../../tmp/servers/virsirnadb/944745946
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi19271gggctcatattgttattgata21
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 18503.....................18523100
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 14933...........t.________1494557
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 15094_____..........g..___1510657
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 9823_________..........._981352
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 10561_________..........__1055247
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 4361________.........a.__437147
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 1541_____........._______153342
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 9798_______........._____980642
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 18504.....................18524100
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 14934...........t.________1494657
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 15095_____..........g..___1510757
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 9823_________..........._981352
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 4361________.........a.__437147
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 1541_____........._______153342
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 9798_______........._____980642
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 18503.....................18523100
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 14933...........t.________1494557
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 15094_____..........g..___1510657
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 9823_________..........._981352
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 4361________.........a.__437147
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 1541_____........._______153342
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 9798_______........._____980642
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 18504.....................18524100
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 14934...........t.________1494657
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 15095_____..........g..___1510757
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 9824_________..........._981452
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 9799_______........._____980742
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 18503.....................18523100
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 14933...........t.________1494557
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 15094_____..........g..___1510657
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 9823_________..........._981352
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 10561_________..........__1055247
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 4361________.........a.__437147
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 1541_____........._______153342
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 9798_______........._____980642
NC_002549.1 Zaire ebolavirus, complete genome 18503.....................18523100
NC_002549.1 Zaire ebolavirus, complete genome 14933...........t.________1494557
NC_002549.1 Zaire ebolavirus, complete genome 15094_____..........g..___1510657
NC_002549.1 Zaire ebolavirus, complete genome 9823_________..........._981352
NC_002549.1 Zaire ebolavirus, complete genome 4361________.........a.__437147
NC_002549.1 Zaire ebolavirus, complete genome 1541_____........._______153342
NC_002549.1 Zaire ebolavirus, complete genome 9798_______........._____980642
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 14890...........c.._______1490361
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 15559...........__________1556952
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 18248_____.........c..____1823752
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 1529_____........._______152142
NC_006432.1 Sudan ebolavirus, complete genome 14890..........cc..ga..g..1491076
NC_006432.1 Sudan ebolavirus, complete genome 18248_____.........t..____1823752
NC_006432.1 Sudan ebolavirus, complete genome 1529_____........._______152142
NC_014373.1 Bundibugyo ebolavirus, complete genome 14761________............_1475057
NC_014373.1 Bundibugyo ebolavirus, complete genome 17436______.g.........____1744647
NC_014373.1 Bundibugyo ebolavirus, complete genome 9826_____........._______983442
NC_014372.1 Cote d'Ivoire ebolavirus 16828_______...........c._1681657
NC_014372.1 Cote d'Ivoire ebolavirus 17673.a.........._________1768452
NC_014372.1 Cote d'Ivoire ebolavirus 9711___________........._971942
NC_014372.1 Cote d'Ivoire ebolavirus 9821________.........____981342
AB050936.1 Reston ebolavirus - Reston genomic RNA, complete genome 14993_..t.........________1498252
AB050936.1 Reston ebolavirus - Reston genomic RNA, complete genome 8218____.........a.a.c.__820457
AB050936.1 Reston ebolavirus - Reston genomic RNA, complete genome 1533_____........._______152542
AY769362.1 Reston ebolavirus strain Pennsylvania, complete genome 14995_..t.........________1498452
AY769362.1 Reston ebolavirus strain Pennsylvania, complete genome 8220____.........a.a.c.__820657
AY769362.1 Reston ebolavirus strain Pennsylvania, complete genome 1535_____........._______152742
AY769362.1 Reston ebolavirus strain Pennsylvania, complete genome 18324____________.........1833242
NC_004161.1 Reston ebolavirus, complete genome 14995_..t.........________1498452
NC_004161.1 Reston ebolavirus, complete genome 8220____.........a.a.c.__820657
NC_004161.1 Reston ebolavirus, complete genome 1535_____........._______152742
NC_004161.1 Reston ebolavirus, complete genome 18321____________.........1832942