../../tmp/servers/virsirnadb/1053309719
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi14991gggagcattgacacatgtgca21
AF221499.1 Japanese encephalitis virus isolate CH2195LA, complete genome 1308.....................1328100
AF221500.1 Japanese encephalitis virus isolate CH2195SA, complete genome 1308.....................1328100
AY303793.1 Japanese encephalitis virus strain CJN-S1, complete genome 1308.....................1328100
AY303794.1 Japanese encephalitis virus strain CJN-L1, complete genome 1308.....................1328100
AY303795.1 Japanese encephalitis virus strain CC27-L1, complete genome 1308.....................1328100
AY303796.1 Japanese encephalitis virus strain CC27-L3, complete genome 1308.....................1328100
AY303797.1 Japanese encephalitis virus strain CC27-S6, complete genome 1308.....................1328100
AY303798.1 Japanese encephalitis virus strain CC27-S8, complete genome 1308.....................1328100
D90195.1JEVSAA Japanese encephalitis virus strain SA(A) genomic RNA, complete 1308..a..................132895
D90194.1JEVSAV Japanese encephalitis virus strain SA(V) genomic RNA, complete 1308..a..................132895
M55506.1JEVCMNAA Japanese encephalitis SA-14 virus, complete genome 1308..a..................132895
U14163.1JEU14163 Japanese encephalitis virus SA14 polyprotein mRNA, complete c1308..a..................132895
U15763.1JEU15763 Japanese encephalitis virus C, prM, M, E, NS1, NS2A, NS2B, NS1308..a..................132895
AF014160.1 Japanese encephalitis virus polyprotein gene, complete cds 1308..a..................132895
AF014161.1 Japanese encephalitis virus polyprotein gene, complete cds 1308..a..................132895
AF075723.1 Japanese encephalitis virus strain GP78, complete genome 1308..a..................132895
AF080251.1 Japanese encephalitis virus isolate Vellore P20778, complete genome 1308..a..................132895
AF098735.1 Japanese encephalitis virus strain HVI, complete genome 1308..a..................132895
AF098736.1 Japanese encephalitis virus strain TC, complete genome 1308..a..................132895
AF098737.1 Japanese encephalitis virus strain TL, complete genome 1308..a..................132895
AF069076.1 Japanese encephalitis virus JaGAr 01 complete genome 1308..a..................132895
AF217620.1 Japanese encephalitis virus FU strain, complete genome 1308..a..................132895
AF315119.1 Japanese encephalitis virus strain SA14-14-2, complete genome 1308..a..................132895
AF416457.1 Japanese encephalitis virus attenuated strain SA14-12-1-7, complete g1308..a..................132895
AF486638.1 Japanese encephalitis virus strain YL polyprotein mRNA, complete cds 1308..a..................132895
AF254452.1 Japanese encephalitis virus strain CH1392 complete genome 1308..a..................132895
AF254453.1 Japanese encephalitis virus strain T1P1 complete genome 1308..a..................132895
AY303791.1 Japanese encephalitis virus strain T1P1-S1, complete genome 1308..a..................132895
AY303792.1 Japanese encephalitis virus strain T1P1-L4, complete genome 1308..a..................132895
AY508812.1 Japanese encephalitis virus strain ML17 (live vaccine)/Japan/1981/hum1308..a..................132895
AY508813.1 Japanese encephalitis virus strain JaOH0566/Japan/1966/human, complet1308..a..................132895
AY585242.1 Japanese encephalitis virus strain K87P39, complete genome 1308..a..................132895
AY585243.1 Japanese encephalitis virus CNU/LP2, complete genome 1308..a..................132895
AB196923.1 Japanese encephalitis virus genomic RNA, complete genome, clone:JEV-A1308..a..................132895
AB196924.1 Japanese encephalitis virus genomic RNA, complete genome, clone:JEV-a1308..a..................132895
AB196925.1 Japanese encephalitis virus genomic RNA, complete genome, clone:JEV-r1308..a..................132895
AB196926.1 Japanese encephalitis virus genomic RNA, complete genome, clone:JEV-A1308..a..................132895
EF543861.1 Japanese encephalitis virus strain SH0601, complete genome 1308..a..................132895
EF571853.1 Japanese encephalitis virus strain Nakayama, complete genome 1308..a..................132895
EF623987.1 Japanese encephalitis virus isolate 014178, complete genome 1308..a..................132895
EF623988.1 Japanese encephalitis virus isolate 057434, complete genome 1308..a..................132895
EF623989.1 Japanese encephalitis virus isolate 04940-4, complete genome 1308..a..................132895
GQ199609.1 Japanese encephalitis virus clone CNU/LP2x, complete genome 1308..a..................132895
AB551990.1 Japanese encephalitis virus RNA, complete genome, strain: JaTAn1/75 1308..a..................132895
AB551991.1 Japanese encephalitis virus RNA, complete genome, strain: JaTAn1/90 1308..a..................132895
AB551992.1 Japanese encephalitis virus RNA, complete genome, strain: JaTAn2/91 1308..a..................132895
GQ918133.2 Japanese encephalitis virus strain NJ 2008, complete genome 1308..a..................132895
GU205163.1 Japanese encephalitis virus strain 131V, complete genome 1309..a..................132995
GQ902063.1 Japanese encephalitis virus strain KPP82-39-214CT, complete genome 1309..a..................132995
M18370.1JEVCG Japanese encephalitis virus (strain JaOArS982), complete genome 1308..a..................132895
AY184212.1 Japanese encephalitis virus strain JKT6468 polyprotein gene, complete1308..a................._132790
L48961.1JEVBEICG Japanese encephalitis virus (strain Beijing-1), complete geno1308..a..t...............132890
U47032.1JEU47032 Japanese encephalitis virus strain p3, complete genome 1308..a........t.........132890
AF045551.2 Japanese encephalitis virus strain K94P05, complete genome 1308..a..............c...132890
AB051292.1 Japanese encephalitis virus gene for viral protein, complete cds 1309..a..............c...132990
L78128.1JEVLINGCG Japanese encephalitis virus strain Ling, complete genome 1308..a..t...............132890
AY316157.1 Japanese encephalitis virus strain KV1899, complete genome 1308..a..............c...132890
AY849939.1 Japanese encephalitis virus strain HW, complete genome 1308..a........t.........132890
AB241118.1 Japanese encephalitis virus genomic RNA, complete genome, strain: JEV1309..a..............c...132990
AB241119.1 Japanese encephalitis virus genomic RNA, complete genome, strain: JEV1309..a..............c...132990
EF107523.1 Japanese encephalitis virus strain WHe, complete genome 1308..a........t.........132890
EU429297.1 Japanese encephalitis virus strain SH17M-07, complete genome 1309..a..............c...132990
EU693899.1 Japanese encephalitis virus strain XJP613, complete genome 1309..a..............c...132990
EU880214.1 Japanese encephalitis virus strain XJ69, complete genome 1309..a..............c...132990
FJ495189.1 Japanese encephalitis virus isolate HEN0701, complete genome 1309..a..............c...132990
GU187972.1 Japanese encephalitis virus strain SC04-17, complete genome 1309..a..............c...132990
GU556217.1 Japanese encephalitis virus strain JX61, complete genome 1309..a..............c...132990
HQ893545.1 Japanese encephalitis virus isolate SX09S-01, complete genome 1309..a..............c...132990
AB594829.1 Japanese encephalitis virus genomic RNA, complete genome, strain: JEV1309..a..............c...132990
HM366552.1 Japanese encephalitis virus isolate GZ56, complete genome 1309..a..............c.._132885
HM596272.1 Japanese encephalitis virus strain Muar, complete genome 1308..c..............c.._132785
HM596272.1 Japanese encephalitis virus strain Muar, complete genome 601_________..........._61152
HM596272.1 Japanese encephalitis virus strain Muar, complete genome 5603..........___________559447
HM228921.1 Japanese encephalitis virus strain 90VN70, complete genome 1309..a............c.c...132985
GQ902061.1 Japanese encephalitis virus strain B-1381-85, complete genome 1309..a...........t..c...132985
GQ902062.1 Japanese encephalitis virus strain 4790-85, complete genome 1309..a...........t..c...132985
GQ902058.1 Japanese encephalitis virus strain B-0860/82, complete genome 3096_____..a.........____310752
GQ902059.1 Japanese encephalitis virus strain 1070/82 (Subin), complete genome 3096_____..a.........____310752