../../tmp/servers/virsirnadb/1571142934
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi19251ggcatcagtgtgctcagttga21
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 193.....................213100
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 12222.........a.t.aa..____1223861
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 7772___________........._776442
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 193.....................213100
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 12223.........a.t.aa..____1223961
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 7772___________........._776442
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 193.....................213100
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 12222.........a.t.aa..____1223861
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 7772___________........._776442
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 193.....................213100
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 12223.........a.t.aa..____1223961
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 193.....................213100
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 12222.........a.t.aa..____1223861
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 7772___________........._776442
NC_002549.1 Zaire ebolavirus, complete genome 193.....................213100
NC_002549.1 Zaire ebolavirus, complete genome 12222.........a.t.aa..____1223861
NC_002549.1 Zaire ebolavirus, complete genome 7772___________........._776442
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 10745__....ctca.........._1072866
NC_006432.1 Sudan ebolavirus, complete genome 10745__....ctca.........._1072866
NC_014372.1 Cote d'Ivoire ebolavirus 7417...gg........._______740457
NC_014372.1 Cote d'Ivoire ebolavirus 11624___.........a..______1163552
NC_014372.1 Cote d'Ivoire ebolavirus 9914_..........__________992347
NC_014373.1 Bundibugyo ebolavirus, complete genome 10782_.....ttcaa........._1076466
NC_014373.1 Bundibugyo ebolavirus, complete genome 3927__.c.........c.t.a.__394361
NC_014373.1 Bundibugyo ebolavirus, complete genome 11680__________.c.........1169047