete genome 5777.t.........._________578852
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy9796................a....981695
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy5777.t.........._________578852
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 9796........t............981695
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 5777.t.........._________578852
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 9796........t............981695
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 5778.t.........._________578952
DQ227319.1 Measles virus isolate 97-45881, complete genome 9796........t............981695
DQ227319.1 Measles virus isolate 97-45881, complete genome 5777.t.........._________578852
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome9796........t............981695
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome5777.t.........._________578852
EU293548.1 Measles virus isolate D-V/S, complete genome 9796..........a..........981695
EU293548.1 Measles virus isolate D-V/S, complete genome 5777.t.........._________578852
EU293549.1 Measles virus isolate D-CEF, complete genome 9796..........a..........981695
EU293549.1 Measles virus isolate D-CEF, complete genome 5777.t.........._________578852
EU293550.1 Measles virus isolate Davis87, complete genome 9796..........a..........981695
EU293550.1 Measles virus isolate Davis87, complete genome 5777.t.........._________578852
EU293551.1 Measles virus isolate D-VI, complete genome 9796..........a..........981695
EU293551.1 Measles virus isolate D-VI, complete genome 5777.t.........._________578852
EU293552.1 Measles virus isolate D-VII, complete genome 9796..........a..........981695
EU293552.1 Measles virus isolate D-VII, complete genome 5777.t.........._________578852