../../tmp/servers/virsirnadb/453281762
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi22771ggcgcagcttcgacgtcatat21
EF407439.1 Hepatitis C virus isolate 8003 polyprotein gene, complete cds 1051.a...................107195
EU482873.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V28/2003, complete1017.a...................103795
EU155284.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V317/2001, complet1040..................c..106095
EU155286.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V319/2001, complet1001.a...................102195
EU155342.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V197/1989, complet1001.a...................102195
EU255950.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V241/2005, complet1024.a...................104495
EU255958.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V265/2005, complet1032.a...................105295
EU256094.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V74/2004, complete1033.a...................105395
EU256025.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V79/2002, complete1002..................c..102295
FJ024087.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1705/2007, comple1033..................c..105395
FJ390399.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1751/2007, comple977...............g.....99795
EU862839.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V175/1990, complet1034.a...................105495
M67463.1HPCCGAA Hepatitis C virus subtype 1a, complete genome 1108__...................112690
AF011751.1 Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds 1108__...................112690
AF011752.1 Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds 1108__...................112690
AF011753.1 Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds 1108__...................112690
AF290978.1 Hepatitis C virus subtype 1a isolate colonel, complete genome 1096__...................111490
AF511950.1 Hepatitis C virus isolate XF224 polyprotein-like gene, complete seque1080__...................109890
EU363761.1 Recombinant Hepatitis C virus H77C/JFH1, complete genome 1107__...................112590
EU155272.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V404/2006, complet1004__...................102290
EU155313.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V413/2003, complet1016__...................103490
EU155319.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V424/2002, complet986__...................100490
EU155346.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V236/2005, complet1030__...................104890
EU529677.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V52/2006, complete1036__...................105490
EU529681.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V251/2005, complet1024__...................104290
EU256044.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V378/2001, complet1013__...................103190
EU256049.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V395/2006, complet1034__...................105290
EU256051.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V4/2005, complete 1030__...................104890
EU256070.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V232/2003, complet1027__...................104590
EU256074.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V264/2005, complet1032__...................105090
EU255973.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V180/1990, complet1029__...................104790
AF009606.1 Hepatitis C virus subtype 1a polyprotein gene, complete cds 1108__...................112690
EF407424.1 Hepatitis C virus isolate 5069 polyprotein gene, partial cds 1031_.................c..105090
EF407441.1 Hepatitis C virus isolate 1036 polyprotein gene, complete cds 1066_.................c..108590
EF407445.1 Hepatitis C virus isolate 5009 polyprotein gene, complete cds 1028_.................c..104790
EU234063.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V177/1992, complet1028_.................c..104790
EU255981.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V191/1990, complet1040_.................c..105990
EU155265.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V388/2005, complet1029___..................104685
D10749.1HPCHCJ1 Hepatitis C virus genomic RNA, complete genome, isolate: HC-J11106.a................c..112690
M62321.1HPCPLYPRE Hepatitis C virus subtype 1a, complete genome 1106.a................c..112690
AF271632.1 Hepatitis C virus subtype 1a clone pHCV-1/SF9 A, complete genome 1106.a................c..112690
EF407431.1 Hepatitis C virus isolate 3005 polyprotein gene, complete cds 1004.a................c..102490
EF407436.1 Hepatitis C virus isolate 7040 polyprotein gene, complete cds 1011.a................c..103190
EF407455.1 Hepatitis C virus isolate 7065 polyprotein gene, complete cds 1066.a................c..108690
EU155241.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V71/2002, complete1002.a.............g.....102290
EU362880.1 Hepatitis C virus isolate 2011_FU24 polyprotein (pol) gene, partial c1027.a................c..104790
EU362891.1 Hepatitis C virus isolate 7003_FU24 polyprotein (pol) gene, partial c1028.a................c..104890
EU362893.1 Hepatitis C virus isolate 7040_FU24 polyprotein (pol) gene, complete 1014.a................c..103490
EU362897.1 Hepatitis C virus isolate 7065_FU24 polyprotein (pol) gene, complete 1065.a................c..108590
EU239715.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V423/2003, complet1032.a................c..105290
EU155213.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V101/2004, complet1035.a................c..105590
EU482836.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V506/2002, complet1037.a................c..105790
EU482842.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V389/2006, complet1011.a................c..103190
EU482850.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V186/1990, complet1001.a................c..102190
EU482863.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V456/2006, complet1036.a................c..105690
EU482865.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V46/2003, complete1012.a.............g.....103290
EU155251.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V359/2006, complet1017.a................c..103790
EU155275.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V409/2006, complet1026.a................c..104690
EU155289.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V323/2001, complet1032.a................c..105290
EU155298.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V334/2002, complet1036.a................c..105690
EU155312.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V412/2000, complet1014.a................c..103490
EU155323.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V429/2002, complet1017.a................c..103790
EU155351.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V257/2003, complet1027.a................c..104790
EU155380.2 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V35/2004, complete1011.a.............c.....103190
EU569722.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V215/1989, complet1040.a................c..106090
EU660385.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V258/2003, complet1015.a................c..103590
EU687193.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V1562/2005, comple1001.a................c..102190
EU255928.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V231/2003, complet1032.a................c..105290
EU255933.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V112/2003, complet1014.a................c..103490
EU255955.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V254/2002, complet1015.a................c..103590
EU255959.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V268/2003, complet999.a.......g...........101990
EU256105.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V505/2001, complet1056.a.................g.107690
EU256004.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V45/2005, complete1013.a................c..103390
EU256005.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V451/2006, complet1034.a................c..105490
EU256006.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V452/2006, complet1040.a................c..106090
EU256015.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V57/2004, complete1024.a................c..104490
EU256026.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V82/2002, complete1037.a................c..105790
EU256037.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V98/2004, complete1039.a.............a.....105990
EU256048.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V394/2006, complet1032.a................c..105290
EU256050.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V397/2006, complet1033.a................c..105390
EU256058.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V8/2005, complete 1018.a................c..103890
EU255966.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V170/1997, complet1037.a.............c.....105790
EU255976.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V184/1992, complet1027.a................c..104790
EU255977.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V187/1991, complet1031.a................c..105190
EU255980.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V190/1990, complet1024.a................c..104490
EU255982.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V194/1990, complet1030.a................c..105090
EU255984.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V200/1990, complet1018.a................c..103890
EU255986.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V203/1989, complet1033.a................c..105390
FJ024275.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1708/2007, comple998.a................c..101890
FJ024276.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1710/2007, comple998.a.............a.....101890
FJ024280.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1717/2007, comple1015.a................c..103590
EU862823.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V24/2003, complete1011.a................c..103190
FJ205867.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1709/2007, comple1054.a.............c.....107490
FJ410172.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1746/2008, comple1000.a................c..102090
AJ278830.1 Hepatitis C virus genomic RNA for polyprotein gene 1108__................c..112685
AF511948.1 Hepatitis C virus isolate XF222 polyprotein-like gene, complete seque1108__................c..112685
AF511949.1 Hepatitis C virus isolate XF223 polyprotein-like gene, complete seque1108__................c..112685
EF032883.1 Hepatitis C virus subtype 1a isolate 03-32_P1_10.16.03 polyprotein ge1030__................c..104885
EF032884.1 Hepatitis C virus subtype 1a isolate 03-32_P2_5.14.04 polyprotein gen1009__................c..102785
EF032885.1 Hepatitis C virus subtype 1a isolate 03-32_P4_11.5.05 polyprotein gen1029__................c..104785
EF621489.1 Hepatitis C virus subtype 1a strain HC-TN, complete genome 1108__................c..112685
EF407411.1 Hepatitis C virus isolate 5043 polyprotein gene, complete cds 1014__................c..103285
EF407413.1 Hepatitis C virus isolate 5012 polyprotein gene, complete cds 1055__................c..107385
EF407415.1 Hepatitis C virus isolate 3018 polyprotein gene, complete cds 1058__................c..107685
EF407418.1 Hepatitis C virus isolate 7020 polyprotein gene, complete cds 1052__................c..107085
EF407419.1 Hepatitis C virus isolate 5003 polyprotein gene, complete cds 1059__................c..107785
EF407421.1 Hepatitis C virus isolate 8030 polyprotein gene, complete cds 1011__................c..102985
EF407422.1 Hepatitis C virus isolate 6001 polyprotein gene, complete cds 1014__................c..103285
EF407426.1 Hepatitis C virus isolate 8070 polyprotein genomic sequence 1057__................c..107585
EF407427.1 Hepatitis C virus isolate 6025 polyprotein gene, complete cds 1055__................c..107385
EF407428.1 Hepatitis C virus isolate 1024 polyprotein gene, complete cds 1014__................c..103285
EF407432.1 Hepatitis C virus isolate 1013 polyprotein gene, complete cds 1069__................c..108785
EF407434.1 Hepatitis C virus isolate 2011 polyprotein gene, complete cds 1030__................c..104885
EF407435.1 Hepatitis C virus isolate 5014 polyprotein gene, complete cds 1025__................c..104385
EF407437.1 Hepatitis C virus isolate 1030 polyprotein gene, complete cds 1068__................c..108685
EF407440.1 Hepatitis C virus isolate 7002 polyprotein gene, complete cds 1056__.............g.....107485
EF407444.1 Hepatitis C virus isolate 6030 polyprotein gene, complete cds 1029__................c..104785
EF407448.1 Hepatitis C virus isolate 6018 polyprotein gene, partial cds 1068__................c..108685
EF407449.1 Hepatitis C virus isolate 2027 polyprotein gene, complete cds 1068__................c..108685
EF407450.1 Hepatitis C virus isolate 6020 polyprotein gene, complete cds 1026__................c..104485
EF407457.1 Hepatitis C virus isolate 1003 polyprotein gene, complete cds 912__................c..93085
EU155294.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V329/2002, complet1002__................c..102085
EU155345.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V221/2002, complet1016__................c..103485
EU155350.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V256/2003, complet989__................c..100785
EU260395.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V10/2005, complete1041__................c..105985
EU362877.1 Hepatitis C virus isolate 1024_FU24 polyprotein (pol) gene, complete 1013__................c..103185
EU362878.1 Hepatitis C virus isolate 1030_FU24 polyprotein (pol) gene, partial c1068__................c..108685
EU362881.1 Hepatitis C virus isolate 2027_FU24 polyprotein (pol) gene, partial c1069__................c..108785
EU362882.1 Hepatitis C virus isolate 3005_FU24 polyprotein (pol) gene, complete 1027__................c..104585
EU362885.1 Hepatitis C virus isolate 5009_FU24 polyprotein (pol) gene, partial c1026__................c..104485
EU362887.1 Hepatitis C virus isolate 6020_FU24 polyprotein (pol) gene, complete 1026__................c..104485
EU362890.1 Hepatitis C virus isolate 7002_FU24 polyprotein (pol) gene, partial c1067__.............g.....108585
EU362895.1 Hepatitis C virus isolate 7043_FU24 polyprotein (pol) gene, complete 1026__................c..104485
EU362898.1 Hepatitis C virus isolate 8012_FU24 polyprotein (pol) gene, complete 1012__................c..103085
EU362899.1 Hepatitis C virus isolate 1013q polyprotein (pol) gene, partial cds 1069__................c..108785
EU362900.1 Hepatitis C virus isolate 1030q polyprotein (pol) gene, partial cds 1068__................c..108685
EU362901.1 Hepatitis C virus isolate 2011q polyprotein (pol) gene, complete cds 1030__................c..104885
EU362902.1 Hepatitis C virus isolate 2027q polyprotein (pol) gene, partial cds 1068__................c..108685
EU362907.1 Hepatitis C virus isolate 7002q polyprotein (pol) gene, complete cds 1056__.............g.....107485
EU260396.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V11/2004, complete1011__................c..102985
EU234064.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V182/1990, complet1022__................c..104085
EU155215.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V105/2004, complet1003__.............g.....102185
EU155238.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V465/2007, complet1034__.............g.....105285
EU155239.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V54/2004, complete1026__.............g.....104485
EU155242.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V73/2004, complete1025__................c..104385
EU155243.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V86/2005, complete1003__................c..102185
EU155244.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V90/2005, complete1049__................c..106785
EU482831.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V25/2003, complete1014__................c..103285
EU482832.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V33/2004, complete1018__................c..103685
EU482835.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V427/2002, complet1041__................c..105985
EU482837.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V17/2004, complete1025__.............g.....104385
EU482838.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V361/2006, complet1040__................c..105885
EU482840.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V386/2004, complet1046__................c..106485
EU482843.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V435/2005, complet1035__................c..105385
EU482844.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V436/2006, complet1042__................c..106085
EU482845.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V438/2006, complet1041__................c..105985
EU482846.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V439/2000, complet1038__................c..105685
EU482847.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V5/2004, complete 1025__................c..104385
EU482848.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V9/2005, complete 1010__.....t.............102885
EU482852.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V217/1989, complet1025__................c..104385
EU482853.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V227/2005, complet1027__................c..104585
EU482854.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V242/2001, complet1025__................c..104385
EU482855.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V249/2002, complet1019__................c..103785
EU482857.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V263/2005, complet1025__.............c.....104385
EU482858.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V271/2006, complet1032__................c..105085
EU482866.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V460/2006, complet1041__.............g.....105985
EU482867.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V461/2006, complet1041__................c..105985
EU482868.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V69/2002, complete1025__.............g.....104385
EU482869.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V70/2002, complete1025__................c..104385
EU482871.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V77/2002, complete1017__................c..103585
EU482872.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V261/2004, complet1034__.t.................105285
EU482882.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V410/2006, complet1018__.............g.....103685
EU482884.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V38/2004, complete792__................c..81085
EU482887.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V66/2002, complete1003__.............g.....102185
EU482889.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V179/1990, complet1035__................c..105385
EU155248.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V336/2006, complet1026__................c..104485
EU155268.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V396/2006, complet1003__................c..102185
EU155270.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V399/2006, complet1025__................c..104385
EU155273.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V406/2006, complet977__.......g...........99585
EU155274.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V407/2006, complet979__................c..99785
EU155276.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V432/2002, complet1027__................c..104585
EU155282.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V696/2006, complet1025__................c..104385
EU155285.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V318/2001, complet1016__................c..103485
EU155291.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V326/2002, complet1027__................c..104585
EU155293.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V328/2001, complet978__................c..99685
EU155295.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V331/2002, complet1027__................c..104585
EU155296.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V332/2002, complet1024__................c..104285
EU155299.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V335/2003, complet1024__................c..104285
EU155310.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V357/2004, complet1023__..........g........104185
EU155314.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V414/2004, complet982__................c..100085
EU155320.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V425/2001, complet979__................c..99785
EU155321.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V426/2001, complet982__................c..100085
EU155322.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V428/2001, complet1022__................c..104085
EU155338.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V169/1996, complet1026__................c..104485
EU155341.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V192/1992, complet1036__................c..105485
EU155343.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V214/1996, complet1027__................c..104585
EU155344.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V216/1990, complet1014__................c..103285
EU155348.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V240/2005, complet1017__................c..103585
EU155349.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V246/2005, complet1015__................c..103385
EU155352.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V262/2004, complet1034__................c..105285
EU234065.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V212/1990, complet1003__................c..102185
EU529676.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V39/2004, complete1040__................c..105885
EU529679.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V76/2002, complete1021__................c..103985
EU529680.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V80/2002, complete1039__................c..105785
EU595697.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V507/2001, complet1024__.............c.....104285
EU595698.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V44/2001, complete1025__.......c...........104385
EU660383.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V100/2004, complet1034__................c..105285
EU660387.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V701/2003, complet1025__................c..104385
EU255927.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V222/2003, complet1029__................c..104785
EU255929.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V233/2004, complet1034__................c..105285
EU255930.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V237/2005, complet1034__................c..105285
EU255931.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V108/2003, complet1034__................c..105285
EU255932.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V111/2005, complet1034__.............g.....105285
EU255934.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V453/2006, complet1042__................c..106085
EU255935.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V462/2007, complet1038__................c..105685
EU255944.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V224/2003, complet1010__................c..102885
EU255945.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V225/2004, complet1027__................c..104585
EU255946.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V226/2005, complet1035__................c..105385
EU255949.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V235/2005, complet1034__................c..105285
EU255957.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V260/2004, complet1056__................c..107485
EU256060.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V360/2006, complet1028__................c..104685
EU256086.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V110/2003, complet1006__................c..102485
EU256095.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V81/2002, complete1038__.............g.....105685
EU256107.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V36/2004, complete1035__................c..105385
EU255993.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V102/2004, complet1034__................c..105285
EU255996.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V107/2003, complet1039__................c..105785
EU255997.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V109/2003, complet1005__.............g.....102385
EU255998.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V113/2001, complet1035__.............g.....105385
EU255999.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V116/2002, complet1021__.......c...........103985
EU256007.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V464/2006, complet1024__................c..104285
EU256009.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V49/2004, complete1021__................c..103985
EU256010.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V50/2002, complete1003__................c..102185
EU256011.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V51/2004, complete1003__................c..102185
EU256012.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V511/2006, complet1042__.............g.....106085
EU256018.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V60/2002, complete1023__................c..104185
EU256019.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V61/2001, complete1030__................c..104885
EU256021.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V64/2003, complete1026__................c..104485
EU256022.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V65/2003, complete1025__................c..104385
EU256023.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V67/2003, complete1034__................c..105285
EU256028.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V84/2001, complete1034__................c..105285
EU256029.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V85/2001, complete1021__................c..103985
EU256030.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V87/2002, complete1017__.............g.....103585
EU256032.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V92/2003, complete1032__................c..105085
EU256033.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V94/2005, complete1035__................c..105385
EU256034.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V95/2006, complete1035__................c..105385
EU256035.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V96/2004, complete1034__................c..105285
EU256040.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V18/2004, complete1034__................c..105285
EU256041.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V2/2005, complete 1039__................c..105785
EU256046.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V392/2006, complet1034__................c..105285
EU256055.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V6/2001, complete 1030__................c..104885
EU256056.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V7/2003, complete 1005__................c..102385
EU256057.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V702/2006, complet1042__................c..106085
EU256069.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V229/2006, complet1015__................c..103385
EU256071.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V234/2004, complet1003__................c..102185
EU256072.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V238/2005, complet1015__................c..103385
EU255965.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V168/1990, complet1032__................c..105085
EU255969.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V174/1992, complet1030__................c..104885
EU255970.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V176/1992, complet1026__................c..104485
EU255975.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V183/1994, complet1033__................c..105185
EU255979.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V189/1991, complet1035__................c..105385
EU255983.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V195/1990, complet1027__................c..104585
EU255987.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V205/1989, complet1016__................c..103485
EU255988.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V206/1995, complet1024__................c..104285
EU255989.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V208/1990, complet1041__................c..105985
EU255990.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V209/1992, complet1033__.............g.....105185
EU255991.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V210/1989, complet1023__................c..104185
EU255992.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V213/1992, complet1029__................c..104785
FJ024274.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1707/2007, comple961__................c..97985
FJ024282.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1719/2005, comple1020__................c..103885
EU862824.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V31/2004, partial 1025__................c..104385
EU862826.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V198/1989, partial1025__................c..104385
FJ182000.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1712/2007, comple1002__................c..102085
FJ182001.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1716/2007, comple1026__.............c.....104485
FJ205868.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1714/2007, comple1012__.............g.....103085
FJ205869.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1720/2006, comple1002__.............g.....102085
FJ390394.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1745/2008, comple1018__................c..103685
FJ390395.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1747/2008, comple995__................c..101385
EU781804.1 Hepatitis C virus subtype 1a isolate 02-46, complete genome 1023__................c..104185
EU781823.1 Hepatitis C virus subtype 1a isolate 03-12, complete genome 1031__................c..104985
AB520610.1 Hepatitis C virus subtype 1a genomic RNA, complete genome, strain: HC1108__................c..112685
EU862832.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V27/2003, complete1022__................c..104085
EU862836.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V244/2003, complet1034__..............t....105285
EU862838.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V165/1992, complet1045__................c..106385
EU862841.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V48/2003, complete1023__................c..104185
EF407414.1 Hepatitis C virus isolate 7018 polyprotein gene, complete cds 1010_..............a..c..102985
EF407438.1 Hepatitis C virus isolate 7012 polyprotein gene, complete cds 1054_.t...............c..107385
EF407453.1 Hepatitis C virus isolate 4035 polyprotein gene, complete cds 1054_..............c..c..107385
EU362884.1 Hepatitis C virus isolate 4035_FU24 polyprotein (pol) gene, complete 1069_..............c..c..108885
EU362892.1 Hepatitis C virus isolate 7012_FU24 polyprotein (pol) gene, complete 1052_.t...............c..107185
EU155249.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V337/2006, complet1024_..............c..c..104385
EU256068.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V405/2006, complet1027_.t...............c..104685
EU256036.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V97/2004, complete1033_.a...............c..105285
EU155252.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V362/2006, complet1026___...............c..104380
EU155340.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V185/1991, complet1004___............g.....102180
EU595699.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V78/2001, complete1018___...............c..103580
EU255937.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V700/2006, complet1026___...............c..104380
EU256014.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V56/2004, complete1004___............g.....102180
EU862840.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V40/2003, complete1050___............g.....106780
EU781824.1 Hepatitis C virus subtype 1a isolate DN14, complete genome 1015__................___103076
EU155233.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V445/2006, complet1033.a.a..............c..105385
EU155288.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V322/2002, complet1023.a.............c..c..104385
EU529678.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V63/2005, complete1020.a.............g..c..104085
EU569723.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V13/2005, complete1025.a.............c..c..104585
EU255940.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V433/2006, complet1039.a.............c..c..105985
EU255941.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V697/2006, complet1038.a.............c..c..105885
EU256002.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V41/2006, complete1047.a.a..............c..106785
EU256024.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V72/2006, complete1001.a...c............c..102185
FJ024278.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1713/2007, comple1000.a.............c..c..102085
FJ024281.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1718/2007, comple1030.a.............c..c..105085
GQ149768.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V2147/2002, comple1017.a.c..............c..103785
EF407417.1 Hepatitis C virus isolate 4040 polyprotein gene, complete cds 1067__.............c..c..108580
EF407425.1 Hepatitis C virus isolate 6071 polyprotein gene, complete cds 1022__.............a..c..104080
EF407442.1 Hepatitis C virus isolate 8012 polyprotein gene, complete cds 1022__.............c..c..104080
EF407446.1 Hepatitis C virus isolate 8009 polyprotein gene, complete cds 1029__.............c..c..104780
EF407456.1 Hepatitis C virus isolate 4025 polyprotein gene, complete cds 1067__.............c..c..108580
EU362876.1 Hepatitis C virus isolate 1013_FU24 polyprotein (pol) gene, complete 1067__.............c..c..108580
EU362883.1 Hepatitis C virus isolate 4025_FU24 polyprotein (pol) gene, partial c1067__.............c..c..108580
EU362886.1 Hepatitis C virus isolate 5014_FU24 polyprotein (pol) gene, complete 1030__.............c..c..104880
EU362903.1 Hepatitis C virus isolate 4025q polyprotein (pol) gene, partial cds 1067__.............c..c..108580
EU239713.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V316/2001, complet1056__.............a..c..107480
EU250017.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V508/2001, complet1025__.............a..c..104380
EU155236.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V450/2006, complet999__..g.............c..101780
EU155237.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V457/2006, complet1049__.............c..c..106780
EU155240.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V68/2004, complete1026__.............c..c..104480
EU155245.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V91/2003, complete1026__.a..............c..104480
EU155246.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V93/2003, complete1027__.a..............c..104580
EU482861.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V446/2006, complet1034__.a..............c..105280
EU482864.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V459/2006, complet1041__.............g...g.105980
EU482870.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V75/2004, complete1049__.............g..c..106780
EU482876.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V330/2002, complet1034__....c...........c..105280
EU482878.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V19/2004, complete1034__.............c..c..105280
EU155247.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1/2005, complete 1032__.............c..c..105080
EU155250.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V358/2006, complet1033__..........g..g.....105180
EU155266.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V390/2006, complet977__.............c..c..99580
EU155267.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V391/2006, complet1014__.............a..c..103280
EU155269.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V398/2006, complet1027__..........g.....c..104580
EU155271.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V401/2006, complet1030__.............a..c..104880
EU155277.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V434/2003, complet1003__.............c..c..102180
EU155278.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V437/2006, complet1018__.............c..c..103680
EU155283.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V698/2006, complet1041__.............c..c..105980
EU155292.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V327/2001, complet1035__..........g.....c..105380
EU155297.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V333/2002, complet1024__..............t.c..104280
EU155311.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V411/2003, complet1034__.............c..c..105280
EU155353.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V267/2005, complet1026__.............c..c..104480
EU155354.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V269/2005, complet1033__.............c..c..105180
EU155355.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V270/2006, complet1032__..........g.....c..105080
EU660384.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V55/2005, complete1056__.a..............c..107480
EU687194.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V1563/2004, comple1035__.............c..c..105380
EU687195.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V1564/2007, comple1042__..........g.....c..106080
EU255936.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V510/2006, complet1035__..............t.c..105380
EU255938.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V88/2003, complete1040__.............c..c..105880
EU255939.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V408/2006, complet1027__..........g.....c..104580
EU255943.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V223/2003, complet1027__.a..............c..104580
EU255947.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V228/2006, complet1041__.a..............c..105980
EU255948.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V230/2003, complet1036__.............c..c..105480
EU255953.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V248/2006, complet1031__.............c..c..104980
EU255956.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V259/2003, complet1035__.............c..c..105380
EU256067.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V402/2006, complet1035__..........g.....c..105380
EU256104.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V430/2005, complet1025__.............c..c..104380
EU256106.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V32/2004, complete1026__..........g.....c..104480
EU155347.2 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V239/2005, complet1019__.............c..c..103780
EU255994.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V103/2005, complet1018__.............c..c..103680
EU255995.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V106/2004, complet1033__.............c..c..105180
EU256008.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V47/2002, complete1003__....a...........c..102180
EU256013.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V53/2004, complete1032__.............c..c..105080
EU256017.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V59/2005, complete1030__.............c..c..104880
EU256020.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V62/2003, complete1032__.............a..c..105080
EU256031.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V89/2006, complete1032__...............gc..105080
EU256038.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V99/2004, complete1039__.............g..c..105780
EU256039.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V16/2004, complete1027__.............a..c..104580
EU256043.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V3/2005, complete 1003__.............c..c..102180
EU256052.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V403/2006, complet1033__.............c..c..105180
EU256053.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V440/2001, complet1035__.a..............c..105380
EU255964.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V167/1992, complet1018__.............c..c..103680
EU255967.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V171/1997, complet1013__.............c..c..103180
EU255978.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V188/1991, complet1022__.............c..c..104080
EU255985.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V201/1991, complet1037__..........g.....c..105580
FJ181999.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1706/2007, comple1019__.............c..c..103780
EU862828.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V12/2004, complete1041__.............c..c..105980
EF407433.1 Hepatitis C virus isolate 7046 polyprotein gene, complete cds 1060___............c..c..107776
EF407443.1 Hepatitis C virus isolate 7024 polyprotein gene, complete cds 1069___...a...........c..108676
EF407454.1 Hepatitis C virus isolate 6031 polyprotein gene, complete cds 1021___.........g.....c..103876
EU362896.1 Hepatitis C virus isolate 7046_FU24 polyprotein (pol) gene, complete 1068___............c..c..108576
EU255954.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V252/2002, complet1034___............g..c..105176
EU256003.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V444/2006, complet1042___............g..c..105976
EU255951.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V245/2005, complet1038.a.a.............gc..105880
EU155214.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V104/2005, complet1034__..........g..c..c..105276
AY878651.1 Hepatitis C virus subtype 6k isolate KM41, complete genome 3124_.........g....._____311066
DQ278893.1 Hepatitis C virus subtype 6k isolate KM41, complete genome 3156_.........g....._____314266
EU158186.1 Hepatitis C virus isolate NK46, complete genome 7460............_________747157
EU798761.1 Hepatitis C virus subtype 6v isolate KM046 polyprotein precursor, gen7460............_________747157