../../tmp/servers/virsirnadb/1253169918
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi14581ggtatgttgcccgtttgtct20
EU306684.1 Hepatitis B virus clone 220-43, complete genome 458....................477100
V00867.1 Hepatitis B virus complete DNA sequence (subtype adr) 458..................._47695
X01587.1 Hepatitis B virus subtype adr4 (HBV) 331..................._34995
X14193.1 Hepatitis B virus DNA for adr mutant 458..................._47695
V00866.1 Hepatitis B virus complete DNA sequence (subtype adw) 458..................._47695
X02763.1 Hepatitis b virus genome (serotype adw2) 1867..................._188595
X69798.1 Hepatitis B virus, subtype adw4 genes 458..................._47695
X65257.1 Hepatitis B virus (ayw,patient C) PreS1, PreS2, PreC, C, X and polyme460..................._47895
X65259.1 Hepatitis B virus (ayw,patient E) genes PreS1, PreS2, PreC, C, X and 460..................._47895
X68292.1 Hepatitis B Virus DNA 460..................._47895
X70185.1 Hepatitis B Virus X, C, P and S overlapping ORF's 458..................._47695
V01460.1 Hepatitis B virus (strain ayw) genome 2727..................._270995
X02496.1 Human hepatitis B virus strain ayw variant 460..................._47895
D00630.1HPBADRC Hepatitis B virus subtype adr genomic DNA, complete sequence 332..................._35095
D00329.1HPBADW1 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl458..................._47695
D00330.1HPBADW2 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl458..................._47695
D00331.1HPBADW3 Hepatitis B virus subtype ADW genomic DNA, complete genome, cl458..................._47695
D12980.1HPBCG Hepatitis B virus subtype adr(SRADR) DNA, complete genome 332..................._35095
S50225.1 {HBV variant} [hepatitis B virus HBV, surface antigen-negative patien460..................._47895
L08805.1HPBETNC Hepatitis B virus envelope, surface and nucleocapsid protein g457..................._47595
L13994.1HUMPRECX Hepatitis B virus preS and preC mRNA, complete cds 460..................._47895
X59795.1 Hepatitis B virus (ayw subtype mutant) complete genome 439..................._45795
M54923.1HPBADWZ Hepatitis B virus (subtype adw), complete genome 458..................._47695
M38636.1HPBCGADR Hepatitis B virus, subtype adr, complete genome 458..................._47695
M32138.1HPBHBVAA Hepatitis B virus variant HBV-alpha1, complete genome 460..................._47895
L27106.1HPBMUT Hepatitis B virus mutant complete genome 460..................._47895
X75657.1 Human hepatitis virus (genotype E, Bas) preS1, preS2, S, C, X, antige458..................._47695
X75665.1 Human hepatitis virus (genotype C, HMA) preS1, preS2, S, C, X, antige458..................._47695
X75664.1 Human hepatitis virus (genotype E, Kou) preS1, preS2, S, C, X, antige458..................._47695
X75663.1 Human hepatitis virus (genotype F, 9203) preS1, preS2, S, C, X, and P458..................._47695
X75658.1 Human hepatitis virus (genotype F, Fou) preS1, preS2, S, C, X, antige458..................._47695
X75656.1 Human hepatitis virus (genotype C, Cha) preS1, preS2, S, C, X, antige458..................._47695
X52939.1 Hepatitis B virus genome with a pre X orf 331..................._34995
Z35717.1 Human hepatitis B virus (adw4) genes for surface protein S, core prot460..................._47895
D16665.1HPBADRM Hepatitis B virus DNA, complete genome, isolate: patient A4 460..................._47895
D23677.1HPBA1HKK2 Hepatitis B virus (A1-HBVKK2) complete genome sequence 458..................._47695
D23678.1HPBA2HYS2 Hepatitis B virus (A2-HBVYS2) complete genome sequence 458..................._47695
D23679.1HPBA3HMS2 Hepatitis B virus (A3-HBVMS2) complete genome sequence 458..................._47695
D23680.1HPBB4HST1 Hepatitis B virus (B4-HBVST1) complete genome sequence 458..................._47695
D23681.1HPBC4HST2 Hepatitis B virus (C4-HBVST2) complete genome sequence 458..................._47695
D23682.1HPBB5HKO1 Hepatitis B virus (B5-HBVKO1) complete genome sequence 458..................._47695
D23683.1HPBC5HKO2 Hepatitis B virus (C5-HBVKO2) complete genome sequence 458..................._47695
D23684.1HPBC6T588 Hepatitis B virus (C6-TKB588) complete genome sequence 458..................._47695
X85254.1 Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polym460..................._47895
S75184.1 S...preS2 [hepatitis B virus HBV, host=human plasma Nis 0859434, Geno458..................._47695
D50489.1HPBA11A Hepatitis B virus DNA, complete genome, isolate:A11 460..................._47895
D16666.1HPBE88A Hepatitis B virus (isolate E88: acute hepatitis) DNA, complete460..................._47895
D16667.1HPBH2B Hepatitis B virus (isolate H2: chronic hepatitis) DNA, complete460..................._47895
X80924.1 Hepatitis B virus (patient 4) complete genome 460..................._47895
X80926.1 Hepatitis B virus (patient 5) complete genome 460..................._47895
X51970.1 Hepatitis B virus (HBV 991) complete genome 458..................._47695
Z72478.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes458..................._47695
Z72479.1 Hepatitis B virus HBcAg, HBeAg, HBsAg, polymerase and X-protein genes458..................._47695
X97848.1 Hepatitis B virus (patient 2) complete genome 460..................._47895
X97850.1 Hepatitis B virus (patient 4) complete genome 460..................._47895
X97851.1 Hepatitis B virus (patient 6) complete genome 460..................._47895
Y07587.1 Hepatitis B virus, complete genome 460..................._47895
U46935.1HBU46935 Hepatitis B virus complete genome 458..................._47695
X98073.1 Hepatitis B virus complete genome with insertion in core promoter (no458..................._47695
X98072.1 Hepatitis B virus complete genome with insertion in core promoter 458..................._47695
X98077.1 Hepatitis B virus complete genome, wild type 458..................._47695
X98074.1 Hepatitis B virus complete genome with insertion in core promoter, 76458..................._47695
X98075.1 Hepatitis B virus complete genome with insertion in core promoter, 19458..................._47695
X98076.1 Hepatitis B virus complete genome with insertion in core promoter, 33458..................._47695
U95551.1 Hepatitis B virus subtype ayw, complete genome 460..................._47895
D28880.1 Hepatitis B virus DNA, complete genome, strain Fukuoka Red Cross HBV 458..................._47695
D50517.1 Hepatitis B virus clone HBV-ASA-EX1 genomic DNA, complete sequence 458..................._47695
D50518.1 Hepatitis B virus clone HBV-ASA-EX2 genomic DNA, complete sequence 458..................._47695
D50519.1 Hepatitis B virus clone HBV-ASA-EX3 genomic DNA, complete sequence 458..................._47695
D50520.1 Hepatitis B virus clone HBV-ASA-EX4 genomic DNA, complete sequence 458..................._47695
AB014360.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D01HCC 458..................._47695
AB014361.1 Hepatitis B virus genomic DNA, complete sequence, isolate 02D02HCC 410..................._42895
AB014362.1 Hepatitis B virus genomic DNA, complete sequence, isolate 03D03HCC 458..................._47695
AB014363.1 Hepatitis B virus genomic DNA, complete sequence, isolate 04D04HCC 458..................._47695
AB014364.1 Hepatitis B virus genomic DNA, complete sequence, isolate 05D05HCC 458..................._47695
AB014365.1 Hepatitis B virus genomic DNA, complete sequence, isolate 01D06HCC 458..................._47695
AB014366.1 Hepatitis B virus genomic DNA, complete sequence, isolate 07D07HCC 458..................._47695
AB014367.1 Hepatitis B virus genomic DNA, complete sequence, isolate 08D08HCC 458..................._47695
AB014368.1 Hepatitis B virus genomic DNA, complete sequence, isolate 09D09HCC 410..................._42895
AB014369.1 Hepatitis B virus genomic DNA, complete sequence, isolate 10D10HCC 458..................._47695
AB014370.1 Hepatitis B virus genomic DNA, complete sequence, isolate 11D11HCC 458..................._47695
AB014372.1 Hepatitis B virus genomic DNA, complete sequence, isolate 13D13HCC 458..................._47695
AB014373.1 Hepatitis B virus genomic DNA, complete sequence, isolate 14D14HCC 410..................._42895
AB014374.1 Hepatitis B virus genomic DNA, complete sequence, isolate 15D15HCC 458..................._47695
AB014375.1 Hepatitis B virus genomic DNA, complete sequence, isolate 16T01HCC 413..................._43195
AB014376.1 Hepatitis B virus genomic DNA, complete sequence, isolate 17T02HCC 458..................._47695
AB014377.1 Hepatitis B virus genomic DNA, complete sequence, isolate 18T03HCC 458..................._47695
AB014378.1 Hepatitis B virus genomic DNA, complete sequence, isolate 19Y01HCC 458..................._47695
AB014379.1 Hepatitis B virus genomic DNA, complete sequence, isolate 20Y02HCC 458..................._47695
AB014380.1 Hepatitis B virus genomic DNA, complete sequence, isolate 21Y03HCC 458..................._47695
AB014387.1 Hepatitis B virus genomic DNA, complete sequence, isolate 28Y10HCC 413..................._43195
AB014389.1 Hepatitis B virus genomic DNA, complete sequence, isolate 30Y12HCC 458..................._47695
AB014390.1 Hepatitis B virus genomic DNA, complete sequence, isolate 31Y13HCC 419..................._43795
AB014391.1 Hepatitis B virus DNA, complete genoem, isolate: 32Y14HCC 458..................._47695
AB014394.1 Hepatitis B virus genomic DNA, complete sequence, isolate 35Y17HCC 458..................._47695
AB014395.1 Hepatitis B virus genomic DNA, complete sequence, isolate 36Y18HCC 445..................._46395
AB014371.1 Hepatitis B virus genomic DNA, complete sequence, isolate 12D12HCC 458..................._47695
AB014381.1 Hepatitis B virus genomic DNA, complete sequence, isolate 22Y04HCC 458..................._47695
AB014382.1 Hepatitis B virus genomic DNA, complete sequence, isolate 23Y05HCC 458..................._47695
AB014383.1 Hepatitis B virus genomic DNA, complete sequence, isolate 24Y06HCC 458..................._47695
AB014384.1 Hepatitis B virus genomic DNA, complete sequence, isolate 25Y07HCC 458..................._47695
AB014385.1 Hepatitis B virus genomic DNA, complete sequence, isolate 26Y08HCC 458..................._47695
AB014386.1 Hepatitis B virus genomic DNA, complete sequence, isolate 27Y09HCC 257..................._27595
AB014388.1 Hepatitis B virus genomic DNA, complete sequence, isolate 29Y11HCC 404..................._42295
AB014392.1 Hepatitis B virus genomic DNA, complete sequence, isolate 33Y15HCC 458..................._47695
AB014393.1 Hepatitis B virus genomic DNA, complete sequence, isolate 34Y16HCC 458..................._47695
AB014396.1 Hepatitis B virus genomic DNA, complete sequence, isolate 37Y19HCC 458..................._47695
AB014397.1 Hepatitis B virus genomic DNA, complete sequence, isolate 38Y20HCC 428..................._44695
AB014398.1 Hepatitis B virus genomic DNA, complete sequence, isolate 39Y21HCC 410..................._42895
AB014399.1 Hepatitis B virus genomic DNA, complete sequence, isolate 40Y22HCC 458..................._47695
AJ012207.1 Hepatitis B virus ssAg, c, pol and x genes 458..................._47695
AJ131567.1 Hepatitis B virus complete genome, isolate gor97 1827..................._184595
AJ131568.1 Hepatitis B virus complete genome, isolate gib824 1827..................._184595
AJ131569.1 Hepatitis B virus complete genome, isolate gib759 1827..................._184595
AJ131572.1 Hepatitis B virus complete genome, isolate gib160 1827..................._184595
AJ131573.1 Hepatitis B virus complete genome, isolate gib153 1827..................._184595
AJ131575.1 Hepatitis B virus complete genome, isolate chimp82 1827..................._184595
AJ131570.1 Hepatitis B virus complete genome, isolate gib731 1591..................._160995
AJ131574.1 Hepatitis B virus complete genome, isolate gib151 1827..................._184595
AF068756.1 Hepatitis B virus, complete genome 461..................._47995
AF100308.1 Hepatitis B virus strain 2-18, complete genome 460..................._47895
AF100309.1 Hepatitis B virus strain 56, complete genome 460..................._47895
AJ131133.1 Hepatitis B virus, complete genome, strain JL1 458..................._47695
Y18855.1 Hepatitis B virus complete genome, isolate HBV-C4 458..................._47695
Y18856.1 Hepatitis B virus complete genome, isolate HBV-C5 458..................._47695
Y18857.1 Hepatitis B virus complete genome, isolate HBV-C6 458..................._47695
Y18858.1 Hepatitis B virus complete genome, isolate HBV-C7 458..................._47695
AF143298.1 Hepatitis B virus clone 7720-G8, complete genome 1803..................._182195
AF143299.1 Hepatitis B virus clone 7744-G9, complete genome 1686..................._170495
AF143300.1 Hepatitis B virus clone 7832-G4, complete genome 1701..................._171995
AF143301.1 Hepatitis B virus clone BW1903, complete genome 1671..................._168995
AF143302.1 Hepatitis B virus clone HD1402, complete genome 1770..................._178895
AF143303.1 Hepatitis B virus clone HD1406, complete genome 1770..................._178895
AF143304.1 Hepatitis B virus clone HD319, complete genome 1779..................._179795
AF143306.1 Hepatitis B virus clone RM517, complete genome 1770..................._178895
AF143307.1 Hepatitis B virus clone RM518, complete genome 1605..................._162395
AF143308.1 Hepatitis B virus clone WB1254, complete genome 1671..................._168995
AF090838.1 Hepatitis B virus strain P1.27239, complete genome 2306..................._232495
AF090839.1 Hepatitis B virus strain G2.27246, complete genome 2306..................._232495
AF090840.1 Hepatitis B virus strain G3.27270, complete genome 2306..................._232495
AF090841.1 Hepatitis B virus strain G4.27241, complete genome 2306..................._232495
AF090842.1 Hepatitis B virus strain G5.27295, complete genome 2306..................._232495
AF151735.1 Hepatitis B virus, complete genome 458..................._47695
AB031262.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietA-3458..................._47695
AB031265.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-2458..................._47695
AB031266.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-3458..................._47695
AB026811.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Feb 460..................._47895
AB026812.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;98.May 460..................._47895
AB026813.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 3;97.Sep 456..................._47495
AB026814.1 Hepatitis B virus DNA, complete genome, isolate:Donor 3;98.May 456..................._47495
AB026815.1 Hepatitis B virus DNA, complete genome, isolate:Recipient 2:full 456..................._47495
AB033550.1 Hepatitis B virus DNA, complete genome 458..................._47695
AB033551.1 Hepatitis B virus DNA, complete genome, isolate:SK300 458..................._47695
AB033552.1 Hepatitis B virus DNA, complete genome, isolate:SK494 458..................._47695
AB033553.1 Hepatitis B virus DNA, complete genome, isolate:SK619 458..................._47695
AB033554.1 Hepatitis B virus DNA, complete genome, isolate:RTB299 458..................._47695
AB033555.1 Hepatitis B virus DNA, complete genome, isolate:PAD744 458..................._47695
AB033556.1 Hepatitis B virus DNA, complete genome, isolate:AK66 458..................._47695
AB033557.1 Hepatitis B virus DNA, complete genome, isolate:IWK146 458..................._47695
AB033558.1 Hepatitis B virus DNA, complete genome, isolate:JYW796 458..................._47695
AB033559.1 Hepatitis B virus DNA, complete genome, isolate:PYW310 458..................._47695
AB010289.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-1 458..................._47695
AB010290.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-2 458..................._47695
AB010291.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-3 458..................._47695
AB010292.1 Hepatitis B virus DNA, complete genome, isolate: Yamagata-4 458..................._47695
AB032431.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV/E-Ch195458..................._47695
AB032432.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch256458..................._47695
AB032433.1 Hepatitis B virus genomic DNA, complete sequence, isolate:ChHBV-Ch258458..................._47695
AF121239.1 Hepatitis B virus isolate HBV/1303, complete genome 458..................._47695
AF121240.1 Hepatitis B virus isolate HBV/11066, complete genome 458..................._47695
AF121241.1 Hepatitis B virus isolate HBV/1758, complete genome 458..................._47695
AF121242.1 Hepatitis B virus isolate HBV/1218, complete genome 458..................._47695
AF121243.1 Hepatitis B virus isolate HBV/14611, complete genome 458..................._47695
AF121244.1 Hepatitis B virus isolate HBV/15122, complete genome 458..................._47695
AF121245.1 Hepatitis B virus isolate HBV/16091, complete genome 458..................._47695
AF121246.1 Hepatitis B virus isolate HBV/IK29902, complete genome 458..................._47695
AF121247.1 Hepatitis B virus isolate HBV/719, complete genome 458..................._47695
AF121248.1 Hepatitis B virus isolate HBV/139-1, complete genome 458..................._47695
AF121249.1 Hepatitis B virus isolate HBV/4014, complete genome 458..................._47695
AF121250.1 Hepatitis B virus isolate HBV/6395, complete genome 458..................._47695
AF121251.1 Hepatitis B virus isolate HBV/9873, complete genome 458..................._47695
AF193863.1 Orangutan hepadnavirus strain Somad, complete genome 458..................._47695
AF193864.1 Orangutan hepadnavirus strain Papa, complete genome 458..................._47695
AF160501.1 Hepatitis B virus strain IG29227, complete genome 458..................._47695
AF222322.1 Hepatitis B virus isolate CH109, complete genome 460..................._47895
AF222323.1 Hepatitis B virus isolate CH926, complete genome 460..................._47895
AF280817.1 Hepatitis B virus DNA, complete sequence, isolate: HBV-D1 458..................._47695
AF233236.1 Hepatitis B virus strain adw2 isolate HBV334, complete genome 1714..................._173295
AF242585.1 Hepatitis B virus isolate CHIMP_2, complete genome 458..................._47695
AF242586.1 Hepatitis B virus isolate CHIMP_4, complete genome 458..................._47695
AF282917.1 Hepatitis B virus isolate HBV-B1, complete genome 458..................._47695
AF282918.1 Hepatitis B virus isolate HBV-B2, complete genome 458..................._47695
AB046525.1 Hepatitis B virus genomic DNA, complete sequence, isolate:PttHBV-ChBa425..................._44395
AF182802.1 Hepatitis B virus strain wenlin61, complete genome 460..................._47895
AF182803.1 Hepatitis B virus strain wenlinA1, complete genome 460..................._47895
AF182804.1 Hepatitis B virus strain WLAP10, complete genome 460..................._47895
AF182805.1 Hepatitis B virus strain WLAID, complete genome 427..................._44595
AF241407.1 Hepatitis B virus isolate 11141, complete genome 458..................._47695
AF241408.1 Hepatitis B virus isolate 14118, complete genome 458..................._47695
AF241409.1 Hepatitis B virus isolate 6871, complete genome 458..................._47695
AF241410.1 Hepatitis B virus isolate 3270, complete genome 458..................._47695
AF241411.1 Hepatitis B virus isolate 8290, complete genome 458..................._47695
AB050018.1 Hepatitis B virus DNA, complete genome 458..................._47695
AB042282.1 Hepatitis B virus DNA, complete genome, isolate:NSS-1 458..................._47695
AB042283.1 Hepatitis B virus DNA, complete genome, isolate:NSS-2 458..................._47695
AB042284.1 Hepatitis B virus DNA, complete genome, isolate:NSS-3 458..................._47695
AB042285.1 Hepatitis B virus DNA, complete genome, isolate:NSS-4 458..................._47695
AB036905.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-458..................._47695
AB036906.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8248-458..................._47695
AB036907.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-458..................._47695
AB036908.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036909.1 Hepatitis B virus DNA, complete genome, genotype F, isolate: VNZ8339-458..................._47695
AB036910.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036911.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036912.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036913.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036914.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036915.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036916.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036917.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036918.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036919.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AB036920.1 Hepatitis B virus (genotype F) genomic DNA, complete genome, isolate:458..................._47695
AJ132335.1 Hepatitis B Virus complete genome, isolate PES1 458..................._47695
AF305327.1 Hepatitis B virus isolate CB0376, complete genome 460..................._47895
AB037927.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Makiko 458..................._47695
AB037928.1 Hepatitis B virus DNA, complete genome, isolate: HBV PG-Yohko 458..................._47695
AB049609.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN28 458..................._47695
AB049610.1 Hepatitis B virus DNA, complete genome, isolate:HBV AN29 458..................._47695
AF223954.1 Hepatitis B virus strain C-1858 isolate ea1, complete genome 458..................._47695
AF223955.1 Hepatitis B virus strain C-1858 isolate ea2, complete genome 458..................._47695
AF223956.1 Hepatitis B virus strain C-1858 isolate ea3, complete genome 458..................._47695
AF223957.1 Hepatitis B virus strain C-1858 isolate ea4, complete genome 458..................._47695
AF223958.1 Hepatitis B virus strain C-1858 isolate ea5, complete genome 458..................._47695
AF223959.1 Hepatitis B virus strain C-1858 isolate ea6, complete genome 458..................._47695
AF223961.1 Hepatitis B virus strain C-1858 isolate ea8, complete genome 458..................._47695
AF223962.1 Hepatitis B virus strain C-1858 isolate sa4, complete genome 458..................._47695
AF223963.1 Hepatitis B virus strain C-1858 isolate sa11, complete genome 458..................._47695
AF223964.1 Hepatitis B virus strain C-1858 isolate sa14, complete genome 458..................._47695
AF223965.1 Hepatitis B virus strain C-1858 isolate sa16, complete genome 458..................._47695
M57663.2HPBADWZCG Hepatitis B virus subtype adw, complete genome 458..................._47695
AB048701.1 Hepatitis B virus DNA, complete genome, serotype:ayw 458..................._47695
AB048702.1 Hepatitis B virus DNA, complete genome, serotype:ayw 458..................._47695
AB048703.1 Hepatitis B virus DNA, complete genome, serotype:ayw 458..................._47695
AB048704.1 Hepatitis B virus DNA, complete genome, serotype:ayw 458..................._47695
AB048705.1 Hepatitis B virus DNA, complete genome, serotype:ayw 458..................._47695
AF330110.1 Hepatitis B virus strain T-1858 genotype C, complete genome 458..................._47695
AF363961.1 Hepatitis B virus strain G683-1, complete genome 1853..................._187195
AF363962.1 Hepatitis B virus strain G683-2, complete genome 1820..................._183895
AF363963.1 Hepatitis B virus strain G683-3, complete genome 1853..................._187195
AF384371.1 Hepatitis B virus isolate G376-7, complete genome 1853..................._187195
AY034878.1 Hepatitis B virus isolate HBVKL, complete genome 1854..................._187295
AF384372.1 Hepatitis B virus isolate G376-A6, complete genome 1757..................._177595
AX155589.1 Sequence 1 from Patent WO0140279 458..................._47695
AY040627.1 Hepatitis B virus genotype C, complete genome 458..................._47695
AJ309369.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 10458..................._47695
AJ309370.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11458..................._47695
AJ309371.1 Hepatitis B virus complete genome, genotype A, isolate X104, clone 11458..................._47695
AF297619.1 Hepatitis B virus adw2, complete genome 458..................._47695
AF297620.1 Hepatitis B virus adw1, complete genome 458..................._47695
AF297621.1 Hepatitis B virus isolate 78, complete genome 458..................._47695
AF297622.1 Hepatitis B virus isolate 79, complete genome 458..................._47695
AF297623.1 Hepatitis B virus isolate 83, complete genome 407..................._42595
AF297624.1 Hepatitis B virus isolate 80, complete genome 458..................._47695
AF297625.1 Hepatitis B virus isolate 84, complete genome 458..................._47695
AB056513.1 Hepatitis B virus DNA, complete genome, clone:USG17 458..................._47695
AB056514.1 Hepatitis B virus DNA, complete genome, clone:USG15 449..................._46795
AB056515.1 Hepatitis B virus DNA, complete genome, clone:USG16 458..................._47695
AB056516.1 Hepatitis B virus DNA, complete genome, clone:USG18 736..................._75495
AF411408.1 Hepatitis B virus strain FMU#14, complete genome 460..................._47895
AF411409.1 Hepatitis B virus strain FMC#16, complete genome 460..................._47895
AF411410.1 Hepatitis B virus strain FMC#20, complete genome 433..................._45195
AF411411.1 Hepatitis B virus strain FMC#97, complete genome 460..................._47895
AF411412.1 Hepatitis B virus strain FMC#15, complete genome 460..................._47895
AY057947.1 Hepatitis B virus isolate Tibet705, complete genome 458..................._47695
AY057948.1 Hepatitis B virus isolate Tibet127, complete genome 458..................._47695
AY033072.1 Hepatitis B virus serotype ayw1, complete genome 1853..................._187195
AY033073.1 Hepatitis B virus serotype ayw1, complete genome 1853..................._187195
AY066028.1 Hepatitis B virus isolate FH4, complete genome 460..................._47895
AB064310.1 Hepatitis B virus DNA, complete genome, clone:USG769 458..................._47695
AB064311.1 Hepatitis B virus DNA, complete genome, clone:USG825 458..................._47695
AB064312.1 Hepatitis B virus DNA, complete genome, clone:USG916 458..................._47695
AB064313.1 Hepatitis B virus DNA, complete genome, clone:USG2638 458..................._47695
AB064314.1 Hepatitis B virus DNA, complete genome, clone:USA825 458..................._47695
AB064316.1 Hepatitis B virus DNA, complete genome, clone:US2573 458..................._47695
AF458664.1 Hepatitis B virus isolate C84, complete genome 460..................._47895
AF458665.1 Hepatitis B virus isolate C733, complete genome 460..................._47895
AF461357.1 Hepatitis B virus isolate FH5, compete genome 460..................._47895
AF461358.1 Hepatitis B virus isolate FH8, compete genome 460..................._47895
AF461359.1 Hepatitis B virus isolate c16, compete genome 460..................._47895
AF461360.1 Hepatitis B virus isolate FH14-2, compete genome 460..................._47895
AF461361.1 Hepatitis B virus isolate FH3Q, compete genome 454..................._47295
AF461362.1 Hepatitis B virus isolate FH10, compete genome 398..................._41695
AF461363.1 Hepatitis B virus isolate C8, compete genome 460..................._47895
AF461043.1 Hepatitis B virus, complete genome 458..................._47695
AF462041.1 Hepatitis B virus clone pAM6, complete genome 458..................._47695
AJ344115.1 Hepatitis B virus complete genome, genotype A, isolate X27 458..................._47695
AJ344116.1 Hepatitis B virus complete genome, genotype D, isolate GX27 458..................._47695
AJ344117.1 Hepatitis B virus complete genome, genotype D 458..................._47695
AF473543.1 Hepatitis B virus isolate 2e, complete genome 458..................._47695
AF479684.1 Hepatitis B virus isolate 3c, complete genome 458..................._47695
AY077736.1 Hepatitis B virus isolate G26, complete genome 458..................._47695
AY077735.1 Hepatitis B virus isolate G25, complete genome 458..................._47695
AF405706.1 Hepatitis B virus isolate 235/01, complete genome 458..................._47695
U87742.3 Hepatitis B virus isolate 7983, complete genome 460..................._47895
U87746.3 Hepatitis B virus isolate 7782, complete genome 460..................._47895
AB073821.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi20 458..................._47695
AB073822.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi32 458..................._47695
AB073823.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi35 458..................._47695
AB073824.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi4 458..................._47695
AB073825.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi51 458..................._47695
AB073826.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi89 458..................._47695
AB073827.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK11 458..................._47695
AB073828.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK37 458..................._47695
AB073829.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HK38 458..................._47695
AB073830.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH57 458..................._47695
AB073832.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th65 458..................._47695
AB073833.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Chi59 458..................._47695
AB073834.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi16 458..................._47695
AB073835.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Vi29 458..................._47695
AB073836.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw25 458..................._47695
AB073837.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ku1 458..................._47695
AB073838.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ho7 458..................._47695
AB073839.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw174 458..................._47695
AB073840.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw36 458..................._47695
AB073841.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Tw30 458..................._47695
AB073842.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw11 458..................._47695
AB073843.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Iw27 458..................._47695
AB073844.1 Hepatitis B virus DNA, complete genome, isolate:HBV-T11 458..................._47695
AB073845.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ya16 458..................._47695
AB073846.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry565 458..................._47695
AB073847.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Fu53 458..................._47695
AB073848.1 Hepatitis B virus DNA, complete genome, isolate:HBV-HUS 458..................._47695
AB073849.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na101 458..................._47695
AB073851.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry1 458..................._47695
AB073852.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry11 458..................._47695
AB073853.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry24 458..................._47695
AB073854.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry30 458..................._47695
AB073855.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry34 458..................._47695
AB073856.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry46 458..................._47695
AB073857.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Ry48 458..................._47695
AB073858.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Shin 458..................._47695
AB074047.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th11 458..................._47695
U87747.3 Hepatitis B virus isolate Wong, complete genome 460..................._47895
AB074755.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th44 458..................._47695
AB074756.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Th55 458..................._47695
AY090453.1 Hepatitis B virus strain 14-94, complete genome 461..................._47995
AY090455.1 Hepatitis B virus strain 1889Nic, complete genome 461..................._47995
AY090456.1 Hepatitis B virus strain 1980Nic, complete genome 449..................._46795
AY090459.1 Hepatitis B virus strain 7768H, complete genome 461..................._47995
AY090461.1 Hepatitis B virus strain 1116Sal, complete genome 461..................._47995
AY123424.1 Hepatitis B virus, complete genome 460..................._47895
AB076678.1 Hepatitis B virus genes for small S protein, X protein, PreC/core pro458..................._47695
AB076679.1 Hepatitis B virus genes for small-S protein, X protein, preC/core pro458..................._47695
AY123041.1 Hepatitis B virus serotype adr, complete genome 332..................._35095
AY128092.1 Hepatitis B virus clone pEco63, complete genome 460..................._47895
AF286594.1 Hepatitis B virus subtype adr, complete genome 458..................._47695
AF536524.1 Hepatitis B virus clone 2A, complete genome 458..................._47695
AF533983.1 Hepatitis B virus genotype C, complete genome 458..................._47695
AF537371.1 Hepatitis B virus clone 3.4, complete genome 458..................._47695
AF537372.1 Hepatitis B virus clone 4B, complete genome 458..................._47695
AF498266.1 Hepatitis B virus isolate FG, complete genome 458..................._47695
AF418676.1 Hepatitis B virus patient 567 clone 1, complete genome 443..................._46195
AF418677.1 Hepatitis B virus patient 567 clone 2, complete genome 443..................._46195
AF418678.1 Hepatitis B virus patient 567 clone 3, complete genome 404..................._42295
AF418682.1 Hepatitis B virus patient 4727 clone 1, complete genome 460..................._47895
AF418683.1 Hepatitis B virus patient 4727 clone 2, complete genome 460..................._47895
AF418684.1 Hepatitis B virus patient 313 clone 1, complete genome 460..................._47895
AF418685.1 Hepatitis B virus patient 313 clone 2, complete genome 460..................._47895
AF418686.1 Hepatitis B virus patient 313 clone 3, complete genome 460..................._47895
AF418687.1 Hepatitis B virus patient 313 clone 4, complete genome 457..................._47595
AF418688.1 Hepatitis B virus patient 313 clone 5, complete genome 460..................._47895
AF418689.1 Hepatitis B virus patient 313 clone 6, complete genome 460..................._47895
AF418690.1 Hepatitis B virus patient 313 clone 7, complete genome 460..................._47895
AF418691.1 Hepatitis B virus patient 313 clone 8, complete genome 460..................._47895
AF418692.1 Hepatitis B virus patient 313 clone 9, complete genome 460..................._47895
AY152726.1 Hepatitis B virus isolate 8.22, complete genome 458..................._47695
AB086397.1 Hepatitis B virus X, C genes for X protein, core protein, complete c458..................._47695
AY163869.1 Hepatitis B virus isolate FMClx-1, complete genome 460..................._47895
AY163870.1 Hepatitis B virus isolate FMU001, complete genome 460..................._47895
AY161139.1 Hepatitis B virus clone S1.2 complete genome 458..................._47695
AY161142.1 Hepatitis B virus clone S3.1, complete genome 404..................._42295
AY161143.1 Hepatitis B virus clone S3.2, complete genome 443..................._46195
AY161144.1 Hepatitis B virus clone S3.3, complete genome 443..................._46195
AY161145.1 Hepatitis B virus clone S4.1 complete genome 458..................._47695
AY161146.1 Hepatitis B virus clone S4.2 complete genome 458..................._47695
AY161147.1 Hepatitis B virus clone S5.1 complete genome 458..................._47695
AY161148.1 Hepatitis B virus clone S5.2 complete genome 456..................._47495
AY161149.1 Hepatitis B virus clone S5.3 complete genome 458..................._47695
AY161150.1 Hepatitis B virus clone S6.1 complete genome 458..................._47695
AY161151.1 Hepatitis B virus clone S6.2, complete genome 458..................._47695
AY161152.1 Hepatitis B virus clone S6.3, complete genome 458..................._47695
AY161153.1 Hepatitis B virus clone S6.4 complete genome 458..................._47695
AY161154.1 Hepatitis B virus clone S6.5, complete genome 458..................._47695
AY161155.1 Hepatitis B virus clone S6.6, complete genome 458..................._47695
AY161156.1 Hepatitis B virus clone S6.7, complete genome 458..................._47695
AY161157.1 Hepatitis B virus clone S7.1 complete genome 458..................._47695
AY161158.1 Hepatitis B virus clone S7.2 complete genome 458..................._47695
AY161159.1 Hepatitis B virus clone S8.1 complete genome 458..................._47695
AY161160.1 Hepatitis B virus clone S8.2 complete genome 458..................._47695
AY148342.1 Hepatitis B virus, complete genome 1823..................._184195
AB078032.1 Hepatitis B virus complete genome, isolate:AH1-SY 458..................._47695
AB100695.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH133 458..................._47695
AB090268.1 Hepatitis B virus DNA, complete genome, strain:CH1-OHs 458..................._47695
AB090269.1 Hepatitis B virus DNA, complete genome, strain:CH2-OHf 458..................._47695
AB090270.1 Hepatitis B virus DNA, complete genome, strain:b-dono12 458..................._47695
AB091255.1 Hepatitis B virus DNA, complete genome, isplate:ABI-129 458..................._47695
AB091256.1 Hepatitis B virus DNA, complete genome, isplate:ABI-212 458..................._47695
AY217371.1 Hepatitis B virus isolate 1-7, complete genome 458..................._47695
AY217372.1 Hepatitis B virus isolate 2-1, complete genome 441..................._45995
AY217373.1 Hepatitis B virus isolate 594, complete genome 462..................._48095
AY217374.1 Hepatitis B virus isolate 595, complete genome 444..................._46295
AY217375.1 Hepatitis B virus isolate 599, complete genome 458..................._47695
AY217376.1 Hepatitis B virus isolate Q1-1, complete genome 458..................._47695
AY217377.1 Hepatitis B virus isolate Q2-10, complete genome 460..................._47895
AY217378.1 Hepatitis B virus isolate Q3-2, complete genome 448..................._46695
AY217355.1 Hepatitis B virus isolate A6-2, complete genome 458..................._47695
AY217356.1 Hepatitis B virus isolate A9-2, complete genome 458..................._47695
AY217357.1 Hepatitis B virus isolate B1r-4, complete genome 458..................._47695
AY217358.1 Hepatitis B virus isolate B8r-4, complete genome 458..................._47695
AY217359.1 Hepatitis B virus isolate Q6-5, complete genome 458..................._47695
AY217360.1 Hepatitis B virus isolate 6-4, complete genome 458..................._47695
AY217361.1 Hepatitis B virus isolate 582-2, complete genome 458..................._47695
AY217362.1 Hepatitis B virus isolate 582-4, complete genome 458..................._47695
AY217363.1 Hepatitis B virus isolate 582-1, complete genome 460..................._47895
AY217364.1 Hepatitis B virus isolate 586, complete genome 392..................._41095
AY217365.1 Hepatitis B virus isolate Q7-1, complete genome 458..................._47695
AY217366.1 Hepatitis B virus isolate 17127, complete genome 457..................._47595
AY217367.1 Hepatitis B virus isolate 17993, complete genome 457..................._47595
AY217369.1 Hepatitis B virus isolate H2, complete genome 458..................._47695
AY217370.1 Hepatitis B virus isolate 7-2, complete genome 458..................._47695
AB106564.1 Hepatitis B virus DNA, complete genome, isolate:HBV-GA325 458..................._47695
AY247030.1 Hepatitis B virus isolate KUHB81, complete genome 458..................._47695
AY247031.1 Hepatitis B virus isolate KUHB84, complete genome 458..................._47695
AY247032.1 Hepatitis B virus isolate KUHB95, complete genome 458..................._47695
AY206373.1 Hepatitis B virus strain FMU002 complete genome 460..................._47895
AY206374.1 Hepatitis B virus strain FMU003 complete genome 460..................._47895
AY206375.1 Hepatitis B virus strain FMU004 complete genome 460..................._47895
AY206376.1 Hepatitis B virus strain FMU005 complete genome 460..................._47895
AY206377.1 Hepatitis B virus strain FMU006 complete genome 460..................._47895
AY206378.1 Hepatitis B virus strain FMU007 complete genome 424..................._44295
AY206379.1 Hepatitis B virus strain FMU008 complete genome 460..................._47895
AY206380.1 Hepatitis B virus strain FMU009 complete genome 460..................._47895
AY206381.1 Hepatitis B virus strain FMU010 complete genome 460..................._47895
AY206382.1 Hepatitis B virus strain FMU011 complete genome 460..................._47895
AY206383.1 Hepatitis B virus strain FMU012 complete genome 460..................._47895
AY206384.1 Hepatitis B virus strain FMU013 complete genome 460..................._47895
AY206385.1 Hepatitis B virus strain FMU014 complete genome 427..................._44595
AY206386.1 Hepatitis B virus strain FMU015 complete genome 460..................._47895
AY206387.1 Hepatitis B virus strain FMU016 complete genome 398..................._41695
AY206388.1 Hepatitis B virus strain FMU017 complete genome 460..................._47895
AY206389.1 Hepatitis B virus strain FMU018 complete genome 460..................._47895
AY206390.1 Hepatitis B virus strain FMU019 complete genome 460..................._47895
AY206391.1 Hepatitis B virus strain FMU020 complete genome 460..................._47895
AY206392.1 Hepatitis B virus strain FMU021 complete genome 460..................._47895
AY206393.1 Hepatitis B virus strain FMU022 complete genome 460..................._47895
AB078031.2 Hepatitis B virus complete genome, isolate:FH1-YS 458..................._47695
AB078033.2 Hepatitis B virus complete genome, isolate:IS1-OY 458..................._47695
AY220697.1 Hepatitis B virus strain GYF634, complete genome 460..................._47895
AY220698.1 Hepatitis B virus strain 536207, complete genome 460..................._47895
AY220699.1 Hepatitis B virus strain MH15, complete genome 460..................._47895
AY220700.1 Hepatitis B virus strain MH534978, complete genome 460..................._47895
AY220701.1 Hepatitis B virus strain WJQ310, complete genome 460..................._47895
AY220702.1 Hepatitis B virus strain WJQ650, complete genome 460..................._47895
AY220703.1 Hepatitis B virus strain WZJ319, complete genome 460..................._47895
AY220704.1 Hepatitis B virus strain WZJ942, complete genome 460..................._47895
AY306136.1 Hepatitis B virus isolate H85, complete genome 458..................._47695
AB104709.1 Hepatitis B virus DNA, complete sequence, isolate: EG64 460..................._47895
AB104710.1 Hepatitis B virus DNA, complete sequence, isolate: EG105 460..................._47895
AB104711.1 Hepatitis B virus DNA, complete sequence, isolate: EG104 460..................._47895
AB104712.1 Hepatitis B virus DNA, complete sequence, isolate: EG75 460..................._47895
AY233274.1 Hepatitis B virus isolate 0962 complete genome 458..................._47695
AY233275.1 Hepatitis B virus isolate 163 complete genome 458..................._47695
AY233276.1 Hepatitis B virus isolate 1839 complete genome 458..................._47695
AY233277.1 Hepatitis B virus isolate 1848 complete genome 458..................._47695
AY233278.1 Hepatitis B virus isolate 1 complete genome 458..................._47695
AY233279.1 Hepatitis B virus isolate 28 complete genome 458..................._47695
AY233280.1 Hepatitis B virus isolate 2 complete genome 458..................._47695
AY233281.1 Hepatitis B virus isolate 303 complete genome 458..................._47695
AY233283.1 Hepatitis B virus isolate 4038 complete genome 458..................._47695
AY233284.1 Hepatitis B virus isolate 5283 complete genome 458..................._47695
AY233285.1 Hepatitis B virus isolate 795 complete genome 458..................._47695
AY233286.1 Hepatitis B virus isolate 818 complete genome 458..................._47695
AY233287.1 Hepatitis B virus isolate 8225 complete genome 458..................._47695
AY233288.1 Hepatitis B virus isolate 823 complete genome 458..................._47695
AY233289.1 Hepatitis B virus isolate 833 complete genome 458..................._47695
AY233290.1 Hepatitis B virus isolate 85 complete genome 458..................._47695
AY233296.1 Hepatitis B virus isolate 185 complete genome 458..................._47695
AY167089.1 Hepatitis B virus isolate Ia, complete genome 458..................._47695
AY167090.1 Hepatitis B virus isolate Ib, complete genome 458..................._47695
AY167091.1 Hepatitis B virus isolate Ic, complete genome 458..................._47695
AY167092.1 Hepatitis B virus isolate Id, complete genome 422..................._44095
AY167093.1 Hepatitis B virus isolate IIa, complete genome 458..................._47695
AY167094.1 Hepatitis B virus isolate IIb, complete genome 458..................._47695
AY167095.1 Hepatitis B virus isolate IIc, complete genome 458..................._47695
AY167096.1 Hepatitis B virus isolate IIIa, complete genome 458..................._47695
AY167097.1 Hepatitis B virus isolate IIIb, complete genome 458..................._47695
AY167098.1 Hepatitis B virus isolate IVa, complete genome 458..................._47695
AY167099.1 Hepatitis B virus isolate IVb, complete genome 458..................._47695
AY167100.1 Hepatitis B virus isolate Va, complete genome 458..................._47695
AY167101.1 Hepatitis B virus isolate Vb, complete genome 458..................._47695
AY167102.1 Hepatitis B virus isolate Vc, complete genome 458..................._47695
AY330911.1 Hepatitis B virus isolate Louisa complete genome 458..................._47695
AY330912.1 Hepatitis B virus isolate Osang complete genome 458..................._47695
AY330913.1 Hepatitis B virus isolate Tamang complete genome 458..................._47695
AY330914.1 Hepatitis B virus isolate Wendy complete genome 458..................._47695
AY330915.1 Hepatitis B virus isolate Happy complete genome 458..................._47695
AY330916.1 Hepatitis B virus isolate Tbblack complete genome 458..................._47695
AB115551.1 Hepatitis B virus DNA, complete genome, isolate:HBV-CB15 458..................._47695
AB105172.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 2 458..................._47695
AB105173.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 16458..................._47695
AB105174.1 Hepatitis B virus gene for S protein, complete cds, isolate:Hawaii 60458..................._47695
AY179734.1 Hepatitis B virus genotype F isolate BA9, complete genome 458..................._47695
AY179735.1 Hepatitis B virus genotype F isolate BA10, complete genome 458..................._47695
AY373428.1 Hepatitis B virus clone SWT.1 complete genome 458..................._47695
AY373429.1 Hepatitis B virus clone SWT.2 complete genome 458..................._47695
AY373430.1 Hepatitis B virus clone SWT.3 complete genome 458..................._47695
AY373431.1 Hepatitis B virus clone SWT.4 complete genome 458..................._47695
AY373432.1 Hepatitis B virus clone SWT.5 complete genome 458..................._47695
AB106884.1 Hepatitis B virus DNA, complete genome, strain:HBV-Ya14 458..................._47695
AB106885.1 Hepatitis B virus DNA, complete genome, strain:HBV-YA34 458..................._47695
AY311369.1 Hepatitis B virus isolate BD4139, complete genome 458..................._47695
AY311370.1 Hepatitis B virus isolate BD14999, complete genome 458..................._47695
AY293309.1 Hepatitis B virus strain Whutj-37, complete genome 2300..................._231895
AY236160.1 Hepatitis B virus isolate 1A, complete genome 1820..................._183895
AY236161.1 Hepatitis B virus isolate 12A, complete genome 1820..................._183895
AY236162.1 Hepatitis B virus isolate 23 A, complete genome 1820..................._183895
AY236163.1 Hepatitis B virus isolate 29, complete genome 1772..................._179095
AY236164.1 Hepatitis B virus isolate 30, complete genome 1820..................._183895
AB126580.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU204 458..................._47695
AB126581.1 Hepatitis B virus DNA, complete genome, isolate:HBV-RU301 460..................._47895
AB111112.1 Hepatitis B virus DNA, complete genome, clone: HS-0 458..................._47695
AB111113.1 Hepatitis B virus DNA, complete genome, clone: HS-6 458..................._47695
AB111114.1 Hepatitis B virus DNA, complete genome, clone: HS-12 458..................._47695
AB111115.1 Hepatitis B virus DNA, complete genome, clone: K5-0 397..................._41595
AB111116.1 Hepatitis B virus DNA, complete genome, clone: K5-7 397..................._41595
AB111117.1 Hepatitis B virus DNA, complete genome, clone: K5-13 410..................._42895
AB111118.1 Hepatitis B virus DNA, complete genome, clone: KM-0 535..................._55395
AB111119.1 Hepatitis B virus DNA, complete genome, clone: KM-10 458..................._47695
AB111120.1 Hepatitis B virus DNA, complete genome, clone: KM-12 458..................._47695
AB111121.1 Hepatitis B virus DNA, complete genome, clone: K4-0 458..................._47695
AB111122.1 Hepatitis B virus DNA, complete genome, clone: KM4-9 458..................._47695
AB111123.1 Hepatitis B virus DNA, complete genome, clone: KM4-12 458..................._47695
AB111124.1 Hepatitis B virus DNA, complete genome, clone: KH-0 458..................._47695
AB111125.1 Hepatitis B virus DNA, complete genome, clone: KH-12 458..................._47695
AB112063.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VT101 458..................._47695
AB112066.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY624 458..................._47695
AB112348.1 Hepatitis B virus DNA, complete genome, isolate: HBV-MY656 458..................._47695
AB112408.1 Hepatitis B virus DNA, complete genome, isolate:HBV-MY683 449..................._46795
AB112471.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH123 458..................._47695
AB112472.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH124 458..................._47695
AY518556.1 Hepatitis B virus isolate 57-1 subtype adw, complete genome 458..................._47695
AB117758.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB10 458..................._47695
AB117759.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CB14 458..................._47695
AB116076.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA1911 458..................._47695
AB116077.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA2126 458..................._47695
AB116078.1 Hepatitis B virus DNA, complete genome, isolate:HBV-USA712 458..................._47695
AB116079.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR1 458..................._47695
AB116080.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR2 458..................._47695
AB116081.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TR3 458..................._47695
AB116082.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN1 458..................._47695
AB116083.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN36 458..................._47695
AB116084.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN81 458..................._47695
AB116085.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BAN83 458..................._47695
AB116086.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND18 458..................._47695
AB116087.1 Hepatitis B virus DNA, complete genome, isolate:HBV-IND8 458..................._47695
AB116088.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP30 458..................._47695
AB116089.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP39 458..................._47695
AB116090.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NEP40 458..................._47695
AB116091.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH1 458..................._47695
AB116092.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH20 458..................._47695
AB116093.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH25 458..................._47695
AB116094.1 Hepatitis B virus DNA, complete genome, isolate:HBV-PH4 458..................._47695
AB116266.1 Hepatitis B virus DNA, complete genome, strain: Ehime TY:871225 458..................._47695
AB111946.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT103 458..................._47695
AB115417.1 Hepatitis B virus DNA, complete genome, isolate:HBV-O47 458..................._47695
AB106895.1 Hepatitis B virus DNA, complete genome, isolate:pHB4-4 458..................._47695
AY661792.1 Hepatitis B virus isolate ayw, complete genome 460..................._47895
AY661793.1 Hepatitis B virus isolate 2, complete genome 460..................._47895
AB116549.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM5 458..................._47695
AB116550.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:PANAM6 458..................._47695
AB116551.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ2 458..................._47695
AB116552.1 Hepatitis B virus S gene for HBsAg, complete cds, clone:VENEZ4 458..................._47695
AB116654.1 Hepatitis B virus DNA, complete genome, clone:JPNTAKA 458..................._47695
AY596102.1 Hepatitis B virus isolate Ia-1, complete genome 458..................._47695
AY596103.1 Hepatitis B virus isolate Ia-2, complete genome 458..................._47695
AY596104.1 Hepatitis B virus isolate Ia-4, complete genome 458..................._47695
AY596105.1 Hepatitis B virus isolate Ia-5, complete genome 458..................._47695
AY596106.1 Hepatitis B virus isolate Ia-6, complete genome 458..................._47695
AY596107.1 Hepatitis B virus isolate Ib-1, complete genome 458..................._47695
AY596108.1 Hepatitis B virus isolate Ib-2, complete genome 458..................._47695
AY596109.1 Hepatitis B virus isolate II-1, complete genome 458..................._47695
AY596110.1 Hepatitis B virus isolate II-2, complete genome 458..................._47695
AY596111.1 Hepatitis B virus isolate Ia-3, complete genome 458..................._47695
AY596112.1 Hepatitis B virus isolate Ia-7, complete genome 458..................._47695
AB166850.1 Hepatitis B virus DNA, complete genome, isolate: HBV-BL592 458..................._47695
AB120308.1 Hepatitis B virus DNA, complete genome, strain:Ehime-full 20:IM 82082458..................._47695
AY707087.1 Hepatitis B virus isolate HBV-N10, complete genome 460..................._47895
AY721605.1 Hepatitis B virus isolate AK1.1, complete genome 460..................._47895
AY721606.1 Hepatitis B virus isolate AT1.2, complete genome 460..................._47895
AY721607.1 Hepatitis B virus isolate HIY1.3, complete genome 460..................._47895
AY721608.1 Hepatitis B virus isolate IB1.4, complete genome 460..................._47895
AY721609.1 Hepatitis B virus isolate AA1.5, complete genome 460..................._47895
AY721610.1 Hepatitis B virus isolate FK1.6, complete genome 460..................._47895
AY721611.1 Hepatitis B virus isolate SK1.7, complete genome 460..................._47895
AY721612.1 Hepatitis B virus isolate BL1.8, complete genome 460..................._47895
AB176642.1 Hepatitis B virus subtype ADR DNA, complete genome, isolate:HBV-115 458..................._47695
AB176643.1 Hepatitis B virus DNA, complete genome, isolate:HBV-NK1 402..................._42095
AY741794.1 Hepatitis B virus isolate IR-IPI-50, complete genome 460..................._47895
AY741795.1 Hepatitis B virus isolate IR-IPI-Hi, complete genome 460..................._47895
AY741797.1 Hepatitis B virus isolate IR-IPI-21, complete genome 460..................._47895
AY741798.1 Hepatitis B virus isolate IR-IPI-P4, complete genome 460..................._47895
AY766463.1 Hepatitis B virus strain GDH1 from China, complete genome 458..................._47695
AY781177.1 Hepatitis B virus strain BG21, complete genome 458..................._47695
AY781178.1 Hepatitis B virus strain G12, complete genome 458..................._47695
AY781179.1 Hepatitis B virus strain GIII_14, complete genome 458..................._47695
AY781180.1 Hepatitis B virus strain GIII_15, complete genome 458..................._47695
AY781181.1 Hepatitis B virus strain GIII_16, complete genome 458..................._47695
AY781182.1 Hepatitis B virus strain GIII_17, complete genome 458..................._47695
AY781183.1 Hepatitis B virus strain GII_11, complete genome 458..................._47695
AY781184.1 Hepatitis B virus strain GII_8, complete genome 458..................._47695
AY781185.1 Hepatitis B virus strain GI_19, complete genome 458..................._47695
AY781186.1 Hepatitis B virus strain MGI, complete genome 458..................._47695
AY781187.1 Hepatitis B virus strain SG_III, complete genome 458..................._47695
AY641558.1 Hepatitis B virus isolate He74, complete genome 458..................._47695
AY641559.1 Hepatitis B virus isolate He53, complete genome 458..................._47695
AY641560.1 Hepatitis B virus isolate He100, complete genome 458..................._47695
AY641561.1 Hepatitis B virus isolate He127, complete genome 458..................._47695
AY641562.1 Hepatitis B virus isolate He82, complete genome 458..................._47695
AY641563.1 Hepatitis B virus isolate He52, complete genome 458..................._47695
AY800389.1 Hepatitis B virus isolate ZY041024, complete genome 458..................._47695
AY800390.1 Hepatitis B virus isolate ZY041025, complete genome 458..................._47695
AY800391.1 Hepatitis B virus isolate ZY041026, complete genome 458..................._47695
AY800392.1 Hepatitis B virus isolate ZY041027, complete genome 458..................._47695
AY796030.1 Hepatitis B virus isolate FC1.9, complete genome 460..................._47895
AY796032.1 Hepatitis B virus isolate NA1.11, complete genome 460..................._47895
AB113875.1 Hepatitis B virus DNA, complete genome, strain:HCC-1-MC 458..................._47695
AB113876.1 Hepatitis B virus DNA, complete genome, strain:HCC-2-NY 458..................._47695
AB113877.1 Hepatitis B virus DNA, complete genome, strain:HCC-3-TT 458..................._47695
AB113878.1 Hepatitis B virus DNA, complete genome, strain:Ehime-Lam-MM1-001208 458..................._47695
AB113879.1 Hepatitis B virus DNA, complete genome, strain:AH-1-ON980424 458..................._47695
AB109475.1 Hepatitis B virus DNA, complete genome, strain:Ehime7: Iyo 0218004 458..................._47695
AB109476.1 Hepatitis B virus DNA, complete genome, strain:Ehime8: Iyo 8288043 458..................._47695
AB109477.1 Hepatitis B virus DNA, complete genome, strain:Ehime9: Iyo 529380 458..................._47695
AB109478.1 Hepatitis B virus DNA, complete genome, strain:Ehime10: Iyo 41676 458..................._47695
AB109479.1 Hepatitis B virus DNA, complete genome, strain:Ehime11: Iyo 529207 458..................._47695
AB110075.1 Hepatitis B virus DNA, complete genome, strain: Ehime12:IM 011025 458..................._47695
AB198076.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.1 458..................._47695
AB198077.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.2 458..................._47695
AB198078.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.3 458..................._47695
AB198079.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.4 458..................._47695
AB198080.1 Hepatitis B virus DNA, complete genome, note: HBeAg positive pt.5 458..................._47695
AB198081.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.1 458..................._47695
AB198082.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.2 458..................._47695
AB198083.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.3 458..................._47695
AB198084.1 Hepatitis B virus DNA, complete genome, note: HBeAg negative pt.4 458..................._47695
AY739674.1 Hepatitis B virus clone A1-33, complete genome 458..................._47695
AY739675.1 Hepatitis B virus clone A1-35, complete genome 458..................._47695
AY738144.1 Hepatitis B virus clone B3, complete genome 458..................._47695
AY738145.1 Hepatitis B virus clone B5, complete genome 458..................._47695
AY738146.1 Hepatitis B virus clone B9, complete genome 458..................._47695
AY738147.1 Hepatitis B virus clone B11, complete genome 458..................._47695
AY902768.1 Hepatitis B virus isolate MTB166, complete genome 458..................._47695
AY902769.1 Hepatitis B virus isolate MTB009, complete genome 458..................._47695
AY902770.1 Hepatitis B virus isolate MTB012, complete genome 458..................._47695
AY902772.1 Hepatitis B virus isolate MTB158, complete genome 458..................._47695
AY902773.1 Hepatitis B virus isolate MTB159, complete genome 458..................._47695
AY902774.1 Hepatitis B virus isolate MTB160, complete genome 458..................._47695
AY902775.1 Hepatitis B virus isolate MTB162, complete genome 458..................._47695
AY902776.1 Hepatitis B virus isolate MTB163, complete genome 458..................._47695
AY902777.1 Hepatitis B virus isolate MTB004, complete genome 458..................._47695
AB188244.1 Hepatitis B virus DNA, complete genome, isolate:UZ24 458..................._47695
AJ748098.1 Hepatitis B virus complete genome, genotype C 458..................._47695
AB205118.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ1-1-2 458..................._47695
AB205119.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-1 458..................._47695
AB205120.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF687-2 458..................._47695
AB205121.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF720-1 458..................._47695
AB205123.1 Hepatitis B virus DNA, complete genome, isolate: HBV-CN578-1 458..................._47695
AB205124.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TJ3-1-1 458..................._47695
AB205125.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH34-1 458..................._47695
AB205126.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IF714-1 458..................._47695
AB205127.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU313-2 458..................._47695
AB205129.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758-2 458..................._47695
AY800249.1 Hepatitis B virus isolate CHN-L2, complete genome 458..................._47695
AY817509.1 Hepatitis B virus isolate CHN-L28 from China, complete genome 458..................._47695
AY817510.1 Hepatitis B virus isolate CHN-L45 from China, complete genome 458..................._47695
AY817511.1 Hepatitis B virus isolate CHN-L49 from China, complete genome 458..................._47695
AY817512.1 Hepatitis B virus isolate CHN-L53 from China, complete genome 458..................._47695
AY817513.1 Hepatitis B virus isolate CHN-L66 from China, complete genome 458..................._47695
AY817514.1 Hepatitis B virus isolate CHN-L79 from China, complete genome 458..................._47695
AY817515.1 Hepatitis B virus isolate CHN-L80 from China, complete genome 458..................._47695
AY945307.1 Hepatitis B virus, complete genome 458..................._47695
AP007262.1 HBV genotype E DNA, complete genome, isolate: HB-JI411F 458..................._47695
AP007263.1 HBV genotype A DNA, complete genome, isolate: HB-JI444AF 458..................._47695
AP007264.1 HBV genotype G DNA, complete genome, isolate: HB-JI444GF 458..................._47695
AY903452.1 Hepatitis B virus serotype adw2, complete genome 458..................._47695
AY935700.1 Hepatitis B virus isolate TH-HBV-012, complete genome 458..................._47695
AY934763.1 Hepatitis B virus isolate ik3346, complete genome 458..................._47695
AY934764.1 Hepatitis B virus isolate 9210699, complete genome 458..................._47695
AY934765.1 Hepatitis B virus isolate 24306, complete genome 458..................._47695
AY934766.1 Hepatitis B virus isolate 24233, complete genome 458..................._47695
AY934767.1 Hepatitis B virus isolate 27178, complete genome 458..................._47695
AY934768.1 Hepatitis B virus isolate 25830, complete genome 458..................._47695
AY934769.1 Hepatitis B virus isolate 23719, complete genome 458..................._47695
AY934770.1 Hepatitis B virus isolate 953642, complete genome 458..................._47695
AY934771.1 Hepatitis B virus isolate 27439, complete genome 458..................._47695
AY934772.1 Hepatitis B virus isolate 1908, complete genome 458..................._47695
AY934773.1 Hepatitis B virus isolate 9414346, complete genome 458..................._47695
AY934774.1 Hepatitis B virus isolate 9615549, complete genome 458..................._47695
DQ020002.1 Hepatitis B virus isolate 380, complete genome 458..................._47695
DQ020003.1 Hepatitis B virus isolate 5780, complete genome 458..................._47695
AB212625.1 Hepatitis B virus DNA, complete genome, isolateVT1026 458..................._47695
AB212626.1 Hepatitis B virus DNA, complete genome, isolateVT1022 458..................._47695
AB205188.1 Hepatitis B virus DNA, complete genome, isolate: HBV-GA283 443..................._46195
AB205189.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G138 458..................._47695
AB205191.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G166 458..................._47695
AB205192.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G758 458..................._47695
AB214516.1 Hepatitis B virus DNA, complete genome, isolate:HBV-BL597 458..................._47695
AB194947.1 Hepatitis B virus DNA, complete genome, isolate: CMR954 458..................._47695
AB194948.1 Hepatitis B virus DNA, complete genome, isolate: CMR936 458..................._47695
AB194949.1 Hepatitis B virus DNA, complete genome, isolate: CMR151 458..................._47695
AB194950.1 Hepatitis B virus DNA, complete genome, isolate: CMR983 458..................._47695
AB194951.1 Hepatitis B virus DNA, complete genome, isolate: CMR82 458..................._47695
AB194952.1 Hepatitis B virus DNA, complete genome, isolate: CMR711 458..................._47695
DQ078791.1 Hepatitis B virus from Thailand, complete genome 458..................._47695
DQ089756.1 Hepatitis B virus isolate HK75, complete genome 425..................._44395
DQ089757.1 Hepatitis B virus isolate HK2342, complete genome 458..................._47695
DQ089758.1 Hepatitis B virus isolate HK1733, complete genome 458..................._47695
DQ089759.1 Hepatitis B virus isolate HK1512, complete genome 458..................._47695
DQ089760.1 Hepatitis B virus isolate HK454, complete genome 458..................._47695
DQ089761.1 Hepatitis B virus isolate HK515, complete genome 458..................._47695
DQ089762.1 Hepatitis B virus isolate HK1644, complete genome 458..................._47695
DQ089763.1 Hepatitis B virus isolate HK1048, complete genome 458..................._47695
DQ089764.1 Hepatitis B virus isolate HK967, complete genome 458..................._47695
DQ089765.1 Hepatitis B virus isolate HK428, complete genome 458..................._47695
DQ089766.1 Hepatitis B virus isolate HK553, complete genome 458..................._47695
DQ089767.1 Hepatitis B virus isolate HK1663, complete genome 458..................._47695
DQ089768.1 Hepatitis B virus isolate HK1814, complete genome 458..................._47695
DQ089769.1 Hepatitis B virus isolate HK430, complete genome 458..................._47695
DQ089770.1 Hepatitis B virus isolate HK1272, complete genome 458..................._47695
DQ089771.1 Hepatitis B virus isolate HK1629, complete genome 458..................._47695
DQ089772.1 Hepatitis B virus isolate HK910, complete genome 458..................._47695
DQ089773.1 Hepatitis B virus isolate HK1193, complete genome 458..................._47695
DQ089774.1 Hepatitis B virus isolate HK858, complete genome 458..................._47695
DQ089775.1 Hepatitis B virus isolate HK290, complete genome 458..................._47695
DQ089776.1 Hepatitis B virus isolate HK884, complete genome 458..................._47695
DQ089777.1 Hepatitis B virus isolate HK1159, complete genome 458..................._47695
DQ089778.1 Hepatitis B virus isolate HK1442, complete genome 458..................._47695
DQ089779.1 Hepatitis B virus isolate HK554, complete genome 458..................._47695
DQ089780.1 Hepatitis B virus isolate HK947, complete genome 458..................._47695
DQ089781.1 Hepatitis B virus isolate HK1476, complete genome 458..................._47695
DQ089782.1 Hepatitis B virus isolate HK2032, complete genome 458..................._47695
DQ089783.1 Hepatitis B virus isolate HK1402, complete genome 458..................._47695
DQ089784.1 Hepatitis B virus isolate HK1285, complete genome 458..................._47695
DQ089785.1 Hepatitis B virus isolate HK1386, complete genome 458..................._47695
DQ089786.1 Hepatitis B virus isolate HK2074, complete genome 458..................._47695
DQ089787.1 Hepatitis B virus isolate HK352, complete genome 458..................._47695
DQ089788.1 Hepatitis B virus isolate HK820, complete genome 458..................._47695
DQ089789.1 Hepatitis B virus isolate HK926, complete genome 458..................._47695
DQ089790.1 Hepatitis B virus isolate HK1248, complete genome 458..................._47695
DQ089791.1 Hepatitis B virus isolate HK1205, complete genome 458..................._47695
DQ089792.1 Hepatitis B virus isolate HK870, complete genome 458..................._47695
DQ089793.1 Hepatitis B virus isolate HK343, complete genome 458..................._47695
DQ089794.1 Hepatitis B virus isolate HK1896, complete genome 411..................._42995
DQ089795.1 Hepatitis B virus isolate HK1465, complete genome 458..................._47695
DQ089796.1 Hepatitis B virus isolate HK751, complete genome 458..................._47695
DQ089797.1 Hepatitis B virus isolate HK1169, complete genome 458..................._47695
DQ089798.1 Hepatitis B virus isolate HK477, complete genome 458..................._47695
DQ089799.1 Hepatitis B virus isolate HK734, complete genome 458..................._47695
DQ089800.1 Hepatitis B virus isolate HK741, complete genome 419..................._43795
DQ089801.1 Hepatitis B virus isolate HK2100, complete genome 458..................._47695
DQ089802.1 Hepatitis B virus isolate HK1371, complete genome 458..................._47695
DQ089803.1 Hepatitis B virus isolate HK931, complete genome 458..................._47695
DQ089804.1 Hepatitis B virus isolate HK262, complete genome 458..................._47695
DQ060822.1 Hepatitis B virus isolate 8510-91, complete genome 458..................._47695
DQ060823.1 Hepatitis B virus isolate 8504-91, complete genome 458..................._47695
DQ060824.1 Hepatitis B virus isolate 0121-20, complete genome 458..................._47695
DQ060825.1 Hepatitis B virus isolate 0262-09, complete genome 458..................._47695
DQ060826.1 Hepatitis B virus isolate 0433-20, complete genome 458..................._47695
DQ060827.1 Hepatitis B virus isolate 0317-04, complete genome 458..................._47695
DQ060828.1 Hepatitis B virus isolate 0443-03, complete genome 458..................._47695
DQ060829.1 Hepatitis B virus isolate 0350-03, complete genome 458..................._47695
DQ060830.1 Hepatitis B virus isolate 235-01, complete genome 458..................._47695
DQ111986.1 Hepatitis B virus isolate MBT181, complete genome 458..................._47695
DQ111987.1 Hepatitis B virus isolate MMU36, complete genome 458..................._47695
AY862860.1 Hepatitis B virus clone Q11, complete genome 458..................._47695
AY862861.1 Hepatitis B virus clone Q17, complete genome 458..................._47695
AY862862.1 Hepatitis B virus clone Q20, complete genome 458..................._47695
AY862863.1 Hepatitis B virus clone Q23, complete genome 458..................._47695
AY862864.1 Hepatitis B virus clone Q34, complete genome 458..................._47695
AY862865.1 Hepatitis B virus clone Q311, complete genome 458..................._47695
AY862866.1 Hepatitis B virus clone Q312, complete genome 460..................._47895
AY862867.1 Hepatitis B virus clone Q42, complete genome 458..................._47695
AY862868.1 Hepatitis B virus clone Q43, complete genome 458..................._47695
AY862869.1 Hepatitis B virus clone Q80, complete genome 458..................._47695
AB201287.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds458..................._47695
AB201288.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds458..................._47695
AB201289.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds458..................._47695
AB201290.1 Hepatitis B virus genes for X protein, precore/core ORF, complete cds458..................._47695
AB231908.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH24 458..................._47695
AB231909.1 Hepatitis B virus DNA, complete genome, isolate:VH10 458..................._47695
AB119251.1 Hepatitis B virus DNA, complete genome, strain:Ehime13:BD No2,2002082458..................._47695
AB119252.1 Hepatitis B virus DNA, complete genome, strain:Ehime14:BD No7,2002082458..................._47695
AB119253.1 Hepatitis B virus DNA, complete genome, strain:Ehime15:BD No27,H12.01458..................._47695
AB119254.1 Hepatitis B virus DNA, complete genome, strain:Ehime16:BD No53,200301458..................._47695
AB119255.1 Hepatitis B virus DNA, complete genome, strain:Ehime17:Iyo 0719039 458..................._47695
AB119256.1 Hepatitis B virus DNA, complete genome, strain:Ehime18:Iyo 529246 458..................._47695
AB206816.1 Hepatitis B virus DNA, complete genome, strain: Toranomon 2274..................._229295
AB206817.1 Hepatitis B virus DNA, complete genome, strain: Hiroshima 2256..................._227495
AB188245.2 Hepatitis B virus DNA, complete genome, isolate:ALTAY136 458..................._47695
AB188243.2 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA27 458..................._47695
DQ207798.1 Hepatitis B virus strain N2829, complete genome 455..................._47395
AB219529.1 Hepatitis B virus DNA, complete genome, isolate:UK1 446..................._46495
AB219530.1 Hepatitis B virus DNA, complete genome, isolate:UK2 458..................._47695
AB219531.1 Hepatitis B virus DNA, complete genome, isolate:UK3 458..................._47695
AB219532.1 Hepatitis B virus DNA, complete genome, isolate:UK4 458..................._47695
AB219533.1 Hepatitis B virus DNA, complete genome, isolate:UK5 458..................._47695
AB219534.1 Hepatitis B virus DNA, complete genome, isolate:UK6 428..................._44695
DQ246215.1 Hepatitis B virus isolate GZ-DYH, complete genome 458..................._47695
DQ298161.1 Hepatitis B virus isolate LT3.12AM clone 1, complete genome 1859..................._187795
DQ298163.1 Hepatitis B virus isolate LT3.12AM clone 3, complete genome 1859..................._187795
DQ298164.1 Hepatitis B virus isolate LT3.12AM clone 4, complete genome 1859..................._187795
DQ298165.1 Hepatitis B virus isolate LT3.12AM clone 5, complete genome 1859..................._187795
DQ304548.1 Hepatitis B virus isolate LT4 clone 2, complete genome 1820..................._183895
DQ304549.1 Hepatitis B virus isolate LT4 clone 3, complete genome 1820..................._183895
DQ304550.1 Hepatitis B virus isolate LT4 clone 4, complete genome 1820..................._183895
DQ304551.1 Hepatitis B virus isolate LT4 clone 5, complete genome 1820..................._183895
AB182589.1 Hepatitis B virus DNA, complete genome, isolate:CH:Mat-Ko 458..................._47695
DQ329356.1 Hepatitis B virus isolate LT1 clone 1, complete genome 1815..................._183395
DQ329357.1 Hepatitis B virus isolate LT1 clone 2, complete genome 1815..................._183395
DQ361534.1 Hepatitis B virus isolate CR-081, complete genome 437..................._45595
DQ361535.1 Hepatitis B virus isolate CRP-228, complete genome 428..................._44695
DQ377159.1 Hepatitis B virus isolate WJT15, complete genome 458..................._47695
DQ377160.1 Hepatitis B virus isolate WJT16, complete genome 458..................._47695
DQ377161.1 Hepatitis B virus isolate WJT14, complete genome 458..................._47695
DQ377162.1 Hepatitis B virus isolate WJT20, complete genome 458..................._47695
DQ377163.1 Hepatitis B virus isolate WJT32, complete genome 458..................._47695
DQ377164.1 Hepatitis B virus isolate WJT5, complete genome 458..................._47695
DQ377165.1 Hepatitis B virus isolate WJT35, complete genome 458..................._47695
AB247916.1 Hepatitis B virus DNA, complete genome, lamivudine resistance with in458..................._47695
AJ627217.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20953 458..................._47695
AJ627219.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 24039 458..................._47695
AJ627221.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 30125 458..................._47695
AJ627224.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33852 458..................._47695
AJ627225.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 19749 458..................._47695
AJ627226.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 20952 449..................._46795
AJ627227.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21077 458..................._47695
AJ627228.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 34408 446..................._46495
DQ315776.1 Hepatitis B virus isolate EI00615, complete genome 458..................._47695
DQ315777.1 Hepatitis B virus isolate EI03194, complete genome 458..................._47695
DQ315778.1 Hepatitis B virus isolate EI0388, complete genome 458..................._47695
DQ315779.1 Hepatitis B virus isolate EI0399, complete genome 458..................._47695
DQ315780.1 Hepatitis B virus isolate EI02456, complete genome 428..................._44695
DQ315781.1 Hepatitis B virus isolate EI0398, complete genome 458..................._47695
DQ315782.1 Hepatitis B virus isolate EI0423, complete genome 449..................._46795
DQ315783.1 Hepatitis B virus isolate EI03188, complete genome 458..................._47695
DQ315784.1 Hepatitis B virus isolate EI03101, complete genome 458..................._47695
DQ315785.1 Hepatitis B virus isolate EI0386, complete genome 458..................._47695
DQ315786.1 Hepatitis B virus isolate EI057, complete genome 458..................._47695
AB250109.1 Hepatitis B virus DNA, complete genome, isolate: IH030213 408..................._42695
AB205152.1 Hepatitis B virus DNA, complete genome, isolate: HB-JFH7-99 458..................._47695
DQ399006.1 Hepatitis B virus isolate G1, complete genome 1740..................._175895
AB219426.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4014, PNN1 458..................._47695
AB219427.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4075, PNN2 458..................._47695
AB219428.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4076, PNN3 458..................._47695
AB219429.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4101, PNN4 458..................._47695
AB219430.1 Hepatitis B virus DNA, complete genome, isolate:Patient #4148, PNN5 458..................._47695
AB222707.1 Hepatitis B virus DNA, complete genome, isolate: UZTBV102 458..................._47695
AB222708.1 Hepatitis B virus DNA, complete genome, isolate: UZBV74 458..................._47695
AB222709.1 Hepatitis B virus DNA, complete genome, isolate: UZBV34 458..................._47695
AB222710.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6M 458..................._47695
AB222711.1 Hepatitis B virus DNA, complete genome, isolate: UZNV24 458..................._47695
AB222712.1 Hepatitis B virus DNA, complete genome, isolate: UZBV61 458..................._47695
AB222713.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC6 458..................._47695
AB222714.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7 458..................._47695
AB222715.1 Hepatitis B virus DNA, complete genome, isolate: UZNVC7M 458..................._47695
DQ448619.1 Hepatitis B virus isolate GZ-DYH, complete genome 458..................._47695
DQ448620.1 Hepatitis B virus isolate GZ-DYF, complete genome 458..................._47695
DQ448621.1 Hepatitis B virus isolate GZ-HQY, complete genome 458..................._47695
DQ448622.1 Hepatitis B virus isolate GZ-JSM, complete genome 458..................._47695
DQ448623.1 Hepatitis B virus isolate GZ-LMX, complete genome 458..................._47695
DQ448624.1 Hepatitis B virus isolate GZ-QSA, complete genome 458..................._47695
DQ448625.1 Hepatitis B virus isolate GZ-TXB, complete genome 458..................._47695
DQ448626.1 Hepatitis B virus isolate GZ-XLB, complete genome 458..................._47695
DQ448627.1 Hepatitis B virus isolate GZ-ZFL, complete genome 458..................._47695
DQ448628.1 Hepatitis B virus isolate GZ-ZX, complete genome 458..................._47695
AB210818.1 Hepatitis B virus DNA, complete genome, strain:Ehime 21-NM 458..................._47695
AB210819.1 Hepatitis B virus DNA, complete genome, strain:Toshima 1 458..................._47695
AB210821.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 1-OA 458..................._47695
AB210822.1 Hepatitis B virus DNA, complete genome, strain:Kokusai-Iryo 2-OS 458..................._47695
DQ463787.1 Hepatitis B virus isolate 928-9_1979, complete genome 458..................._47695
DQ463788.1 Hepatitis B virus isolate 739-11_1979, complete genome 458..................._47695
DQ463789.1 Hepatitis B virus isolate 650-15_1979, complete genome 458..................._47695
DQ463790.1 Hepatitis B virus isolate 621-14_1979, complete genome 458..................._47695
DQ463791.1 Hepatitis B virus isolate 539-16_1979, complete genome 458..................._47695
DQ463792.1 Hepatitis B virus isolate 524-3_1979, complete genome 458..................._47695
DQ463793.1 Hepatitis B virus isolate 462-4_1979, complete genome 458..................._47695
DQ463794.1 Hepatitis B virus isolate 234-6_1979, complete genome 458..................._47695
DQ463795.1 Hepatitis B virus isolate 928-9_2004, complete genome 458..................._47695
DQ463796.1 Hepatitis B virus isolate 739-11_2004, complete genome 458..................._47695
DQ463797.1 Hepatitis B virus isolate 650-15_2004, complete genome 458..................._47695
DQ463798.1 Hepatitis B virus isolate 621-14_2004, complete genome 458..................._47695
DQ463799.1 Hepatitis B virus isolate 539-16_2004, complete genome 458..................._47695
DQ463800.1 Hepatitis B virus isolate 524-3_2004, complete genome 458..................._47695
DQ463801.1 Hepatitis B virus isolate 462-4_2004, complete genome 458..................._47695
DQ463802.1 Hepatitis B virus isolate 234-6_2004, complete genome 458..................._47695
AM180623.1 Hepatitis B virus complete genome, isolate MAL36 458..................._47695
DQ478881.1 Hepatitis B virus isolate CHN-QH2, complete genome 458..................._47695
DQ478882.1 Hepatitis B virus isolate CHN-QH3, complete genome 458..................._47695
DQ478883.1 Hepatitis B virus isolate CHN-QH33, complete genome 458..................._47695
DQ478884.1 Hepatitis B virus isolate CHN-QH4, complete genome 458..................._47695
DQ478886.1 Hepatitis B virus isolate CHN-QH5, complete genome 458..................._47695
DQ478887.1 Hepatitis B virus isolate CHN-QH8, complete genome 458..................._47695
DQ478888.1 Hepatitis B virus isolate CHN-QH9, complete genome 458..................._47695
DQ478889.1 Hepatitis B virus isolate CHN-QH14, complete genome 458..................._47695
DQ478890.1 Hepatitis B virus isolate CHN-QH18, complete genome 458..................._47695
DQ478891.1 Hepatitis B virus isolate CHN-QH19, complete genome 458..................._47695
DQ478892.1 Hepatitis B virus isolate CHN-QH28, complete genome 458..................._47695
DQ478893.1 Hepatitis B virus isolate CHN-QH29, complete genome 458..................._47695
DQ478894.1 Hepatitis B virus isolate CHN-QH30, complete genome 458..................._47695
DQ478895.1 Hepatitis B virus isolate CHN-QH31, complete genome 458..................._47695
DQ478896.1 Hepatitis B virus isolate CHN-QH32, complete genome 458..................._47695
DQ478897.1 Hepatitis B virus isolate CHN-QH37, complete genome 458..................._47695
DQ478898.1 Hepatitis B virus isolate CHN-QH38, complete genome 458..................._47695
DQ478899.1 Hepatitis B virus isolate CHN-D20, complete genome 458..................._47695
DQ478900.1 Hepatitis B virus isolate CHN-H172, complete genome 458..................._47695
DQ478901.1 Hepatitis B virus isolate CHN-H155, complete genome 458..................._47695
DQ486021.1 Hepatitis B virus isolate LT13, complete genome 1820..................._183895
DQ486022.1 Hepatitis B virus isolate LT11, complete genome 1820..................._183895
DQ486023.1 Hepatitis B virus isolate LT10, complete genome 1799..................._181795
DQ486024.1 Hepatitis B virus isolate LT9, complete genome 1820..................._183895
DQ486025.1 Hepatitis B virus isolate LT12, complete genome 1820..................._183895
AB241109.1 Hepatitis B virus DNA, complete genome, isolate:PhCH24 458..................._47695
AB241110.1 Hepatitis B virus DNA, complete genome, isolate:PhLC03 458..................._47695
AB241111.1 Hepatitis B virus DNA, complete genome, isolate:PhLC14 458..................._47695
AB241112.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC15 404..................._42295
AB241113.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC13 404..................._42295
AB241114.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC01 458..................._47695
AB241115.1 Hepatitis B virus DNA, complete genome, isolate:PhCH09 458..................._47695
AB241116.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC03 423..................._44195
AB241117.1 Hepatitis B virus DNA, complete genome, isolate:PhHCC05 458..................._47695
AM282986.1 Hepatitis B virus (SUBTYPE ADW2), genotype A, complete genome 458..................._47695
AB246317.1 Hepatitis B virus DNA, complete genome, isolate: TA112 422..................._44095
DQ536410.1 Hepatitis B virus isolate JeF339 clone JeF339U-3, complete genome 458..................._47695
DQ536411.1 Hepatitis B virus isolate JeF339 clone JeF339U-1, complete genome 458..................._47695
DQ536412.1 Hepatitis B virus isolate JeF339 clone JeF339U-2, complete genome 458..................._47695
DQ683578.1 Hepatitis B virus from South Korea, complete genome 458..................._47695
DQ788725.1 Hepatitis B virus clone S1, complete genome 458..................._47695
DQ788726.1 Hepatitis B virus clone S15, complete genome 452..................._47095
DQ788727.1 Hepatitis B virus clone S18, complete genome 452..................._47095
DQ788728.1 Hepatitis B virus clone S24, complete genome 452..................._47095
DQ788729.1 Hepatitis B virus clone L1, complete genome 452..................._47095
AM184125.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate O64 458..................._47695
AM184126.1 Hepatitis B virus gene complete genome, sub-genotype A3, isolate N35 458..................._47695
DQ904357.1 Hepatitis B virus strain A0004 from China, complete genome 460..................._47895
DQ922649.1 Hepatitis B virus strain B0024, complete genome 460..................._47895
DQ922650.1 Hepatitis B virus strain C0955, complete genome 460..................._47895
DQ922651.1 Hepatitis B virus strain F0691, complete genome 460..................._47895
DQ975271.1 Hepatitis B virus strain B0641, complete genome 460..................._47895
DQ975272.1 Hepatitis B virus strain C1248, complete genome 460..................._47895
DQ975273.1 Hepatitis B virus strain e1013, complete genome 460..................._47895
DQ975274.1 Hepatitis B virus strain F0885, complete genome 460..................._47895
AM117394.1 Hepatitis B virus, isolate CHIMP_DJA, complete genome 457..................._47595
AM117395.1 Hepatitis B virus, isolate CHIMP_MAK, complete genome 457..................._47595
AM117396.1 Hepatitis B virus, isolate CHIMP_BAT, complete genome 457..................._47595
AM117397.1 Hepatitis B virus, isolate CHIMP_ED, complete genome 457..................._47595
DQ993181.1 Hepatitis B virus strain A0583, complete genome 460..................._47895
DQ980547.1 Hepatitis B virus strain E0113, complete genome 460..................._47895
DQ980548.1 Hepatitis B virus strain C1198, complete genome 460..................._47895
DQ980549.1 Hepatitis B virus strain B0949, complete genome 427..................._44595
DQ980550.1 Hepatitis B virus strain B0206, complete genome 403..................._42195
DQ980551.1 Hepatitis B virus strain A0712, complete genome 427..................._44595
DQ899142.1 Hepatitis B virus isolate Warao152, complete genome 458..................._47695
DQ899143.1 Hepatitis B virus isolate Warao189, complete genome 458..................._47695
DQ899144.1 Hepatitis B virus isolate Japreira75, complete genome 458..................._47695
DQ899145.1 Hepatitis B virus isolate Japreira76, complete genome 458..................._47695
DQ899146.1 Hepatitis B virus isolate Japreira80, complete genome 458..................._47695
DQ899147.1 Hepatitis B virus isolate Japreira116, complete genome 458..................._47695
DQ899148.1 Hepatitis B virus isolate Yanomami114, complete genome 458..................._47695
DQ899149.1 Hepatitis B virus isolate Piaroa3019, complete genome 458..................._47695
DQ899150.1 Hepatitis B virus isolate Colombia8, complete genome 458..................._47695
DQ986375.1 Hepatitis B virus strain 616-93, complete genome 460..................._47895
DQ986376.1 Hepatitis B virus strain F0297, complete genome 430..................._44895
AB246335.1 Hepatitis B virus DNA, complete genome, clone: Aa_IND 458..................._47695
AB246336.1 Hepatitis B virus DNA, complete genome, clone: Aa_SAF 458..................._47695
AB246337.1 Hepatitis B virus DNA, complete genome, clone: Ae_US 458..................._47695
AB246338.1 Hepatitis B virus DNA, complete genome, clone: Ae_JPN 458..................._47695
AB246339.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN51 458..................._47695
AB246340.1 Hepatitis B virus DNA, complete genome, clone: Ba_JPN58 458..................._47695
AB246341.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN35 458..................._47695
AB246342.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN56 458..................._47695
AB246343.1 Hepatitis B virus DNA, complete genome, clone: Bj_JPN57 458..................._47695
AB246344.1 Hepatitis B virus DNA, complete genome, clone: C_JPN22 458..................._47695
AB246345.1 Hepatitis B virus DNA, complete genome, clone: C_JPNAT 458..................._47695
AB246346.1 Hepatitis B virus DNA, complete genome, clone: C_HK74 458..................._47695
AB246347.1 Hepatitis B virus DNA, complete genome, clone: D_IND60 458..................._47695
AB246348.1 Hepatitis B virus DNA, complete genome, clone: D_US68 458..................._47695
DQ995802.1 Hepatitis B virus isolate H293-16, complete genome 458..................._47695
DQ995803.1 Hepatitis B virus isolate C265-15, complete genome 458..................._47695
DQ995804.1 Hepatitis B virus isolate C1691-11, complete genome 458..................._47695
DQ995805.1 Hepatitis B virus isolate H60-2.5KB, complete genome 405..................._42395
AB288026.1 Hepatitis B virus DNA, complete genome, genotype: C, country: Japan, 458..................._47695
EF134945.1 Hepatitis B virus isolate G247-B3, complete genome 1853..................._187195
EF134946.1 Hepatitis B virus isolate G247-B5, complete genome 1853..................._187195
AB267090.1 Hepatitis B virus ayw/Japan/Ehime 22-HS/2005 DNA, complete genome 458..................._47695
EF208113.1 Hepatitis B virus clone B-S3, complete genome 458..................._47695
EF208114.1 Hepatitis B virus clone B-S7, complete genome 458..................._47695
EF208115.1 Hepatitis B virus clone B-S8, complete genome 458..................._47695
AB270547.1 Hepatitis B virus DNA, complete genome, isolate: MGL295F 458..................._47695
AB270548.1 Hepatitis B virus DNA, complete genome, isolate: MGL207F 458..................._47695
AB270549.1 Hepatitis B virus DNA, complete genome, isolate: MGL79F 458..................._47695
AB270550.1 Hepatitis B virus DNA, complete genome, isolate: MGL247F 458..................._47695
AB270534.1 Hepatitis B virus DNA, complete genome, isolate: MGL110F 458..................._47695
AB270535.1 Hepatitis B virus DNA, complete genome, isolate: MGL50F 458..................._47695
AB270536.1 Hepatitis B virus DNA, complete genome, isolate: MGL226F 457..................._47595
AB270537.1 Hepatitis B virus DNA, complete genome, isolate: MGL22F 458..................._47695
AB270538.1 Hepatitis B virus DNA, complete genome, isolate: MGL231F 458..................._47695
AB270539.1 Hepatitis B virus DNA, complete genome, isolate: MGL200F 458..................._47695
AB270541.1 Hepatitis B virus DNA, complete genome, isolate: MGL47F 458..................._47695
AB270542.1 Hepatitis B virus DNA, complete genome, isolate: MGL12F 458..................._47695
AB270543.1 Hepatitis B virus DNA, complete genome, isolate: MGL209F 458..................._47695
AB270544.1 Hepatitis B virus DNA, complete genome, isolate: MGL215F 458..................._47695
AB270545.1 Hepatitis B virus DNA, complete genome, isolate: MGL108F 458..................._47695
AB270546.1 Hepatitis B virus DNA, complete genome, isolate: MGL88F 458..................._47695
EF103276.1 Hepatitis B virus isolate Ran22, complete genome 458..................._47695
EF103277.1 Hepatitis B virus isolate Ran33, complete genome 458..................._47695
EF103278.1 Hepatitis B virus isolate Ran60, complete genome 458..................._47695
EF103279.1 Hepatitis B virus isolate Ran99, complete genome 458..................._47695
EF103280.1 Hepatitis B virus isolate Ran100, complete genome 458..................._47695
EF103281.1 Hepatitis B virus isolate Ran102, complete genome 458..................._47695
EF103282.1 Hepatitis B virus isolate Ran103, complete genome 458..................._47695
EF103283.1 Hepatitis B virus isolate Ran105, complete genome 458..................._47695
EF103284.1 Hepatitis B virus isolate Ran113, complete genome 458..................._47695
AB274969.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB320 458..................._47695
AB274970.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB291 458..................._47695
AB274971.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB295 458..................._47695
AB274972.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB250 403..................._42195
AB274973.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB18 452..................._47095
AB274974.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB60 458..................._47695
AB274975.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB241 458..................._47695
AB274976.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB382 458..................._47695
AB274977.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB183 458..................._47695
AB274978.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB261 458..................._47695
AB274979.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB302 458..................._47695
AB274981.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB331 458..................._47695
AB274982.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB130 458..................._47695
AB274983.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB85 458..................._47695
AB274984.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB109 458..................._47695
AB274985.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB145 452..................._47095
AM295795.1 Hepatitis B virus complete genome, clone LB1Clone5 458..................._47695
AM295796.1 Hepatitis B virus complete genome, clone LB1Clone10 458..................._47695
AM295797.1 Hepatitis B virus complete genome, clone LB2Clone6 458..................._47695
AM295798.1 Hepatitis B virus complete genome, clone LB3Clone1 458..................._47695
AM295799.1 Hepatitis B virus complete genome, clone LB3Clone5 458..................._47695
AM295800.2 Hepatitis B virus complete genome, clone LB3Clone11 459..................._47795
DQ890381.1 Hepatitis B virus strain S40U, complete genome 458..................._47695
EF536065.1 Hepatitis B virus strain XZK pre-t, complete genome 460..................._47895
EF536066.1 Mutant Hepatitis B virus strain XZK t-w128, complete genome 460..................._47895
EF137802.1 Hepatitis B virus strain JH4-1896-G, complete genome 458..................._47695
EF137803.1 Hepatitis B virus strain JH4-1896-A, complete genome 458..................._47695
AB195930.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-1 458..................._47695
AB195931.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-2 458..................._47695
AB195932.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MM lam 1-3 458..................._47695
AB195933.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-1 458..................._47695
AB195934.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-2 458..................._47695
AB195935.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 2-3 458..................._47695
AB195936.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-1 458..................._47695
AB195937.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-2 458..................._47695
AB195938.1 Hepatitis B virus DNA, complete genome, strain: Ehi-MH lam 3-3 458..................._47695
AB195939.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-1 458..................._47695
AB195940.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-2 458..................._47695
AB195941.1 Hepatitis B virus DNA, complete genome, strain: Ehi-YY lam 4-3 458..................._47695
AB195942.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-1 458..................._47695
AB195943.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-2 458..................._47695
AB195944.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 5-3 458..................._47695
AB195945.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-1 458..................._47695
AB195946.1 Hepatitis B virus DNA, complete genome, strain: Ehi-OM lam 6-2 413..................._43195
AB195947.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-1 458..................._47695
AB195948.1 Hepatitis B virus DNA, complete genome, strain: Ehi-SK lam 7-2 458..................._47695
AB195949.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-1 458..................._47695
AB195950.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-2 458..................._47695
AB195951.1 Hepatitis B virus DNA, complete genome, strain: Ehi-TH lam 8-3 458..................._47695
AB195952.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-1 458..................._47695
AB195953.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-2 458..................._47695
AB195954.1 Hepatitis B virus DNA, complete genome, strain: Ehi-KK lam 9-3 458..................._47695
AB195955.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-1 458..................._47695
AB195956.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-2 458..................._47695
AB195957.1 Hepatitis B virus DNA, complete genome, strain: Ehi-IK lam 10-3 458..................._47695
AM422939.1 Hepatitis B virus, genotype D, complete genome, isolate X28 458..................._47695
DQ993680.1 Hepatitis B virus isolate patient 268, complete genome 458..................._47695
DQ993681.1 Hepatitis B virus isolate patient 290, complete genome 458..................._47695
DQ993682.1 Hepatitis B virus isolate patient 479, complete genome 458..................._47695
DQ993683.1 Hepatitis B virus isolate patient 82, complete genome 458..................._47695
DQ993684.1 Hepatitis B virus isolate patient 336, complete genome 458..................._47695
DQ993685.1 Hepatitis B virus isolate patient 554, complete genome 458..................._47695
DQ993686.1 Hepatitis B virus isolate patient 342, complete genome 458..................._47695
DQ993687.1 Hepatitis B virus isolate patient 700, complete genome 458..................._47695
DQ993688.1 Hepatitis B virus isolate 209-0519-Nature1.2-unSero, complete genome 458..................._47695
DQ993689.1 Hepatitis B virus isolate 209-1119-Nature1.1-unSero, complete genome 458..................._47695
DQ993690.1 Hepatitis B virus isolate 204-1113-Nature1.1-unSero, complete genome 458..................._47695
DQ993691.1 Hepatitis B virus isolate 4007-0803-Nature2.2-unSero, complete genome458..................._47695
DQ993692.1 Hepatitis B virus isolate 4007-0810-Nature2.1-unSero, complete genome458..................._47695
DQ993693.1 Hepatitis B virus isolate 232-1125-Nature1.1-unSero, complete genome 458..................._47695
DQ993695.1 Hepatitis B virus isolate patient 373, complete genome 458..................._47695
DQ993696.1 Hepatitis B virus isolate patient 452b1, complete genome 458..................._47695
DQ993697.1 Hepatitis B virus isolate patient 940b1, complete genome 458..................._47695
DQ993698.1 Hepatitis B virus isolate 6144-0327-ETCvs3TC-Naive, complete genome 458..................._47695
DQ993699.1 Hepatitis B virus isolate 6144-0226-ETCvs3TC-Break, complete genome 458..................._47695
DQ993700.1 Hepatitis B virus isolate JMY-0725-ETC, complete genome 458..................._47695
DQ993701.1 Hepatitis B virus isolate JMY-0210-ETCvs3TC-Brack, complete genome 458..................._47695
DQ993702.1 Hepatitis B virus isolate JMY-0919-ETCvs3TC-Naive, complete genome 458..................._47695
DQ993703.1 Hepatitis B virus isolate 236-0526-Nature1.2-Sero, complete genome 458..................._47695
DQ993704.1 Hepatitis B virus isolate 239-1127-Nature3.1-unSero, complete genome 458..................._47695
DQ993705.1 Hepatitis B virus isolate 239-0625-Nature3.4-unSero, complete genome 458..................._47695
DQ993706.1 Hepatitis B virus isolate 239-0402-Nature3.3-unSero, complete genome 458..................._47695
DQ993707.1 Hepatitis B virus isolate 239-O218-Nature3.2-unSero, complete genome 458..................._47695
DQ993708.1 Hepatitis B virus isolate 6136-1228-Naive, complete genome 458..................._47695
DQ993709.1 Hepatitis B virus isolate 6136-0127-ETCvs3TC-Break, complete genome 458..................._47695
DQ993710.1 Hepatitis B virus isolate 6144-0718-ETC, complete genome 458..................._47695
DQ993711.1 Hepatitis B virus isolate 221-1120-Nature1.1-unSero, complete genome 458..................._47695
EF634480.1 Hepatitis B virus clone G6, complete genome 458..................._47695
EF634481.1 Hepatitis B virus clone G1, complete genome 458..................._47695
EF688062.1 Hepatitis B virus isolate GZ28-1, complete genome 458..................._47695
EF473973.1 Hepatitis B virus isolate EIH45AChinese, complete genome 458..................._47695
EF473974.1 Hepatitis B virus isolate EIH21AChinese, complete genome 458..................._47695
EF473975.1 Hepatitis B virus isolate 2061Chinese, complete genome 458..................._47695
EF473977.1 Hepatitis B virus isolate KD048East, complete genome 458..................._47695
EF464097.1 Hepatitis B virus isolate 06hac, complete genome 458..................._47695
EF464098.1 Hepatitis B virus isolate 09hgg, complete genome 458..................._47695
EF464099.1 Hepatitis B virus isolate 05hgg, complete genome 458..................._47695
AB202071.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-1 458..................._47695
AB202072.1 Hepatitis B virus DNA, complete genome, strain:Ehi-OK lam 8-2 434..................._45295
AB302095.1 Hepatitis B virus DNA, complete genome, clone: Bj_39 458..................._47695
EU086721.1 Hepatitis B virus isolate HRO/w4601-2002, complete genome 458..................._47695
EF494376.1 Hepatitis B virus isolate TW706 genotype C, complete genome 458..................._47695
EF494377.1 Hepatitis B virus isolate TW1138 genotype C, complete genome 425..................._44395
EF494379.1 Hepatitis B virus isolate TW8585 genotype C, complete genome 458..................._47695
EF494380.1 Hepatitis B virus isolate TW836 genotype B, complete genome 458..................._47695
EF494381.1 Hepatitis B virus isolate TW936 genotype B, complete genome 458..................._47695
EF494382.1 Hepatitis B virus isolate TWD347 genotype B, complete genome 451..................._46995
EU139543.1 Hepatitis B virus strain NDJ, complete genome 458..................._47695
AB298720.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1S 458..................._47695
AB298721.1 Hepatitis B virus DNA, complete genome, isolate: BAJT2006-1C 458..................._47695
EU054331.1 Hepatitis B virus strain FE-929-MO, complete genome 458..................._47695
AB300359.1 Hepatitis B virus DNA, complete genome, isolate: patient1 458..................._47695
AB300360.1 Hepatitis B virus DNA, complete genome, isolate: patient2 458..................._47695
AB300361.1 Hepatitis B virus DNA, complete genome, isolate: patient3 458..................._47695
AB300362.1 Hepatitis B virus DNA, complete genome, isolate: patient4 458..................._47695
AB300363.1 Hepatitis B virus DNA, complete genome, isolate: patient5 458..................._47695
AB300364.1 Hepatitis B virus DNA, complete genome, isolate: patient6 458..................._47695
AB300365.1 Hepatitis B virus DNA, complete genome, isolate: patient7 458..................._47695
AB300366.1 Hepatitis B virus DNA, complete genome, isolate: patient8 458..................._47695
AB300367.1 Hepatitis B virus DNA, complete genome, isolate: patient9 458..................._47695
AB300368.1 Hepatitis B virus DNA, complete genome, isolate: patient10 458..................._47695
AB300369.1 Hepatitis B virus DNA, complete genome, isolate: patient11 458..................._47695
AB300370.1 Hepatitis B virus DNA, complete genome, isolate: patient12 401..................._41995
AB300372.1 Hepatitis B virus DNA, complete genome, isolate: patient14 458..................._47695
AB300373.1 Hepatitis B virus DNA, complete genome, isolate: patient15 434..................._45295
EF473971.1 Hepatitis B virus isolate 2059Java, complete genome 458..................._47695
EF473972.1 Hepatitis B virus isolate 1839Java, complete genome 458..................._47695
EF473976.1 Hepatitis B virus isolate Alr049East, complete genome 458..................._47695
AB368295.1 Hepatitis B virus DNA, complete genome, Genotype B, Subgenotype B4, c458..................._47695
AB368296.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c458..................._47695
AB368297.1 Hepatitis B virus DNA, complete genome, Genotype C, Subgenotype C2, c458..................._47695
EU239217.1 Hepatitis B virus isolate G2451, complete genome 458..................._47695
EU239218.1 Hepatitis B virus isolate BD2, complete genome 458..................._47695
EU239219.1 Hepatitis B virus isolate PW3, complete genome 458..................._47695
EU239220.1 Hepatitis B virus isolate PW5, complete genome 458..................._47695
EU239222.1 Hepatitis B virus isolate PW2, complete genome 458..................._47695
EU239223.1 Hepatitis B virus isolate PW4, complete genome 458..................._47695
EU239224.1 Hepatitis B virus isolate BD1, complete genome 458..................._47695
EU239225.1 Hepatitis B virus isolate PW7, complete genome 455..................._47395
EU239226.1 Hepatitis B virus isolate PW6, complete genome 458..................._47695
AB287314.1 Hepatitis B virus DNA, complete genome, isolate: Alaska433 458..................._47695
AB287315.1 Hepatitis B virus DNA, complete genome, isolate: Alaska419 458..................._47695
AB287316.1 Hepatitis B virus DNA, complete genome, isolate: Alaska427 458..................._47695
AB287317.1 Hepatitis B virus DNA, complete genome, isolate: Alaska416 458..................._47695
AB287318.1 Hepatitis B virus DNA, complete genome, isolate: Alaska2 458..................._47695
AB287319.1 Hepatitis B virus DNA, complete genome, isolate: AlaskaG23 458..................._47695
AB287320.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-1 458..................._47695
AB287321.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-2 458..................._47695
AB287322.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-3 458..................._47695
AB287323.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-4 458..................._47695
AB287324.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-5 458..................._47695
AB287325.1 Hepatitis B virus DNA, complete genome, isolate: Greenland-6 458..................._47695
AB287326.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A44 458..................._47695
AB287327.1 Hepatitis B virus DNA, complete genome, isolate: JPN Bj A53 458..................._47695
AB287328.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba 51 458..................._47695
AB287329.1 Hepatitis B virus DNA, complete genome, isolate: JPN Ba A55 458..................._47695
EU155893.1 Hepatitis B virus isolate 4, complete genome 458..................._47695
EU155895.1 Hepatitis B virus isolate 5b, complete genome 458..................._47695
D00220.2HPBVCG Hepatitis B virus DNA, complete genome, strain: LSH 458..................._47695
AB330366.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ2HB458..................._47695
AB330368.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ54H458..................._47695
AB330370.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ6HB458..................._47695
AB330371.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ23H458..................._47695
AB330372.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ22H458..................._47695
EU185780.1 Hepatitis B virus isolate H-IDU7 (Rec.Arg-1) D3/A2 recombinant, compl458..................._47695
EU158262.1 Hepatitis B virus isolate G116, complete genome 458..................._47695
EU158263.1 Hepatitis B virus isolate G108, complete genome 458..................._47695
EU305540.1 Hepatitis B virus isolate G67-123, complete genome 458..................._47695
EU305541.1 Hepatitis B virus isolate G67-190, complete genome 458..................._47695
EU305542.1 Hepatitis B virus isolate G67-1251, complete genome 458..................._47695
EU305543.1 Hepatitis B virus isolate L15-57, complete genome 458..................._47695
EU305544.1 Hepatitis B virus isolate L15-129, complete genome 458..................._47695
EU305545.1 Hepatitis B virus isolate L15-196, complete genome 458..................._47695
EU305546.1 Hepatitis B virus isolate M118-153, complete genome 458..................._47695
EU305547.1 Hepatitis B virus isolate M118-481, complete genome 458..................._47695
EU305548.1 Hepatitis B virus isolate M118-673, complete genome 458..................._47695
AM494689.1 Hepatitis B virus complete genome, isolate CAR006 446..................._46495
AM494690.1 Hepatitis B virus complete genome, isolate CAR008 458..................._47695
AM494691.1 Hepatitis B virus complete genome, isolate CAR024 458..................._47695
AM494693.1 Hepatitis B virus complete genome, isolate CAR039 458..................._47695
AM494694.1 Hepatitis B virus complete genome, isolate CAR047 458..................._47695
AM494695.1 Hepatitis B virus complete genome, isolate CAR053 458..................._47695
AM494696.1 Hepatitis B virus complete genome, isolate CAR060 458..................._47695
AM494697.1 Hepatitis B virus complete genome, isolate CAR063 458..................._47695
AM494698.1 Hepatitis B virus complete genome, isolate CAR066 437..................._45595
AM494699.1 Hepatitis B virus complete genome, isolate CAR082 458..................._47695
AM494700.1 Hepatitis B virus complete genome, isolate CAR083 458..................._47695
AM494701.1 Hepatitis B virus complete genome, isolate CAR097 458..................._47695
AM494702.1 Hepatitis B virus complete genome, isolate CAR106 458..................._47695
AM494703.1 Hepatitis B virus complete genome, isolate CAR107 458..................._47695
AM494704.1 Hepatitis B virus complete genome, isolate CAR112 458..................._47695
AM494705.1 Hepatitis B virus complete genome, isolate CAR115 458..................._47695
AM494706.1 Hepatitis B virus complete genome, isolate CAR131 458..................._47695
AM494707.1 Hepatitis B virus complete genome, isolate CAR137 458..................._47695
AM494708.1 Hepatitis B virus complete genome, isolate CAR138 458..................._47695
AM494709.1 Hepatitis B virus complete genome, isolate CAR143 458..................._47695
AM494710.1 Hepatitis B virus complete genome, isolate CAR144 458..................._47695
AM494711.1 Hepatitis B virus complete genome, isolate CAR146 455..................._47395
AM494712.1 Hepatitis B virus complete genome, isolate CAR150 455..................._47395
AM494713.1 Hepatitis B virus complete genome, isolate CAR154 458..................._47695
AM494714.1 Hepatitis B virus complete genome, isolate CAR165 458..................._47695
AM494715.1 Hepatitis B virus complete genome, isolate CAR171 458..................._47695
AM494716.1 Hepatitis B virus complete genome, isolate CAR175 458..................._47695
AM494717.1 Hepatitis B virus complete genome, isolate CAR187 458..................._47695
AM494718.1 Hepatitis B virus complete genome, isolate CAR204 458..................._47695
EU306670.1 Hepatitis B virus clone 110-33, complete genome 432..................._45095
EU306671.1 Hepatitis B virus clone 626-49, complete genome 458..................._47695
EU306672.1 Hepatitis B virus clone 626-20, complete genome 458..................._47695
EU306673.1 Hepatitis B virus clone 213-10, complete genome 458..................._47695
EU306674.1 Hepatitis B virus clone 213-6, complete genome 458..................._47695
EU306675.1 Hepatitis B virus clone 213-21, complete genome 458..................._47695
EU306678.1 Hepatitis B virus clone 220-36, complete genome 458..................._47695
EU306679.1 Hepatitis B virus clone 220-26, complete genome 458..................._47695
EU306680.1 Hepatitis B virus clone 220-27, complete genome 458..................._47695
EU306681.1 Hepatitis B virus clone 220-44, complete genome 458..................._47695
EU306682.1 Hepatitis B virus clone 220-8, complete genome 458..................._47695
EU306683.1 Hepatitis B virus clone 220-30, complete genome 458..................._47695
EU306685.1 Hepatitis B virus clone 327-4, complete genome 458..................._47695
EU306686.1 Hepatitis B virus clone 327-28, complete genome 458..................._47695
EU306687.1 Hepatitis B virus clone 327-6, complete genome 458..................._47695
EU306688.1 Hepatitis B virus clone 327-54, complete genome 458..................._47695
EU306689.1 Hepatitis B virus clone 327-27, complete genome 458..................._47695
EU306690.1 Hepatitis B virus clone 327-71, complete genome 458..................._47695
EU306691.1 Hepatitis B virus clone 327-57, complete genome 458..................._47695
EU306692.1 Hepatitis B virus clone 327-73, complete genome 458..................._47695
EU306693.1 Hepatitis B virus clone 327-67, complete genome 458..................._47695
EU306694.1 Hepatitis B virus clone 327-46, complete genome 458..................._47695
EU306699.1 Hepatitis B virus clone 807-13, complete genome 458..................._47695
EU306700.1 Hepatitis B virus clone 221-2, complete genome 458..................._47695
EU306701.1 Hepatitis B virus clone 221-10, complete genome 458..................._47695
EU306702.1 Hepatitis B virus clone 221-11, complete genome 458..................._47695
EU306703.1 Hepatitis B virus clone 221-13, complete genome 458..................._47695
EU306704.1 Hepatitis B virus clone 221-29, complete genome 458..................._47695
EU306705.1 Hepatitis B virus clone 221-31, complete genome 458..................._47695
EU306706.1 Hepatitis B virus clone 221-33, complete genome 458..................._47695
EU306707.1 Hepatitis B virus clone 221-36, complete genome 458..................._47695
EU306708.1 Hepatitis B virus clone 221-37, complete genome 458..................._47695
EU306709.1 Hepatitis B virus clone 221-42, complete genome 458..................._47695
EU306710.1 Hepatitis B virus clone 221-14, complete genome 458..................._47695
EU306711.1 Hepatitis B virus clone 221-50, complete genome 458..................._47695
EU306712.1 Hepatitis B virus clone 221-15, complete genome 458..................._47695
EU306713.1 Hepatitis B virus clone 602-27, complete genome 458..................._47695
EU306714.1 Hepatitis B virus clone 602-77, complete genome 458..................._47695
EU306715.1 Hepatitis B virus clone 602(son)-17, complete genome 458..................._47695
EU306716.1 Hepatitis B virus clone 602(son)-18, complete genome 458..................._47695
EU306717.1 Hepatitis B virus clone 602(son)-22, complete genome 458..................._47695
EU306718.1 Hepatitis B virus clone 602(son)-24, complete genome 458..................._47695
EU306720.1 Hepatitis B virus clone 602(son)-68, complete genome 458..................._47695
EU306721.1 Hepatitis B virus clone 602(son)-1, complete genome 458..................._47695
EU306722.1 Hepatitis B virus clone 6022-28-, complete genome 458..................._47695
EU306723.1 Hepatitis B virus clone 6022-19, complete genome 458..................._47695
EU306724.1 Hepatitis B virus clone 6022-2-, complete genome 458..................._47695
EU306725.1 Hepatitis B virus clone 6022-17, complete genome 458..................._47695
EU306726.1 Hepatitis B virus clone 6022-12-, complete genome 458..................._47695
EU306727.1 Hepatitis B virus clone 6022-5-, complete genome 458..................._47695
EU306728.1 Hepatitis B virus clone 6022-43, complete genome 458..................._47695
EU306729.1 Hepatitis B virus clone 6022-33, complete genome 458..................._47695
EU350409.1 Hepatitis B virus isolate BTO5856, complete genome 458..................._47695
EU410079.1 Hepatitis B virus isolate ph109, complete genome 458..................._47695
EU410080.1 Hepatitis B virus isolate ph76, complete genome 458..................._47695
EU410081.1 Hepatitis B virus isolate ph80, complete genome 458..................._47695
EU410082.1 Hepatitis B virus isolate ph81, complete genome 458..................._47695
EU439005.1 Hepatitis B virus clone 6022-35 from China, complete genome 458..................._47695
EU439006.1 Hepatitis B virus clone 602(S)-3 from China, complete genome 458..................._47695
EU439007.1 Hepatitis B virus clone 602(S)-39 from China, complete genome 458..................._47695
EU439008.1 Hepatitis B virus clone 6023-27 from China, complete genome 458..................._47695
EU439010.1 Hepatitis B virus clone 6023-38 from China, complete genome 458..................._47695
EU439015.1 Hepatitis B virus clone zgh-26 from China, complete genome 458..................._47695
EU439016.1 Hepatitis B virus clone zgh-9 from China, complete genome 458..................._47695
EU439018.1 Hepatitis B virus clone dzc-5 from China, complete genome 458..................._47695
EU439019.1 Hepatitis B virus clone dzc-6 from China, complete genome 458..................._47695
EU439020.1 Hepatitis B virus clone dzc-12 from China, complete genome 458..................._47695
EU439021.1 Hepatitis B virus clone dzc-14 from China, complete genome 458..................._47695
EU439022.1 Hepatitis B virus clone dzc-19 from China, complete genome 458..................._47695
EU439024.1 Hepatitis B virus clone 220-42 from China, complete genome 458..................._47695
AB365445.1 Hepatitis B virus DNA, complete genome, isolate: BOL1 458..................._47695
AB365446.1 Hepatitis B virus DNA, complete genome, isolate: BOL3 458..................._47695
AB365447.1 Hepatitis B virus DNA, complete genome, isolate: BOL51 458..................._47695
AB365448.1 Hepatitis B virus DNA, complete genome, isolate: BOL71 460..................._47895
AB365449.1 Hepatitis B virus DNA, complete genome, isolate: BOL93 458..................._47695
AB365450.1 Hepatitis B virus DNA, complete genome, isolate: BOL102 458..................._47695
AB365451.1 Hepatitis B virus DNA, complete genome, isolate: BOL196 458..................._47695
AB365452.1 Hepatitis B virus DNA, complete genome, isolate: BOL577 458..................._47695
AB365453.1 Hepatitis B virus DNA, complete genome, isolate: BOL584 458..................._47695
AM410963.1 Hepatitis B virus complete genome, clone LB3Clone24 458..................._47695
AB426467.1 Hepatitis B virus DNA, complete genome, clone: HBVFH0204 458..................._47695
DQ991753.2 Hepatitis B virus isolate Irish-13, complete genome 458..................._47695
EU547558.1 Hepatitis B virus isolate MC01, complete genome 458..................._47695
EU547559.1 Hepatitis B virus isolate MC02, complete genome 425..................._44395
EU547561.1 Hepatitis B virus isolate MC04, complete genome 458..................._47695
EU547562.1 Hepatitis B virus isolate MC05, complete genome 458..................._47695
EU547563.1 Hepatitis B virus isolate MC06, complete genome 458..................._47695
EU439009.1 Hepatitis B virus clone 6023-33 from China, complete genome 411..................._42995
AB299858.1 Hepatitis B virus subtype adr DNA, complete genome, clone: HBVFH0204 458..................._47695
EU554535.1 Hepatitis B virus isolate S472-20, complete genome 458..................._47695
EU554536.1 Hepatitis B virus isolate S472-24, complete genome 458..................._47695
EU554537.1 Hepatitis B virus isolate S541-13, complete genome 458..................._47695
EU554538.1 Hepatitis B virus isolate S541-15, complete genome 458..................._47695
EU554539.1 Hepatitis B virus isolate S541-21, complete genome 458..................._47695
EU554540.1 Hepatitis B virus isolate S304-10, complete genome 458..................._47695
EU554541.1 Hepatitis B virus isolate S696-1, complete genome 458..................._47695
EU554542.1 Hepatitis B virus isolate S696-4, complete genome 458..................._47695
EU562215.1 Hepatitis B virus isolate 11, complete genome 458..................._47695
EU562216.1 Hepatitis B virus isolate 13, complete genome 458..................._47695
EU562217.1 Hepatitis B virus isolate 16, complete genome 458..................._47695
EU562218.1 Hepatitis B virus isolate 7, complete genome 458..................._47695
EU562219.1 Hepatitis B virus isolate 5, complete genome 458..................._47695
EU560438.1 Hepatitis B virus isolate 2-B74, complete genome 458..................._47695
EU560439.1 Hepatitis B virus isolate 7-B74, complete genome 458..................._47695
EU560440.1 Hepatitis B virus isolate 1-S869, complete genome 458..................._47695
EU560441.1 Hepatitis B virus isolate 4-S869, complete genome 458..................._47695
EU570067.1 Hepatitis B virus isolate 18-S541, complete genome 458..................._47695
EU570068.1 Hepatitis B virus isolate 26-S541, complete genome 458..................._47695
EU570069.1 Hepatitis B virus isolate 1-B24, complete genome 458..................._47695
EU570070.1 Hepatitis B virus isolate 2-B24, complete genome 458..................._47695
EU570071.1 Hepatitis B virus isolate 4-B24, complete genome 458..................._47695
EU570072.1 Hepatitis B virus isolate 1-B74, complete genome 458..................._47695
EU570073.1 Hepatitis B virus isolate 8-S698, complete genome 458..................._47695
EU570074.1 Hepatitis B virus isolate 11-S698, complete genome 458..................._47695
EU570075.1 Hepatitis B virus isolate 11-S142, complete genome 458..................._47695
EU579441.1 Hepatitis B virus isolate 12 genotype B, complete genome 458..................._47695
EU579442.1 Hepatitis B virus isolate 6 genotype C, complete genome 458..................._47695
EU579443.1 Hepatitis B virus isolate 2 genotype C, complete genome 458..................._47695
EU595030.1 Hepatitis B virus isolate 6, complete genome 458..................._47695
EU595031.1 Hepatitis B virus isolate 7, complete genome 458..................._47695
EU589335.1 Hepatitis B virus isolate S142-5, complete genome 458..................._47695
EU589336.1 Hepatitis B virus isolate S1175-1, complete genome 458..................._47695
EU589337.1 Hepatitis B virus isolate S710-2, complete genome 452..................._47095
EU589341.1 Hepatitis B virus isolate S852-10, complete genome 413..................._43195
EU589342.1 Hepatitis B virus isolate S852-13, complete genome 413..................._43195
EU589343.1 Hepatitis B virus isolate S852-15, complete genome 413..................._43195
EU589345.1 Hepatitis B virus isolate S624-2, complete genome 443..................._46195
AB302942.1 Hepatitis B virus DNA, complte genome, isolate: GRE3837NN 458..................._47695
AB302943.1 Hepatitis B virus DNA, complte genome, isolate: GRE3639NN 458..................._47695
AB302944.1 Hepatitis B virus DNA, complte genome, isolate: GRE3641NN 458..................._47695
AB302945.1 Hepatitis B virus DNA, complte genome, isolate: GRE3643NN 458..................._47695
EU487256.1 Hepatitis B virus isolate patient12, complete genome 458..................._47695
EU487257.1 Hepatitis B virus isolate patient14, complete genome 458..................._47695
EU414133.1 Hepatitis B virus strain 28058, complete genome 458..................._47695
EU414135.1 Hepatitis B virus strain 28025, complete genome 458..................._47695
EU414136.1 Hepatitis B virus strain 28052, complete genome 458..................._47695
EU414137.1 Hepatitis B virus strain 28059, complete genome 458..................._47695
EU414141.1 Hepatitis B virus strain 28051, complete genome 458..................._47695
EU414142.1 Hepatitis B virus strain 28004, complete genome 458..................._47695
EU414143.1 Hepatitis B virus strain 28042, complete genome 458..................._47695
EU747320.1 Hepatitis B virus isolate V51, complete genome 458..................._47695
EU670261.1 Hepatitis B virus isolate 499, complete genome 378..................._39695
EU670262.1 Hepatitis B virus isolate 549, complete genome 458..................._47695
EU670263.1 Hepatitis B virus isolate ph105, complete genome 458..................._47695
EU717211.1 Hepatitis B virus isolate D23K-6, complete genome 460..................._47895
EU717212.1 Hepatitis B virus isolate D26K-7, complete genome 460..................._47895
AB375165.1 Hepatitis B virus DNA, complete genome, strain: MEXICO8-G 458..................._47695
AB375166.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-G 458..................._47695
AB375167.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32-G 458..................._47695
AB375168.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-G 458..................._47695
AB375169.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-G 458..................._47695
AB375170.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-G 458..................._47695
EU330989.1 Hepatitis B virus isolate M84-74, complete genome 458..................._47695
EU330990.1 Hepatitis B virus isolate M84-146, complete genome 458..................._47695
EU330992.1 Hepatitis B virus isolate M85-6, complete genome 458..................._47695
EU330993.1 Hepatitis B virus isolate M85-8, complete genome 457..................._47595
EU330994.1 Hepatitis B virus isolate M85-10, complete genome 458..................._47695
EU330995.1 Hepatitis B virus isolate M85-80, complete genome 458..................._47695
EU330996.1 Hepatitis B virus isolate M85-81, complete genome 458..................._47695
EU330997.1 Hepatitis B virus isolate M85-216, complete genome 458..................._47695
EU330998.1 Hepatitis B virus isolate M85-1043, complete genome 458..................._47695
EU330999.1 Hepatitis B virus isolate M85-1044, complete genome 458..................._47695
EU331000.1 Hepatitis B virus isolate M85-1045, complete genome 458..................._47695
EU331001.1 Hepatitis B virus isolate M85-1046, complete genome 458..................._47695
EU796066.1 Hepatitis B virus strain 0477, complete genome 458..................._47695
EU796067.1 Hepatitis B virus strain 2164, complete genome 458..................._47695
EU796068.1 Hepatitis B virus strain 3831, complete genome 458..................._47695
EU796069.1 Hepatitis B virus strain 4364, complete genome 458..................._47695
EU796070.1 Hepatitis B virus strain 4460, complete genome 458..................._47695
EU796071.1 Hepatitis B virus strain 5051, complete genome 458..................._47695
EU796072.1 Hepatitis B virus strain 5131, complete genome 458..................._47695
EU871969.1 Hepatitis B virus isolate 6-024-1, complete genome 458..................._47695
EU871970.1 Hepatitis B virus isolate 6-024-3, complete genome 458..................._47695
EU871971.1 Hepatitis B virus isolate 6-024-5, complete genome 458..................._47695
EU871972.1 Hepatitis B virus isolate 6-024-8, complete genome 458..................._47695
EU871973.1 Hepatitis B virus isolate 6-024-99-5, complete genome 458..................._47695
EU871974.1 Hepatitis B virus isolate 6-024A-1, complete genome 458..................._47695
EU871975.1 Hepatitis B virus isolate 6-024A-8, complete genome 458..................._47695
EU871976.1 Hepatitis B virus isolate 179-04-3, complete genome 458..................._47695
EU871977.1 Hepatitis B virus isolate 252-2, complete genome 458..................._47695
EU871978.1 Hepatitis B virus isolate 252-95-2, complete genome 458..................._47695
EU871979.1 Hepatitis B virus isolate 252-95-4, complete genome 458..................._47695
EU871980.1 Hepatitis B virus isolate 318-01-5, complete genome 458..................._47695
EU871981.1 Hepatitis B virus isolate 318-95-3, complete genome 458..................._47695
EU871982.1 Hepatitis B virus isolate 318-96-2, complete genome 458..................._47695
EU871983.1 Hepatitis B virus isolate 318-97-2, complete genome 458..................._47695
EU871984.1 Hepatitis B virus isolate 490-00-1, complete genome 458..................._47695
EU871985.1 Hepatitis B virus isolate 490-00-3, complete genome 458..................._47695
EU871986.1 Hepatitis B virus isolate 490-1, complete genome 458..................._47695
EU871987.1 Hepatitis B virus isolate 490-01-1, complete genome 458..................._47695
EU871988.1 Hepatitis B virus isolate 490-01-3, complete genome 458..................._47695
EU871989.1 Hepatitis B virus isolate 490-03-3, complete genome 458..................._47695
EU871990.1 Hepatitis B virus isolate 490-04-1, complete genome 458..................._47695
EU871991.1 Hepatitis B virus isolate 490-04-3, complete genome 458..................._47695
EU871992.1 Hepatitis B virus isolate 490-99-1, complete genome 458..................._47695
EU871993.1 Hepatitis B virus isolate 490-99-2, complete genome 458..................._47695
EU871994.1 Hepatitis B virus isolate 490A-3, complete genome 458..................._47695
EU871995.1 Hepatitis B virus isolate 490A-4, complete genome 458..................._47695
EU871996.1 Hepatitis B virus isolate 490A-6, complete genome 458..................._47695
EU871997.1 Hepatitis B virus isolate 530-00-3, complete genome 458..................._47695
EU871998.1 Hepatitis B virus isolate 530-00-5, complete genome 458..................._47695
EU871999.1 Hepatitis B virus isolate 530-00-7, complete genome 458..................._47695
EU872000.1 Hepatitis B virus isolate 530-92-2, complete genome 458..................._47695
EU872001.1 Hepatitis B virus isolate 530-92-8, complete genome 458..................._47695
EU872002.1 Hepatitis B virus isolate 530-97-1, complete genome 458..................._47695
EU872003.1 Hepatitis B virus isolate 530-97-2, complete genome 458..................._47695
EU872004.1 Hepatitis B virus isolate 530-97-3, complete genome 458..................._47695
EU872005.1 Hepatitis B virus isolate 179-96-1, complete genome 400..................._41895
EU872006.1 Hepatitis B virus isolate 318-92-1, complete genome 458..................._47695
EU872007.1 Hepatitis B virus isolate 252-92-6, complete genome 458..................._47695
EU872008.1 Hepatitis B virus isolate 252A-8, complete genome 458..................._47695
EU872009.1 Hepatitis B virus isolate 318-98-4, complete genome 443..................._46195
EU872010.1 Hepatitis B virus isolate 252-92-3, complete genome 458..................._47695
EU872011.1 Hepatitis B virus isolate 318-99-8, complete genome 443..................._46195
EU872012.1 Hepatitis B virus isolate 318-99-5, complete genome 458..................._47695
EU872013.1 Hepatitis B virus isolate 318-99-6, complete genome 443..................._46195
EU872014.1 Hepatitis B virus isolate 490-96-3, complete genome 403..................._42195
EU872015.1 Hepatitis B virus isolate 490-96-1, complete genome 403..................._42195
EU872016.1 Hepatitis B virus isolate 490A-1, complete genome 458..................._47695
EU872017.1 Hepatitis B virus isolate 530-00-6, complete genome 458..................._47695
EU594382.1 Hepatitis B virus strain 3798-91, complete genome 458..................._47695
EU594383.1 Hepatitis B virus strain 2000-00, complete genome 458..................._47695
EU594384.1 Hepatitis B virus strain 1906-99, complete genome 458..................._47695
EU594385.1 Hepatitis B virus strain 1898-98, complete genome 458..................._47695
EU594386.1 Hepatitis B virus strain 644-00, complete genome 458..................._47695
EU594387.1 Hepatitis B virus strain 3784-91, complete genome 458..................._47695
EU594388.1 Hepatitis B virus strain 3782-91, complete genome 458..................._47695
EU594389.1 Hepatitis B virus strain 4435-97, complete genome 458..................._47695
EU594390.1 Hepatitis B virus strain 4625-97, complete genome 458..................._47695
EU594391.1 Hepatitis B virus strain 4620-97, complete genome 458..................._47695
EU594392.1 Hepatitis B virus strain 4600-97, complete genome 458..................._47695
EU594393.1 Hepatitis B virus strain 4590-97, complete genome 458..................._47695
EU594394.1 Hepatitis B virus strain 4512-97, complete genome 458..................._47695
EU594395.1 Hepatitis B virus strain 4509-97, complete genome 458..................._47695
EU594396.1 Hepatitis B virus strain 4383-97, complete genome 458..................._47695
EU594397.1 Hepatitis B virus strain 4398-97, complete genome 458..................._47695
EU594434.1 Hepatitis B virus strain 683-95, complete genome 458..................._47695
EU594435.1 Hepatitis B virus strain 320-95, complete genome 458..................._47695
EU594436.1 Hepatitis B virus strain 4550-97, complete genome 458..................._47695
EU787434.1 Hepatitis B virus isolate 92, complete genome 458..................._47695
EU787435.1 Hepatitis B virus isolate 114, complete genome 458..................._47695
EU787436.1 Hepatitis B virus isolate 165, complete genome 458..................._47695
EU787437.1 Hepatitis B virus isolate 17, complete genome 458..................._47695
EU787438.1 Hepatitis B virus isolate 7, complete genome 458..................._47695
EU787439.1 Hepatitis B virus isolate 89, complete genome 458..................._47695
EU787440.1 Hepatitis B virus isolate W17, complete genome 458..................._47695
EU787441.1 Hepatitis B virus isolate W32, complete genome 458..................._47695
EU787442.1 Hepatitis B virus isolate W37, complete genome 458..................._47695
EU787443.1 Hepatitis B virus isolate w40, complete genome 458..................._47695
EU787444.1 Hepatitis B virus isolate W41, complete genome 458..................._47695
EU787445.1 Hepatitis B virus isolate W51, complete genome 458..................._47695
EU787446.1 Hepatitis B virus isolate W75, complete genome 458..................._47695
EU787447.1 Hepatitis B virus isolate W46, complete genome 458..................._47695
AB453979.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH1 458..................._47695
AB453980.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH2 458..................._47695
AB453981.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH3 458..................._47695
AB453982.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH4 458..................._47695
AB453984.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH6 458..................._47695
AB453985.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH7 458..................._47695
AB453986.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH8 458..................._47695
AB453987.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH9 458..................._47695
AB453988.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH10 458..................._47695
AB453989.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH11 458..................._47695
AB453983.1 Hepatitis B virus DNA, complete genome, isolate: JPN_CH5 458..................._47695
EU921418.1 Hepatitis B virus isolate 22.165.07, complete genome 458..................._47695
EU921419.1 Hepatitis B virus isolate 22.252.07, complete genome 458..................._47695
EU919197.1 Hepatitis B virus isolate XJU, complete genome 458..................._47695
EU939536.1 Hepatitis B virus isolate C3, complete genome 458..................._47695
EU939537.1 Hepatitis B virus isolate C8, complete genome 404..................._42295
EU939538.1 Hepatitis B virus isolate C9, complete genome 458..................._47695
EU939539.1 Hepatitis B virus isolate C22, complete genome 458..................._47695
EU939540.1 Hepatitis B virus isolate C24, complete genome 458..................._47695
EU939541.1 Hepatitis B virus isolate C25, complete genome 458..................._47695
EU939542.1 Hepatitis B virus isolate C26, complete genome 458..................._47695
EU939543.1 Hepatitis B virus isolate C38, complete genome 458..................._47695
EU939544.1 Hepatitis B virus isolate C39, complete genome 458..................._47695
EU939545.1 Hepatitis B virus isolate C41, complete genome 458..................._47695
EU939546.1 Hepatitis B virus isolate C44, complete genome 458..................._47695
EU939547.1 Hepatitis B virus isolate C45, complete genome 458..................._47695
EU939548.1 Hepatitis B virus isolate C46, complete genome 458..................._47695
EU939549.1 Hepatitis B virus isolate C49, complete genome 458..................._47695
EU939550.1 Hepatitis B virus isolate C55, complete genome 458..................._47695
EU939551.1 Hepatitis B virus isolate C56, complete genome 458..................._47695
EU939552.1 Hepatitis B virus isolate C57, complete genome 458..................._47695
EU939553.1 Hepatitis B virus isolate C60, complete genome 458..................._47695
EU939554.1 Hepatitis B virus isolate C61, complete genome 458..................._47695
EU939555.1 Hepatitis B virus isolate C63, complete genome 458..................._47695
EU939556.1 Hepatitis B virus isolate C64, complete genome 449..................._46795
EU939557.1 Hepatitis B virus isolate C65, complete genome 446..................._46495
EU939558.1 Hepatitis B virus isolate C66, complete genome 428..................._44695
EU939559.1 Hepatitis B virus isolate C67, complete genome 458..................._47695
EU939560.1 Hepatitis B virus isolate C69, complete genome 425..................._44395
EU939561.1 Hepatitis B virus isolate C70, complete genome 458..................._47695
EU939562.1 Hepatitis B virus isolate C75, complete genome 458..................._47695
EU939563.1 Hepatitis B virus isolate C76, complete genome 458..................._47695
EU939564.1 Hepatitis B virus isolate C77, complete genome 458..................._47695
EU939565.1 Hepatitis B virus isolate C86, complete genome 458..................._47695
EU939566.1 Hepatitis B virus isolate C88, complete genome 458..................._47695
EU939567.1 Hepatitis B virus isolate C91, complete genome 458..................._47695
EU939568.1 Hepatitis B virus isolate C93, complete genome 458..................._47695
EU939569.1 Hepatitis B virus isolate C102, complete genome 458..................._47695
EU939570.1 Hepatitis B virus isolate C103, complete genome 458..................._47695
EU939571.1 Hepatitis B virus isolate C104, complete genome 458..................._47695
EU939572.1 Hepatitis B virus isolate C105, complete genome 458..................._47695
EU939573.1 Hepatitis B virus isolate C106, complete genome 458..................._47695
EU939574.1 Hepatitis B virus isolate C109, complete genome 430..................._44895
EU939575.1 Hepatitis B virus isolate C113, complete genome 454..................._47295
EU939576.1 Hepatitis B virus isolate C115, complete genome 428..................._44695
EU939577.1 Hepatitis B virus isolate C116, complete genome 458..................._47695
EU939578.1 Hepatitis B virus isolate C119, complete genome 458..................._47695
EU939579.1 Hepatitis B virus isolate C120, complete genome 458..................._47695
EU939580.1 Hepatitis B virus isolate B1, complete genome 458..................._47695
EU939581.1 Hepatitis B virus isolate B16, complete genome 458..................._47695
EU939582.1 Hepatitis B virus isolate B25, complete genome 458..................._47695
EU939583.1 Hepatitis B virus isolate B31, complete genome 416..................._43495
EU939584.1 Hepatitis B virus isolate B107, complete genome 458..................._47695
EU939585.1 Hepatitis B virus isolate B126, complete genome 458..................._47695
EU939586.1 Hepatitis B virus isolate B142, complete genome 458..................._47695
EU939587.1 Hepatitis B virus isolate C2, complete genome 458..................._47695
EU939588.1 Hepatitis B virus isolate C173, complete genome 458..................._47695
EU939589.1 Hepatitis B virus isolate C175, complete genome 458..................._47695
EU939590.1 Hepatitis B virus isolate C127, complete genome 458..................._47695
EU939591.1 Hepatitis B virus isolate C131, complete genome 458..................._47695
EU939592.1 Hepatitis B virus isolate C141, complete genome 458..................._47695
EU939593.1 Hepatitis B virus isolate C144, complete genome 458..................._47695
EU939594.1 Hepatitis B virus isolate C146, complete genome 458..................._47695
EU939595.1 Hepatitis B virus isolate C147, complete genome 458..................._47695
EU939596.1 Hepatitis B virus isolate C149, complete genome 458..................._47695
EU939597.1 Hepatitis B virus isolate C151, complete genome 458..................._47695
EU939598.1 Hepatitis B virus isolate C164, complete genome 458..................._47695
EU939599.1 Hepatitis B virus isolate C172, complete genome 455..................._47395
EU939600.1 Hepatitis B virus isolate C176, complete genome 458..................._47695
EU939601.1 Hepatitis B virus isolate C177, complete genome 458..................._47695
EU939602.1 Hepatitis B virus isolate C179, complete genome 458..................._47695
EU939603.1 Hepatitis B virus isolate C183, complete genome 458..................._47695
EU939604.1 Hepatitis B virus isolate C192, complete genome 458..................._47695
EU939605.1 Hepatitis B virus isolate C200, complete genome 458..................._47695
EU939606.1 Hepatitis B virus isolate C206, complete genome 458..................._47695
EU939607.1 Hepatitis B virus isolate C207, complete genome 458..................._47695
EU939608.1 Hepatitis B virus isolate C208, complete genome 433..................._45195
EU939609.1 Hepatitis B virus isolate C209, complete genome 458..................._47695
EU939610.1 Hepatitis B virus isolate C211, complete genome 458..................._47695
EU939611.1 Hepatitis B virus isolate C212, complete genome 458..................._47695
EU939612.1 Hepatitis B virus isolate C213, complete genome 458..................._47695
EU939613.1 Hepatitis B virus isolate C214, complete genome 458..................._47695
EU939614.1 Hepatitis B virus isolate C217, complete genome 458..................._47695
EU939615.1 Hepatitis B virus isolate C226, complete genome 458..................._47695
EU939616.1 Hepatitis B virus isolate C228, complete genome 458..................._47695
EU939617.1 Hepatitis B virus isolate C229, complete genome 458..................._47695
EU939618.1 Hepatitis B virus isolate C230, complete genome 458..................._47695
EU939619.1 Hepatitis B virus isolate C233, complete genome 458..................._47695
EU939620.1 Hepatitis B virus isolate B140, complete genome 458..................._47695
EU939621.1 Hepatitis B virus isolate C94, complete genome 458..................._47695
EU939622.1 Hepatitis B virus isolate C124, complete genome 458..................._47695
EU939623.1 Hepatitis B virus isolate C126, complete genome 458..................._47695
EU939624.1 Hepatitis B virus isolate C138, complete genome 422..................._44095
EU939625.1 Hepatitis B virus isolate C167, complete genome 458..................._47695
EU939626.1 Hepatitis B virus isolate D158, complete genome 458..................._47695
EU939627.1 Hepatitis B virus isolate C15, complete genome 458..................._47695
EU939628.1 Hepatitis B virus isolate C72, complete genome 451..................._46995
EU939629.1 Hepatitis B virus isolate C95, complete genome 458..................._47695
EU939630.1 Hepatitis B virus isolate C122, complete genome 458..................._47695
EU939631.1 Hepatitis B virus isolate C123, complete genome 458..................._47695
EU939632.1 Hepatitis B virus isolate C130, complete genome 441..................._45995
EU939633.1 Hepatitis B virus isolate C181, complete genome 458..................._47695
EU939634.1 Hepatitis B virus isolate C19, complete genome 458..................._47695
EU939635.1 Hepatitis B virus isolate B125, complete genome 458..................._47695
EU939636.1 Hepatitis B virus isolate C11, complete genome 458..................._47695
EU939637.1 Hepatitis B virus isolate C13, complete genome 458..................._47695
EU939638.1 Hepatitis B virus isolate C17, complete genome 458..................._47695
EU939639.1 Hepatitis B virus isolate C28, complete genome 458..................._47695
EU939640.1 Hepatitis B virus isolate C239, complete genome 458..................._47695
EU939641.1 Hepatitis B virus isolate D18, complete genome 404..................._42295
EU939642.1 Hepatitis B virus isolate D20, complete genome 458..................._47695
EU939643.1 Hepatitis B virus isolate D32, complete genome 458..................._47695
EU939644.1 Hepatitis B virus isolate D36, complete genome 458..................._47695
EU939645.1 Hepatitis B virus isolate D38, complete genome 458..................._47695
EU939646.1 Hepatitis B virus isolate D88, complete genome 458..................._47695
EU939647.1 Hepatitis B virus isolate D90, complete genome 458..................._47695
EU939648.1 Hepatitis B virus isolate D96, complete genome 458..................._47695
EU939649.1 Hepatitis B virus isolate D98, complete genome 458..................._47695
EU939650.1 Hepatitis B virus isolate D103, complete genome 429..................._44795
EU939651.1 Hepatitis B virus isolate D104, complete genome 458..................._47695
EU939652.1 Hepatitis B virus isolate D107, complete genome 458..................._47695
EU939653.1 Hepatitis B virus isolate D109, complete genome 458..................._47695
EU939654.1 Hepatitis B virus isolate D115, complete genome 458..................._47695
EU939655.1 Hepatitis B virus isolate D116, complete genome 458..................._47695
EU939656.1 Hepatitis B virus isolate D117, complete genome 458..................._47695
EU939657.1 Hepatitis B virus isolate D139, complete genome 458..................._47695
EU939659.1 Hepatitis B virus isolate D165, complete genome 458..................._47695
EU939660.1 Hepatitis B virus isolate C34, complete genome 431..................._44995
EU939661.1 Hepatitis B virus isolate C40, complete genome 458..................._47695
EU939662.1 Hepatitis B virus isolate C62, complete genome 458..................._47695
EU939663.1 Hepatitis B virus isolate C74, complete genome 458..................._47695
EU939664.1 Hepatitis B virus isolate C85, complete genome 458..................._47695
EU939665.1 Hepatitis B virus isolate C129, complete genome 458..................._47695
EU939666.1 Hepatitis B virus isolate C150, complete genome 458..................._47695
EU939667.1 Hepatitis B virus isolate C171, complete genome 458..................._47695
EU939668.1 Hepatitis B virus isolate C182, complete genome 458..................._47695
EU939669.1 Hepatitis B virus isolate C185, complete genome 458..................._47695
EU939670.1 Hepatitis B virus isolate C189, complete genome 458..................._47695
EU939671.1 Hepatitis B virus isolate C201, complete genome 458..................._47695
EU939672.1 Hepatitis B virus isolate C215, complete genome 458..................._47695
EU939673.1 Hepatitis B virus isolate C219, complete genome 458..................._47695
EU939674.1 Hepatitis B virus isolate C232, complete genome 458..................._47695
EU939675.1 Hepatitis B virus isolate C235, complete genome 458..................._47695
EU939676.1 Hepatitis B virus isolate D54, complete genome 458..................._47695
EU939677.1 Hepatitis B virus isolate D95, complete genome 458..................._47695
EU939678.1 Hepatitis B virus isolate D106, complete genome 458..................._47695
EU939679.1 Hepatitis B virus isolate D134, complete genome 458..................._47695
EU939681.1 Hepatitis B virus isolate D146, complete genome 458..................._47695
EU366129.2 Hepatitis B virus isolate BA92, complete genome 458..................._47695
AB367392.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 1, derived 458..................._47695
AB367393.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 2/Adefovir-458..................._47695
AB367394.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 3/Adefovir-458..................._47695
AB367395.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 4, derived 458..................._47695
AB367396.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 5, derived 458..................._47695
AB367397.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 6, derived 458..................._47695
AB367398.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 7/Adefovir-458..................._47695
AB367399.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 8/Adefovir-458..................._47695
AB367400.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 9, derived 458..................._47695
AB367401.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 10/Adefovir458..................._47695
AB367402.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 11, derived458..................._47695
AB367403.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 12/Adefovir458..................._47695
AB367404.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 13/Adefovir458..................._47695
AB367405.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 14/Adefovir410..................._42895
AB367406.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 15/Adefovir458..................._47695
AB367407.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 16/Adefovir458..................._47695
AB367408.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 17/Adefovir425..................._44395
AB367409.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 18, derived413..................._43195
AB367410.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 19/Adefovir458..................._47695
AB367411.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 20, derived458..................._47695
AB367412.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 21, derived458..................._47695
AB367413.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 22/Adefovir425..................._44395
AB367414.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 23/Adefovir458..................._47695
AB367415.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 24/Adefovir458..................._47695
AB367416.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 25, derived458..................._47695
AB367417.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 26, derived458..................._47695
AB367418.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 27/Adefovir458..................._47695
AB367419.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 28, derived458..................._47695
AB367420.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 29, derived458..................._47695
AB367421.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 30, derived458..................._47695
AB367422.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 31/Adefovir458..................._47695
AB367423.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 32/Adefovir458..................._47695
AB367424.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 33, derived458..................._47695
AB367425.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 34/Adefovir422..................._44095
AB367426.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 35, derived413..................._43195
AB367427.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 36/Adefovir458..................._47695
AB367428.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 37/Adefovir404..................._42295
AB367429.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 38, derived419..................._43795
AB367430.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 39/Adefovir446..................._46495
AB367431.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 40, derived458..................._47695
AB367432.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 41, derived458..................._47695
AB367433.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 42/Adefovir404..................._42295
AB367434.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 43/Adefovir458..................._47695
AB367435.1 Hepatitis B virus DNA, complete genome, isolate: LAMr Pt. 44/Adefovir452..................._47095
AB367800.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 24 458..................._47695
AB367801.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 30 413..................._43195
AB367802.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 16 419..................._43795
AB367803.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 13 458..................._47695
AB367804.1 Hepatitis B virus DNA, complete gonome, isolate: ADVT Pt. 6 458..................._47695
FM209512.1 Hepatitis B virus complete genome, isolate G15 458..................._47695
FM209513.1 Hepatitis B virus complete genome, isolate G18 458..................._47695
FM209514.1 Hepatitis B virus complete genome, isolate G50 458..................._47695
FM209515.1 Hepatitis B virus complete genome, isolate G51 458..................._47695
FM209516.1 Hepatitis B virus complete genome, isolate G56 458..................._47695
FJ032331.1 Hepatitis B virus isolate S193-1 from China, complete genome 458..................._47695
FJ032334.1 Hepatitis B virus isolate S445-3 from China, complete genome 458..................._47695
FJ032335.1 Hepatitis B virus isolate S459-2 from China, complete genome 457..................._47595
FJ032336.1 Hepatitis B virus isolate S462-4 from China, complete genome 458..................._47695
FJ032337.1 Hepatitis B virus isolate S462-5 from China, complete genome 458..................._47695
FJ032338.1 Hepatitis B virus isolate S462-7 from China, complete genome 458..................._47695
FJ032339.1 Hepatitis B virus isolate S462-9 from China, complete genome 458..................._47695
FJ032340.1 Hepatitis B virus isolate S529-1 from China, complete genome 458..................._47695
FJ032341.1 Hepatitis B virus isolate S529-6 from China, complete genome 458..................._47695
FJ032342.1 Hepatitis B virus isolate S659-2 from China, complete genome 458..................._47695
FJ032343.1 Hepatitis B virus isolate S659-4 from China, complete genome 452..................._47095
FJ032344.1 Hepatitis B virus isolate S659-5 from China, complete genome 458..................._47695
FJ032345.1 Hepatitis B virus isolate S696-3 from China, complete genome 458..................._47695
FJ032346.1 Hepatitis B virus isolate S732-3 from China, complete genome 458..................._47695
FJ032349.1 Hepatitis B virus isolate S734-1 from China, complete genome 458..................._47695
FJ032350.1 Hepatitis B virus isolate S943-1 from China, complete genome 458..................._47695
FJ032351.1 Hepatitis B virus isolate S943-5 from China, complete genome 458..................._47695
FJ032352.1 Hepatitis B virus isolate S1026-3 from China, complete genome 458..................._47695
FJ032353.1 Hepatitis B virus isolate S1026-4 from China, complete genome 458..................._47695
FJ032354.1 Hepatitis B virus isolate S1026-7 from China, complete genome 458..................._47695
FJ032355.1 Hepatitis B virus isolate S1030-8 from China, complete genome 458..................._47695
FJ032356.1 Hepatitis B virus isolate S1030-9 from China, complete genome 458..................._47695
FJ032357.1 Hepatitis B virus isolate S1607-8 from China, complete genome 458..................._47695
FJ032359.1 Hepatitis B virus isolate S1634-1 from China, complete genome 458..................._47695
FJ032360.1 Hepatitis B virus isolate S1634-2 from China, complete genome 458..................._47695
FJ032361.1 Hepatitis B virus isolate S1634-7 from China, complete genome 458..................._47695
FJ023642.1 Hepatitis B virus isolate C2_C04-1257 S protein (S) and core protein 458..................._47695
FJ023659.1 Hepatitis B virus isolate I1_M04-0469, complete genome 458..................._47695
FJ023660.1 Hepatitis B virus isolate I1_M04-3692, complete genome 458..................._47695
FJ023661.1 Hepatitis B virus isolate I1_M05-0592, complete genome 458..................._47695
FJ023663.1 Hepatitis B virus isolate I1_M04-3979, complete genome 458..................._47695
FJ023664.1 Hepatitis B virus isolate I2_M04-0026, complete genome 458..................._47695
FJ023665.1 Hepatitis B virus isolate I2_M04-0033, complete genome 458..................._47695
FJ023666.1 Hepatitis B virus isolate I2_M04-1907, complete genome 458..................._47695
FJ023667.1 Hepatitis B virus isolate I2_M04-2742, complete genome 458..................._47695
FJ023669.1 Hepatitis B virus isolate I2_M04-3665, complete genome 458..................._47695
FJ023670.1 Hepatitis B virus isolate I2_M04-3724, complete genome 458..................._47695
FJ023671.1 Hepatitis B virus isolate I2_M04-3733, complete genome 458..................._47695
FJ023672.1 Hepatitis B virus isolate I2_M04-2305, complete genome 458..................._47695
FJ023673.1 Hepatitis B virus isolate I2_M04-4997, complete genome 458..................._47695
FJ023674.1 Hepatitis B virus isolate I2/C2_C04-0790 S protein (S) and core prote458..................._47695
FJ023675.1 Hepatitis B virus isolate I1/I2_M04-3739 S protein (S) and core prote458..................._47695
FJ023676.1 Hepatitis B virus isolate I1/I2_M04-2531 S protein (S) and core prote458..................._47695
FJ023631.1 Hepatitis B virus isolate B2_C04-1213 S protein (S) and core protein 458..................._47695
FJ023632.1 Hepatitis B virus isolate B4_C04-0254 S protein (S) and core protein 458..................._47695
FJ023633.1 Hepatitis B virus isolate B4_C04-0583 S protein (S) and core protein 458..................._47695
FJ023634.1 Hepatitis B virus isolate B4_C04-1358 S protein (S) and core protein 458..................._47695
FJ023635.1 Hepatitis B virus isolate B4_M04-0467 S protein (S) and core protein 458..................._47695
FJ023636.1 Hepatitis B virus isolate B4_M04-0876 S protein (S) and core protein 458..................._47695
FJ023637.1 Hepatitis B virus isolate B5_M04-0013 S protein (S) and core protein 458..................._47695
FJ023638.1 Hepatitis B virus isolate B5_M04-0465 S protein (S) and core protein 458..................._47695
FJ023639.1 Hepatitis B virus isolate C2_C04-0968 S protein (S) and core protein 458..................._47695
FJ023640.1 Hepatitis B virus isolate C2_C04-1206 S protein (S) and core protein 431..................._44995
FJ023641.1 Hepatitis B virus isolate C2_C04-1237 S protein (S) and core protein 458..................._47695
FJ023643.1 Hepatitis B virus isolate C2_C04-1306 S protein (S) and core protein 458..................._47695
FJ023644.1 Hepatitis B virus isolate C2_C04-1318 S protein (S) and core protein 458..................._47695
FJ023645.1 Hepatitis B virus isolate C2_M04-0071 S protein (S) and core protein 458..................._47695
FJ023646.1 Hepatitis B virus isolate C2_M04-0201 S protein (S) and core protein 458..................._47695
FJ023647.1 Hepatitis B virus isolate C2_M04-0214 S protein (S) and core protein 458..................._47695
FJ023648.1 Hepatitis B virus isolate C2_M04-0273 S protein (S) and core protein 458..................._47695
FJ023649.1 Hepatitis B virus isolate C2_M04-0289 S protein (S) and core protein 458..................._47695
FJ023650.1 Hepatitis B virus isolate C2_M04-0341 S protein (S) and core protein 458..................._47695
FJ023651.1 Hepatitis B virus isolate C2_M04-0391 S protein (S) and core protein 437..................._45595
FJ023652.1 Hepatitis B virus isolate C2_M04-0648 S protein (S) and core protein 401..................._41995
FJ023653.1 Hepatitis B virus isolate C2_M04-0909 S protein (S) and core protein 458..................._47695
FJ023654.1 Hepatitis B virus isolate C2_C04-1412 S protein (S) and core protein 458..................._47695
FJ023655.1 Hepatitis B virus isolate C2_M04-0754 S protein (S) and core protein 428..................._44695
FJ023656.1 Hepatitis B virus isolate C2_M04-0938 S protein (S) and core protein 458..................._47695
FJ023657.1 Hepatitis B virus isolate C2_M04-0987 S protein (S) and core protein 458..................._47695
FJ023658.1 Hepatitis B virus isolate C2_M04-1116 S protein (S) and core protein 458..................._47695
FJ386574.1 Hepatitis B virus isolate 1743, complete genome 458..................._47695
FJ386575.1 Hepatitis B virus isolate 1745, complete genome 458..................._47695
FJ386576.1 Hepatitis B virus isolate 1746, complete genome 458..................._47695
FJ386577.1 Hepatitis B virus isolate 1747, complete genome 458..................._47695
FJ386578.1 Hepatitis B virus isolate 1748, complete genome 458..................._47695
FJ386579.1 Hepatitis B virus isolate 1762, complete genome 458..................._47695
FJ386580.1 Hepatitis B virus isolate 1763, complete genome 458..................._47695
FJ386581.1 Hepatitis B virus isolate 1764, complete genome 458..................._47695
FJ386582.1 Hepatitis B virus isolate 1765, complete genome 458..................._47695
FJ386583.1 Hepatitis B virus isolate 1780, complete genome 458..................._47695
FJ386584.1 Hepatitis B virus isolate 1798, complete genome 458..................._47695
FJ386585.1 Hepatitis B virus isolate 1800, complete genome 458..................._47695
FJ386586.1 Hepatitis B virus isolate 1811, complete genome 458..................._47695
FJ386587.1 Hepatitis B virus isolate 1812, complete genome 458..................._47695
FJ386588.1 Hepatitis B virus isolate 1828, complete genome 458..................._47695
FJ386589.1 Hepatitis B virus isolate 1830, complete genome 458..................._47695
FJ386590.1 Hepatitis B virus isolate 1841, complete genome 458..................._47695
FJ386591.1 Hepatitis B virus isolate 1869, complete genome 458..................._47695
FJ386592.1 Hepatitis B virus isolate 1870, complete genome 458..................._47695
FJ386593.1 Hepatitis B virus isolate 1877, complete genome 440..................._45895
FJ386594.1 Hepatitis B virus isolate 1878, complete genome 443..................._46195
FJ386595.1 Hepatitis B virus isolate 1879, complete genome 458..................._47695
FJ386596.1 Hepatitis B virus isolate 1887, complete genome 458..................._47695
FJ386597.1 Hepatitis B virus isolate 1888, complete genome 458..................._47695
FJ386598.1 Hepatitis B virus isolate 1889, complete genome 458..................._47695
FJ386599.1 Hepatitis B virus isolate 1892, complete genome 458..................._47695
FJ386600.1 Hepatitis B virus isolate 1893, complete genome 458..................._47695
FJ386601.1 Hepatitis B virus isolate 1912, complete genome 458..................._47695
FJ386602.1 Hepatitis B virus isolate 1914, complete genome 458..................._47695
FJ386603.1 Hepatitis B virus isolate 1949, complete genome 458..................._47695
FJ386604.1 Hepatitis B virus isolate 1950, complete genome 458..................._47695
FJ386605.1 Hepatitis B virus isolate 1965, complete genome 458..................._47695
FJ386606.1 Hepatitis B virus isolate 1966, complete genome 458..................._47695
FJ386607.1 Hepatitis B virus isolate 1967, complete genome 458..................._47695
FJ386608.1 Hepatitis B virus isolate 1998, complete genome 458..................._47695
FJ386609.1 Hepatitis B virus isolate 1999, complete genome 458..................._47695
FJ386610.1 Hepatitis B virus isolate 2000, complete genome 458..................._47695
FJ386611.1 Hepatitis B virus isolate 2018, complete genome 458..................._47695
FJ386612.1 Hepatitis B virus isolate 2019, complete genome 458..................._47695
FJ386613.1 Hepatitis B virus isolate 2039, complete genome 458..................._47695
FJ386614.1 Hepatitis B virus isolate 2040, complete genome 458..................._47695
FJ386615.1 Hepatitis B virus isolate 2061, complete genome 458..................._47695
FJ386616.1 Hepatitis B virus isolate 2064, complete genome 458..................._47695
FJ386617.1 Hepatitis B virus isolate 2093, complete genome 458..................._47695
FJ386618.1 Hepatitis B virus isolate 2111, complete genome 458..................._47695
FJ386619.1 Hepatitis B virus isolate 2119, complete genome 458..................._47695
FJ386620.1 Hepatitis B virus isolate 2121, complete genome 458..................._47695
FJ386621.1 Hepatitis B virus isolate 2123, complete genome 458..................._47695
FJ386622.1 Hepatitis B virus isolate 2135, complete genome 458..................._47695
FJ386623.1 Hepatitis B virus isolate 2165, complete genome 458..................._47695
FJ386624.1 Hepatitis B virus isolate 2187, complete genome 458..................._47695
FJ386625.1 Hepatitis B virus isolate 2190, complete genome 458..................._47695
FJ386626.1 Hepatitis B virus isolate 2205, complete genome 458..................._47695
FJ386627.1 Hepatitis B virus isolate 2242, complete genome 458..................._47695
FJ386628.1 Hepatitis B virus isolate 2255, complete genome 458..................._47695
FJ386629.1 Hepatitis B virus isolate 2286, complete genome 434..................._45295
FJ386630.1 Hepatitis B virus isolate 2336, complete genome 458..................._47695
FJ386631.1 Hepatitis B virus isolate 2359, complete genome 458..................._47695
FJ386632.1 Hepatitis B virus isolate 2370, complete genome 458..................._47695
FJ386633.1 Hepatitis B virus isolate 2372, complete genome 458..................._47695
FJ386634.1 Hepatitis B virus isolate 2392, complete genome 458..................._47695
FJ386635.1 Hepatitis B virus isolate 2399, complete genome 458..................._47695
FJ386636.1 Hepatitis B virus isolate 1813, complete genome 458..................._47695
FJ386637.1 Hepatitis B virus isolate 2151, complete genome 458..................._47695
FJ386638.1 Hepatitis B virus isolate 2015, complete genome 458..................._47695
FJ386639.1 Hepatitis B virus isolate 1929, complete genome 458..................._47695
FJ386640.1 Hepatitis B virus isolate 2168, complete genome 425..................._44395
FJ386641.1 Hepatitis B virus isolate 2236, complete genome 422..................._44095
FJ386642.1 Hepatitis B virus isolate 1829, complete genome 458..................._47695
FJ386643.1 Hepatitis B virus isolate 2493, complete genome 404..................._42295
FJ386644.1 Hepatitis B virus isolate S737, complete genome 458..................._47695
FJ386645.1 Hepatitis B virus isolate S897, complete genome 431..................._44995
FJ386646.1 Hepatitis B virus isolate 1716, complete genome 458..................._47695
FJ386647.1 Hepatitis B virus isolate 2400, complete genome 458..................._47695
FJ386648.1 Hepatitis B virus isolate 2419, complete genome 458..................._47695
FJ386649.1 Hepatitis B virus isolate 2422, complete genome 458..................._47695
FJ386650.1 Hepatitis B virus isolate 2468, complete genome 458..................._47695
FJ386651.1 Hepatitis B virus isolate 2476, complete genome 458..................._47695
FJ386652.1 Hepatitis B virus isolate 2518, complete genome 458..................._47695
FJ386653.1 Hepatitis B virus isolate S3, complete genome 458..................._47695
FJ386654.1 Hepatitis B virus isolate S51, complete genome 458..................._47695
FJ386655.1 Hepatitis B virus isolate S121, complete genome 458..................._47695
FJ386656.1 Hepatitis B virus isolate S142, complete genome 458..................._47695
FJ386657.1 Hepatitis B virus isolate S165, complete genome 458..................._47695
FJ386658.1 Hepatitis B virus isolate S185, complete genome 458..................._47695
FJ386659.1 Hepatitis B virus isolate S219, complete genome 458..................._47695
FJ386660.1 Hepatitis B virus isolate S221, complete genome 458..................._47695
FJ386661.1 Hepatitis B virus isolate S251, complete genome 458..................._47695
FJ386662.1 Hepatitis B virus isolate S269, complete genome 458..................._47695
FJ386663.1 Hepatitis B virus isolate S307, complete genome 458..................._47695
FJ386664.1 Hepatitis B virus isolate S310, complete genome 458..................._47695
FJ386665.1 Hepatitis B virus isolate S359, complete genome 458..................._47695
FJ386666.1 Hepatitis B virus isolate S367, complete genome 458..................._47695
FJ386667.1 Hepatitis B virus isolate S379, complete genome 458..................._47695
FJ386668.1 Hepatitis B virus isolate S395, complete genome 458..................._47695
FJ386669.1 Hepatitis B virus isolate S411, complete genome 458..................._47695
FJ386670.1 Hepatitis B virus isolate S454, complete genome 458..................._47695
FJ386671.1 Hepatitis B virus isolate S586, complete genome 458..................._47695
FJ386672.1 Hepatitis B virus isolate S606, complete genome 458..................._47695
FJ386673.1 Hepatitis B virus isolate S633, complete genome 458..................._47695
FJ386674.1 Hepatitis B virus isolate S659, complete genome 458..................._47695
FJ386675.1 Hepatitis B virus isolate S734, complete genome 458..................._47695
FJ386677.1 Hepatitis B virus isolate S1104, complete genome 416..................._43495
FJ386678.1 Hepatitis B virus isolate S1147, complete genome 458..................._47695
FJ386679.1 Hepatitis B virus isolate S1217, complete genome 458..................._47695
FJ386680.1 Hepatitis B virus isolate S1244, complete genome 458..................._47695
FJ386681.1 Hepatitis B virus isolate S1336, complete genome 458..................._47695
FJ386682.1 Hepatitis B virus isolate S1416, complete genome 458..................._47695
FJ386683.1 Hepatitis B virus isolate S1450, complete genome 458..................._47695
FJ386684.1 Hepatitis B virus isolate S1554, complete genome 458..................._47695
FJ386685.1 Hepatitis B virus isolate S1568, complete genome 458..................._47695
FJ386686.1 Hepatitis B virus isolate S1572, complete genome 458..................._47695
FJ386687.1 Hepatitis B virus isolate S1600, complete genome 458..................._47695
FJ386688.1 Hepatitis B virus isolate S1632, complete genome 458..................._47695
FJ386689.1 Hepatitis B virus isolate S1649, complete genome 458..................._47695
EU835240.1 Hepatitis B virus isolate IND-DIB112, complete genome 458..................._47695
EU835241.1 Hepatitis B virus isolate IND-DIB24, complete genome 458..................._47695
EU835242.1 Hepatitis B virus isolate IND-DIB30, complete genome 458..................._47695
FJ518810.1 Hepatitis B virus strain 6898, complete genome 458..................._47695
FJ518811.1 Hepatitis B virus strain ZXJ, complete genome 453..................._47195
FJ518812.1 Hepatitis B virus strain 6923, complete genome 458..................._47695
FJ518813.1 Hepatitis B virus strain 6945, complete genome 458..................._47695
FM199974.1 Hepatitis B virus complete genome, strain 45021 458..................._47695
FM199976.1 Hepatitis B virus complete genome, strain 45082 458..................._47695
FM199977.1 Hepatitis B virus complete genome, strain 45088 458..................._47695
FM199978.1 Hepatitis B virus complete genome, strain 49136 458..................._47695
FM199979.1 Hepatitis B virus complete genome, strain 49224 458..................._47695
FM199980.1 Hepatitis B virus complete genome, strain 49244 458..................._47695
FJ361772.1 Hepatitis B virus 146/Thailand, complete genome 440..................._45895
FJ787436.1 Hepatitis B virus isolate S129-6, complete genome 458..................._47695
FJ787437.1 Hepatitis B virus isolate S129-9, complete genome 458..................._47695
FJ787438.1 Hepatitis B virus isolate S129-8, complete genome 458..................._47695
FJ787439.1 Hepatitis B virus isolate S157-4, complete genome 458..................._47695
FJ787440.1 Hepatitis B virus isolate S157-6, complete genome 458..................._47695
FJ787441.1 Hepatitis B virus isolate S157-9, complete genome 458..................._47695
FJ787442.1 Hepatitis B virus isolate S171-4, complete genome 458..................._47695
FJ787445.1 Hepatitis B virus isolate S425-2, complete genome 458..................._47695
FJ787446.1 Hepatitis B virus isolate S425-20, complete genome 458..................._47695
FJ787447.1 Hepatitis B virus isolate S461-2, complete genome 458..................._47695
FJ787448.1 Hepatitis B virus isolate S461-3, complete genome 458..................._47695
FJ787449.1 Hepatitis B virus isolate S567-3, complete genome 458..................._47695
FJ787450.1 Hepatitis B virus isolate S627-2, complete genome 458..................._47695
FJ787451.1 Hepatitis B virus isolate S627-3, complete genome 458..................._47695
FJ787452.1 Hepatitis B virus isolate S955-2, complete genome 458..................._47695
FJ787453.1 Hepatitis B virus isolate S1049-3, complete genome 458..................._47695
FJ787454.1 Hepatitis B virus isolate S1049-4, complete genome 458..................._47695
FJ787455.1 Hepatitis B virus isolate S1092-3, complete genome 458..................._47695
FJ787456.1 Hepatitis B virus isolate S1092-4, complete genome 458..................._47695
FJ787457.1 Hepatitis B virus isolate S1248-4, complete genome 458..................._47695
FJ787458.1 Hepatitis B virus isolate S1248-9, complete genome 458..................._47695
FJ787459.1 Hepatitis B virus isolate S1348-1, complete genome 458..................._47695
FJ787460.1 Hepatitis B virus isolate S1348-4, complete genome 458..................._47695
FJ787461.1 Hepatitis B virus isolate S1357-2, complete genome 458..................._47695
FJ787462.1 Hepatitis B virus isolate S1357-3, complete genome 458..................._47695
FJ787463.1 Hepatitis B virus isolate S1357-6, complete genome 458..................._47695
FJ787464.1 Hepatitis B virus isolate S1371-3, complete genome 458..................._47695
FJ787465.1 Hepatitis B virus isolate S1371-5, complete genome 458..................._47695
FJ787466.1 Hepatitis B virus isolate S1371-11, complete genome 458..................._47695
FJ787467.1 Hepatitis B virus isolate S1371-16, complete genome 458..................._47695
FJ787468.1 Hepatitis B virus isolate S1426-1, complete genome 458..................._47695
FJ787469.1 Hepatitis B virus isolate S1426-3, complete genome 458..................._47695
FJ787470.1 Hepatitis B virus isolate S1538-4, complete genome 458..................._47695
FJ787473.1 Hepatitis B virus isolate S1732-2, complete genome 458..................._47695
FJ787474.1 Hepatitis B virus isolate S1732-6, complete genome 458..................._47695
FJ787475.1 Hepatitis B virus isolate CX-2, complete genome 458..................._47695
FJ787476.1 Hepatitis B virus isolate CX-3, complete genome 458..................._47695
FJ787478.1 Hepatitis B virus isolate S65-2, complete genome 443..................._46195
FJ787480.1 Hepatitis B virus isolate S425-16, complete genome 458..................._47695
FJ787481.1 Hepatitis B virus isolate S852-2, complete genome 413..................._43195
FJ787482.1 Hepatitis B virus isolate S1158-7, complete genome 428..................._44695
FJ787485.1 Hepatitis B virus isolate S1656-8, complete genome 428..................._44695
FJ787486.1 Hepatitis B virus isolate S2235-2, complete genome 458..................._47695
FJ787487.1 Hepatitis B virus isolate DMY-1, complete genome 407..................._42595
FJ787488.1 Hepatitis B virus isolate DMY-5, complete genome 404..................._42295
FJ787490.1 Hepatitis B virus isolate LHZ-1, complete genome 431..................._44995
AB493827.1 Hepatitis B virus DNA, complete genome, isolate: 25UC 458..................._47695
AB493828.1 Hepatitis B virus DNA, complete genome, isolate: 33UC 458..................._47695
AB493829.1 Hepatitis B virus DNA, complete genome, isolate: P14 458..................._47695
AB493830.1 Hepatitis B virus DNA, complete genome, isolate: P41 460..................._47895
AB493831.1 Hepatitis B virus DNA, complete genome, isolate: P48 322..................._34095
AB493832.1 Hepatitis B virus DNA, complete genome, isolate: P19 458..................._47695
AB493833.1 Hepatitis B virus DNA, complete genome, isolate: P9 458..................._47695
AB493834.1 Hepatitis B virus DNA, complete genome, isolate: P18 458..................._47695
AB493835.1 Hepatitis B virus DNA, complete genome, isolate: P30 458..................._47695
AB493836.1 Hepatitis B virus DNA, complete genome, isolate: P57 458..................._47695
AB493837.1 Hepatitis B virus DNA, complete genome, isolate: 03UC 458..................._47695
AB493838.1 Hepatitis B virus DNA, complete genome, isolate: 06UC 458..................._47695
AB493839.1 Hepatitis B virus DNA, complete genome, isolate: 08UC 458..................._47695
AB493840.1 Hepatitis B virus DNA, complete genome, isolate: 16UC 458..................._47695
AB493841.1 Hepatitis B virus DNA, complete genome, isolate: 29UC 458..................._47695
AB493842.1 Hepatitis B virus DNA, complete genome, isolate: 31UC 458..................._47695
AB493843.1 Hepatitis B virus DNA, complete genome, isolate: 32UC 458..................._47695
AB493844.1 Hepatitis B virus DNA, complete genome, isolate: 43UC 458..................._47695
AB493846.1 Hepatitis B virus DNA, complete genome, isolate: 17UC 458..................._47695
AB493847.1 Hepatitis B virus DNA, complete genome, isolate: 05UC 458..................._47695
AB493848.1 Hepatitis B virus DNA, complete genome, isolate: P7 437..................._45595
FJ349296.1 Hepatitis B virus strain 29-OYE-10, complete genome 458..................._47695
GQ167301.1 Hepatitis B virus isolate ZADGM452, complete genome 458..................._47695
GQ167302.1 Hepatitis B virus isolate ZADGM4521, complete genome 458..................._47695
AB362931.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon458..................._47695
AB362932.1 Hepatitis B virus C gene for precore/core protein, complete cds, clon458..................._47695
AB362933.1 Hepatitis B virus C gene for core protein, complete cds, clone: B1_JP458..................._47695
GQ205440.1 Hepatitis B virus isolate Bc, complete genome 458..................._47695
GQ205441.1 Hepatitis B virus isolate Cc, complete genome 458..................._47695
AP011084.1 Hepatitis B virus DNA, complete genome, strain: B0503341(PTK)F 458..................._47695
AP011085.1 Hepatitis B virus DNA, complete genome, strain: B0612746(JKT)F 458..................._47695
AP011086.1 Hepatitis B virus DNA, complete genome, strain: B0503233(BJS)F 458..................._47695
AP011087.1 Hepatitis B virus DNA, complete genome, strain: B0607171(KDR)F 458..................._47695
AP011088.1 Hepatitis B virus DNA, complete genome, strain: B0503213(MKS)F 458..................._47695
AP011089.1 Hepatitis B virus DNA, complete genome, strain: B0607154(KDR)F 458..................._47695
AP011090.1 Hepatitis B virus DNA, complete genome, strain: B0714189(WBK)F 458..................._47695
AP011091.1 Hepatitis B virus DNA, complete genome, strain: B0714202(BMA)F 458..................._47695
AP011092.1 Hepatitis B virus DNA, complete genome, strain: B0715677(MMR)F 458..................._47695
AP011093.1 Hepatitis B virus DNA, complete genome, strain: B0308839(DPS)F 458..................._47695
AP011094.1 Hepatitis B virus DNA, complete genome, strain: B0503102(DIL)F 458..................._47695
AP011095.1 Hepatitis B virus DNA, complete genome, strain: B0503138(KPG)F 458..................._47695
AP011096.1 Hepatitis B virus DNA, complete genome, strain: B0714157(WBK)F 458..................._47695
AP011097.1 Hepatitis B virus DNA, complete genome, strain: C0503296(PTK)F 458..................._47695
AP011098.1 Hepatitis B virus DNA, complete genome, strain: C0714154(WBK)F 458..................._47695
AP011099.1 Hepatitis B virus DNA, complete genome, strain: C0503222(MND)F 458..................._47695
AP011100.1 Hepatitis B virus DNA, complete genome, strain: C0607174(THN)F 458..................._47695
AP011101.1 Hepatitis B virus DNA, complete genome, strain: C0715697(TNT)F 458..................._47695
AP011102.1 Hepatitis B virus DNA, complete genome, strain: C0610090(BIK)F 458..................._47695
AP011103.1 Hepatitis B virus DNA, complete genome, strain: C0610316(JYP)F 458..................._47695
AP011104.1 Hepatitis B virus DNA, complete genome, strain: C0309374(DPS)F 458..................._47695
AP011105.1 Hepatitis B virus DNA, complete genome, strain: C0309392(DPS)F 458..................._47695
AP011106.1 Hepatitis B virus DNA, complete genome, strain: C0503236(BJS)F 458..................._47695
AP011107.1 Hepatitis B virus DNA, complete genome, strain: C0503463(MTR)F 458..................._47695
AP011108.1 Hepatitis B virus DNA, complete genome, strain: C0503133(DIL)F 458..................._47695
GQ227692.1 Hepatitis B virus isolate Z3-1, complete genome 458..................._47695
GQ227693.1 Hepatitis B virus isolate Z31-1, complete genome 458..................._47695
GQ227694.1 Hepatitis B virus isolate Z31-2, complete genome 458..................._47695
GQ227695.1 Hepatitis B virus isolate Z31-5, complete genome 458..................._47695
GQ227696.1 Hepatitis B virus isolate Z31-6, complete genome 458..................._47695
GQ227697.1 Hepatitis B virus isolate Z3-2, complete genome 458..................._47695
GQ259588.1 Hepatitis B virus isolate Z31-22, complete genome 458..................._47695
GQ184322.1 Hepatitis B virus isolate ZADGM4522, complete genome 458..................._47695
GQ184323.1 Hepatitis B virus isolate ZADGM1121, complete genome 458..................._47695
GQ184324.1 Hepatitis B virus isolate ZADGM1122, complete genome 458..................._47695
GQ184325.1 Hepatitis B virus isolate ZADGM50, complete genome 438..................._45695
GQ184326.1 Hepatitis B virus isolate ZADGM501, complete genome 458..................._47695
FJ899761.1 Hepatitis B virus isolate C9-1, complete genome 458..................._47695
FJ899762.1 Hepatitis B virus isolate C9-3, complete genome 458..................._47695
FJ899763.1 Hepatitis B virus isolate C9-4, complete genome 458..................._47695
FJ899764.1 Hepatitis B virus isolate C9-12, complete genome 458..................._47695
FJ899765.1 Hepatitis B virus isolate C9-13, complete genome 458..................._47695
FJ899766.1 Hepatitis B virus isolate C25-2, complete genome 458..................._47695
FJ899767.1 Hepatitis B virus isolate C26-2, complete genome 458..................._47695
FJ899768.1 Hepatitis B virus isolate C56-7, complete genome 458..................._47695
FJ899769.1 Hepatitis B virus isolate C76-3, complete genome 458..................._47695
FJ899770.1 Hepatitis B virus isolate C76-4, complete genome 458..................._47695
FJ899771.1 Hepatitis B virus isolate C76-5, complete genome 458..................._47695
FJ899772.1 Hepatitis B virus isolate C113-3, complete genome 458..................._47695
FJ899773.1 Hepatitis B virus isolate C113-6, complete genome 458..................._47695
FJ899774.1 Hepatitis B virus isolate C120-5, complete genome 458..................._47695
FJ899775.1 Hepatitis B virus isolate C120-6, complete genome 458..................._47695
FJ899776.1 Hepatitis B virus isolate C122-7, complete genome 458..................._47695
FJ899777.1 Hepatitis B virus isolate C127-10, complete genome 458..................._47695
FJ899778.1 Hepatitis B virus isolate C173-1, complete genome 458..................._47695
FJ899779.1 Hepatitis B virus isolate C185-1, complete genome 458..................._47695
FJ899780.1 Hepatitis B virus isolate C185-2, complete genome 458..................._47695
FJ899781.1 Hepatitis B virus isolate C185-3, complete genome 458..................._47695
FJ899782.1 Hepatitis B virus isolate C185-6, complete genome 458..................._47695
FJ899783.1 Hepatitis B virus isolate C207-1, complete genome 458..................._47695
FJ899784.1 Hepatitis B virus isolate C215-3, complete genome 458..................._47695
FJ899785.1 Hepatitis B virus isolate C215-5, complete genome 458..................._47695
FJ899786.1 Hepatitis B virus isolate C215-7, complete genome 458..................._47695
FJ899787.1 Hepatitis B virus isolate C215-9, complete genome 458..................._47695
FJ899788.1 Hepatitis B virus isolate C226-1, complete genome 458..................._47695
FJ899789.1 Hepatitis B virus isolate C226-3, complete genome 458..................._47695
FJ899790.1 Hepatitis B virus isolate C232-2, complete genome 458..................._47695
FJ899791.1 Hepatitis B virus isolate C232-6, complete genome 458..................._47695
FJ899792.1 Hepatitis B virus isolate D146-1, complete genome 458..................._47695
FJ899793.1 Hepatitis B virus isolate C122-2, complete genome 403..................._42195
FJ899794.1 Hepatitis B virus isolate C122-3, complete genome 403..................._42195
FJ899795.1 Hepatitis B virus isolate C122-9, complete genome 403..................._42195
FJ899796.1 Hepatitis B virus isolate C76-1, complete genome 458..................._47695
AB486012.1 Hepatitis B virus DNA, complete genome, clone: JRB34 458..................._47695
GQ372968.1 Hepatitis B virus isolate 6380-3, complete genome 458..................._47695
AB485808.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IT 458..................._47695
AB485809.1 Hepatitis B virus DNA, complete genome, isolate: FEP1 446..................._46495
AB485810.1 Hepatitis B virus DNA, complete genome, isolate: FEP2 458..................._47695
GQ414522.1 Hepatitis B virus strain GTA_CT, complete genome 2306..................._232495
GQ377514.1 Hepatitis B virus isolate J8, complete genome 458..................._47695
GQ377515.1 Hepatitis B virus isolate J9, complete genome 458..................._47695
GQ377516.1 Hepatitis B virus isolate J10, complete genome 458..................._47695
GQ377517.1 Hepatitis B virus isolate J12, complete genome 458..................._47695
GQ377518.1 Hepatitis B virus isolate J14, complete genome 458..................._47695
GQ377519.1 Hepatitis B virus isolate J16, complete genome 458..................._47695
GQ377520.1 Hepatitis B virus isolate J18, complete genome 458..................._47695
GQ377521.1 Hepatitis B virus isolate J19, complete genome 458..................._47695
GQ377522.1 Hepatitis B virus isolate J20, complete genome 458..................._47695
GQ377523.1 Hepatitis B virus isolate J21, complete genome 458..................._47695
GQ377524.1 Hepatitis B virus isolate J23, complete genome 458..................._47695
GQ377525.1 Hepatitis B virus isolate J24, complete genome 458..................._47695
GQ377526.1 Hepatitis B virus isolate J27, complete genome 458..................._47695
GQ377527.1 Hepatitis B virus isolate J28, complete genome 458..................._47695
GQ377528.1 Hepatitis B virus isolate J29, complete genome 458..................._47695
GQ377529.1 Hepatitis B virus isolate J34, complete genome 458..................._47695
GQ377530.1 Hepatitis B virus isolate J35, complete genome 458..................._47695
GQ377531.1 Hepatitis B virus isolate J36, complete genome 458..................._47695
GQ377533.1 Hepatitis B virus isolate J39, complete genome 458..................._47695
GQ377534.1 Hepatitis B virus isolate J41, complete genome 458..................._47695
GQ377535.1 Hepatitis B virus isolate J45, complete genome 458..................._47695
GQ377536.1 Hepatitis B virus isolate J47, complete genome 458..................._47695
GQ377537.1 Hepatitis B virus isolate J48, complete genome 458..................._47695
GQ377538.1 Hepatitis B virus isolate J52, complete genome 458..................._47695
GQ377540.1 Hepatitis B virus isolate J57, complete genome 458..................._47695
GQ377541.1 Hepatitis B virus isolate J58, complete genome 458..................._47695
GQ377542.1 Hepatitis B virus isolate J61, complete genome 458..................._47695
GQ377543.1 Hepatitis B virus isolate J63, complete genome 458..................._47695
GQ377544.1 Hepatitis B virus isolate J69, complete genome 458..................._47695
GQ377545.1 Hepatitis B virus isolate J76, complete genome 458..................._47695
GQ377546.1 Hepatitis B virus isolate J77, complete genome 458..................._47695
GQ377547.1 Hepatitis B virus isolate J78, complete genome 458..................._47695
GQ377548.1 Hepatitis B virus isolate J79, complete genome 458..................._47695
GQ377549.1 Hepatitis B virus isolate J80, complete genome 458..................._47695
GQ377550.1 Hepatitis B virus isolate J81, complete genome 458..................._47695
GQ377551.1 Hepatitis B virus isolate J82, complete genome 458..................._47695
GQ377552.1 Hepatitis B virus isolate J83, complete genome 458..................._47695
GQ377553.1 Hepatitis B virus isolate J84, complete genome 458..................._47695
GQ377554.1 Hepatitis B virus isolate J85, complete genome 458..................._47695
GQ377555.1 Hepatitis B virus isolate J86, complete genome 458..................._47695
GQ377556.1 Hepatitis B virus isolate J87, complete genome 458..................._47695
GQ377557.1 Hepatitis B virus isolate J88, complete genome 458..................._47695
GQ377558.1 Hepatitis B virus isolate J89, complete genome 458..................._47695
GQ377559.1 Hepatitis B virus isolate J92, complete genome 458..................._47695
GQ377560.1 Hepatitis B virus isolate J93, complete genome 458..................._47695
GQ377561.1 Hepatitis B virus isolate J96, complete genome 458..................._47695
GQ377562.1 Hepatitis B virus isolate J97, complete genome 458..................._47695
GQ377563.1 Hepatitis B virus isolate J98, complete genome 458..................._47695
GQ377564.1 Hepatitis B virus isolate J99, complete genome 458..................._47695
GQ377565.1 Hepatitis B virus isolate J100, complete genome 458..................._47695
GQ377566.1 Hepatitis B virus isolate J101, complete genome 458..................._47695
GQ377567.1 Hepatitis B virus isolate J102, complete genome 458..................._47695
GQ377568.1 Hepatitis B virus isolate J103, complete genome 458..................._47695
GQ377569.1 Hepatitis B virus isolate J105, complete genome 458..................._47695
GQ377570.1 Hepatitis B virus isolate J110, complete genome 458..................._47695
GQ377571.1 Hepatitis B virus isolate J112, complete genome 458..................._47695
GQ377572.1 Hepatitis B virus isolate J113, complete genome 458..................._47695
GQ377573.1 Hepatitis B virus isolate J114, complete genome 458..................._47695
GQ377574.1 Hepatitis B virus isolate J115, complete genome 458..................._47695
GQ377575.1 Hepatitis B virus isolate J116, complete genome 458..................._47695
GQ377576.1 Hepatitis B virus isolate J117, complete genome 458..................._47695
GQ377577.1 Hepatitis B virus isolate J118, complete genome 458..................._47695
GQ377578.1 Hepatitis B virus isolate J125, complete genome 458..................._47695
GQ377579.1 Hepatitis B virus isolate J126, complete genome 458..................._47695
GQ377580.1 Hepatitis B virus isolate J127, complete genome 458..................._47695
GQ377581.1 Hepatitis B virus isolate J129, complete genome 458..................._47695
GQ377582.1 Hepatitis B virus isolate J131, complete genome 458..................._47695
GQ377583.1 Hepatitis B virus isolate J132, complete genome 458..................._47695
GQ377584.1 Hepatitis B virus isolate J133, complete genome 458..................._47695
GQ377585.1 Hepatitis B virus isolate J134, complete genome 458..................._47695
GQ377586.1 Hepatitis B virus isolate J135, complete genome 458..................._47695
GQ377587.1 Hepatitis B virus isolate J138, complete genome 458..................._47695
GQ377588.1 Hepatitis B virus isolate J141, complete genome 458..................._47695
GQ377589.1 Hepatitis B virus isolate J145, complete genome 458..................._47695
GQ377590.1 Hepatitis B virus isolate J147, complete genome 458..................._47695
GQ377591.1 Hepatitis B virus isolate J148, complete genome 458..................._47695
GQ377592.1 Hepatitis B virus isolate J149, complete genome 458..................._47695
GQ377593.1 Hepatitis B virus isolate J150, complete genome 458..................._47695
GQ377594.1 Hepatitis B virus isolate J152, complete genome 458..................._47695
GQ377595.1 Hepatitis B virus isolate J155, complete genome 458..................._47695
GQ377596.1 Hepatitis B virus isolate J156, complete genome 458..................._47695
GQ377597.1 Hepatitis B virus isolate J157, complete genome 458..................._47695
GQ377598.1 Hepatitis B virus isolate J158, complete genome 458..................._47695
GQ377599.1 Hepatitis B virus isolate J160, complete genome 458..................._47695
GQ377600.1 Hepatitis B virus isolate J161, complete genome 458..................._47695
GQ377601.1 Hepatitis B virus isolate J164, complete genome 458..................._47695
GQ377602.1 Hepatitis B virus isolate J165, complete genome 458..................._47695
GQ377603.1 Hepatitis B virus isolate J166, complete genome 458..................._47695
GQ377604.1 Hepatitis B virus isolate J168, complete genome 458..................._47695
GQ377605.1 Hepatitis B virus isolate J169, complete genome 458..................._47695
GQ377606.1 Hepatitis B virus isolate J171, complete genome 458..................._47695
GQ377607.1 Hepatitis B virus isolate J172, complete genome 458..................._47695
GQ377608.1 Hepatitis B virus isolate J174, complete genome 458..................._47695
GQ377609.1 Hepatitis B virus isolate J176, complete genome 458..................._47695
GQ377610.1 Hepatitis B virus isolate J177, complete genome 458..................._47695
GQ377611.1 Hepatitis B virus isolate J179, complete genome 458..................._47695
GQ377612.1 Hepatitis B virus isolate J180, complete genome 458..................._47695
GQ377613.1 Hepatitis B virus isolate J181, complete genome 458..................._47695
GQ377614.1 Hepatitis B virus isolate J185, complete genome 458..................._47695
GQ377615.1 Hepatitis B virus isolate J186, complete genome 458..................._47695
GQ377616.1 Hepatitis B virus isolate J192, complete genome 458..................._47695
GQ377617.1 Hepatitis B virus isolate J193, complete genome 458..................._47695
GQ377618.1 Hepatitis B virus isolate J194, complete genome 458..................._47695
GQ377619.1 Hepatitis B virus isolate J195, complete genome 458..................._47695
GQ377620.1 Hepatitis B virus isolate J197, complete genome 458..................._47695
GQ377621.1 Hepatitis B virus isolate J206, complete genome 458..................._47695
GQ377622.1 Hepatitis B virus isolate J207, complete genome 458..................._47695
GQ377623.1 Hepatitis B virus isolate J208, complete genome 458..................._47695
GQ377624.1 Hepatitis B virus isolate J221, complete genome 458..................._47695
GQ377625.1 Hepatitis B virus isolate J222, complete genome 458..................._47695
GQ377626.1 Hepatitis B virus isolate J225, complete genome 458..................._47695
GQ377627.1 Hepatitis B virus isolate J231, complete genome 458..................._47695
GQ377629.1 Hepatitis B virus isolate J234, complete genome 458..................._47695
GQ377630.1 Hepatitis B virus isolate J236, complete genome 458..................._47695
GQ377631.1 Hepatitis B virus isolate J239, complete genome 458..................._47695
GQ377632.1 Hepatitis B virus isolate J240, complete genome 458..................._47695
GQ377633.1 Hepatitis B virus isolate J241, complete genome 458..................._47695
GQ377634.1 Hepatitis B virus isolate J242, complete genome 458..................._47695
GQ377635.1 Hepatitis B virus isolate J245, complete genome 458..................._47695
GQ377636.1 Hepatitis B virus isolate J248, complete genome 458..................._47695
GQ377637.1 Hepatitis B virus isolate J249, complete genome 458..................._47695
GQ377638.1 Hepatitis B virus isolate J250, complete genome 458..................._47695
GQ377639.1 Hepatitis B virus isolate J251, complete genome 458..................._47695
GQ377640.1 Hepatitis B virus isolate J253, complete genome 458..................._47695
GQ377641.1 Hepatitis B virus isolate J254, complete genome 458..................._47695
GQ377642.1 Hepatitis B virus isolate J256, complete genome 458..................._47695
GQ377643.1 Hepatitis B virus isolate J258, complete genome 458..................._47695
GQ377644.1 Hepatitis B virus isolate J294, complete genome 458..................._47695
GQ872210.1 Hepatitis B virus, complete genome 458..................._47695
GQ872211.1 Hepatitis B virus, complete genome 458..................._47695
GQ475305.1 Hepatitis B virus isolate KOR1CHB, complete genome 458..................._47695
GQ475306.1 Hepatitis B virus isolate KOR2CHB, complete genome 458..................._47695
GQ475307.1 Hepatitis B virus isolate KOR3CHB, complete genome 458..................._47695
GQ475308.1 Hepatitis B virus isolate KOR4CHB, complete genome 458..................._47695
GQ475309.1 Hepatitis B virus isolate KOR5CHB, complete genome 458..................._47695
GQ475310.1 Hepatitis B virus isolate KOR6CHB, complete genome 458..................._47695
GQ475311.1 Hepatitis B virus isolate KOR7CHB, complete genome 458..................._47695
GQ475312.1 Hepatitis B virus isolate KOR8CHB, complete genome 458..................._47695
GQ475313.1 Hepatitis B virus isolate KOR9CHB, complete genome 458..................._47695
GQ475314.1 Hepatitis B virus isolate KOR10CHB, complete genome 458..................._47695
GQ475315.1 Hepatitis B virus isolate KOR11CHB, complete genome 458..................._47695
GQ475316.1 Hepatitis B virus isolate KOR12CHB, complete genome 458..................._47695
GQ475317.1 Hepatitis B virus isolate KOR13CHB, complete genome 458..................._47695
GQ475318.1 Hepatitis B virus isolate KOR14CHB, complete genome 458..................._47695
GQ475319.1 Hepatitis B virus isolate KOR15CHB, complete genome 458..................._47695
GQ475320.1 Hepatitis B virus isolate KOR16CHB, complete genome 458..................._47695
GQ475321.1 Hepatitis B virus isolate KOR17CHB, complete genome 458..................._47695
GQ475322.1 Hepatitis B virus isolate KOR18LC, complete genome 458..................._47695
GQ475323.1 Hepatitis B virus isolate KOR19LC, complete genome 458..................._47695
GQ475324.1 Hepatitis B virus isolate KOR20LC, complete genome 458..................._47695
GQ475325.1 Hepatitis B virus isolate KOR21LC, complete genome 452..................._47095
GQ475326.1 Hepatitis B virus isolate KOR22LC, complete genome 410..................._42895
GQ475327.1 Hepatitis B virus isolate KOR23LC, complete genome 458..................._47695
GQ475328.1 Hepatitis B virus isolate KOR24LC, complete genome 458..................._47695
GQ475329.1 Hepatitis B virus isolate KOR25LC, complete genome 458..................._47695
GQ475331.1 Hepatitis B virus isolate KOR27LC, complete genome 458..................._47695
GQ475332.1 Hepatitis B virus isolate KOR28LC, complete genome 458..................._47695
GQ475333.1 Hepatitis B virus isolate KOR29LC, complete genome 404..................._42295
GQ475334.1 Hepatitis B virus isolate KOR30LC, complete genome 458..................._47695
GQ475335.1 Hepatitis B virus isolate KOR31LC, complete genome 431..................._44995
GQ475336.1 Hepatitis B virus isolate KOR32LC, complete genome 458..................._47695
GQ475337.1 Hepatitis B virus isolate KOR33LC, complete genome 458..................._47695
GQ475338.1 Hepatitis B virus isolate KOR34LC, complete genome 458..................._47695
GQ475339.1 Hepatitis B virus isolate KOR35HCC, complete genome 458..................._47695
GQ475340.1 Hepatitis B virus isolate KOR36HCC, complete genome 458..................._47695
GQ475341.1 Hepatitis B virus isolate KOR37HCC, complete genome 458..................._47695
GQ475342.1 Hepatitis B virus isolate KOR38HCC, complete genome 458..................._47695
GQ475343.1 Hepatitis B virus isolate KOR39HCC, complete genome 425..................._44395
GQ475344.1 Hepatitis B virus isolate KOR40HCC, complete genome 458..................._47695
GQ475345.1 Hepatitis B virus isolate KOR41HCC, complete genome 458..................._47695
GQ475346.1 Hepatitis B virus isolate KOR42HCC, complete genome 458..................._47695
GQ475347.1 Hepatitis B virus isolate KOR43HCC, complete genome 458..................._47695
GQ475348.1 Hepatitis B virus isolate KOR44HCC, complete genome 458..................._47695
GQ475349.1 Hepatitis B virus isolate KOR45HCC, complete genome 458..................._47695
GQ475350.1 Hepatitis B virus isolate KOR46HCC, complete genome 458..................._47695
GQ475351.1 Hepatitis B virus isolate KOR47HCC, complete genome 458..................._47695
GQ475352.1 Hepatitis B virus isolate KOR48HCC, complete genome 425..................._44395
GQ475353.1 Hepatitis B virus isolate KOR49HCC, complete genome 458..................._47695
GQ475354.1 Hepatitis B virus isolate KOR50HCC, complete genome 458..................._47695
GQ475355.1 Hepatitis B virus isolate KOR51HCC, complete genome 458..................._47695
GQ475356.1 Hepatitis B virus isolate KOR52HCC, complete genome 458..................._47695
GQ475357.1 Hepatitis B virus isolate KOR53HCC, complete genome 458..................._47695
FJ798095.1 Hepatitis B virus isolate ggcam19, complete genome 458..................._47695
FJ798096.1 Hepatitis B virus isolate ggcam7, complete genome 458..................._47695
FJ798097.1 Hepatitis B virus isolate ggcam22, complete genome 458..................._47695
FJ798098.1 Hepatitis B virus isolate cpzcam17, complete genome 458..................._47695
FJ798099.1 Hepatitis B virus isolate cpzcam6, complete genome 458..................._47695
AB471848.1 Hepatitis B virus DNA, complete genome, isolate: F1S-F 458..................._47695
AB471849.1 Hepatitis B virus DNA, complete genome, isolate: F1S-C2 458..................._47695
AB471850.1 Hepatitis B virus DNA, complete genome, isolate: F1S-C1 458..................._47695
AB471851.1 Hepatitis B virus DNA, complete genome, isolate: F2NK-F 458..................._47695
AB471852.1 Hepatitis B virus DNA, complete genome, isolate: F2S-C2 458..................._47695
AB471853.1 Hepatitis B virus DNA, complete genome, isolate: F2S-C3 458..................._47695
AB471854.1 Hepatitis B virus DNA, complete genome, isolate: F5M-F 458..................._47695
AB471855.1 Hepatitis B virus DNA, complete genome, isolate: F5M-C 458..................._47695
AB471856.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C1 458..................._47695
AB471857.1 Hepatitis B virus DNA, complete genome, isolate: F3O-C2 458..................._47695
FJ657519.1 Hepatitis B virus isolate BA110, complete genome 458..................._47695
FJ657522.1 Hepatitis B virus isolate BA116, complete genome 458..................._47695
FJ657525.1 Hepatitis B virus isolate BA107, complete genome 458..................._47695
FJ657528.1 Hepatitis B virus isolate BA108, complete genome 458..................._47695
FJ657529.1 Hepatitis B virus isolate BA109, complete genome 458..................._47695
AF043560.2 Hepatitis B virus isolate BA2, complete genome 458..................._47695
AF043580.2 Hepatitis B virus isolate BA3, complete genome 458..................._47695
FN594748.1 Hepatitis B virus complete genome, isolate bne6 458..................._47695
FN594750.1 Hepatitis B virus complete genome, isolate bne12 458..................._47695
FN594752.1 Hepatitis B virus complete genome, isolate bne134 458..................._47695
FN594753.1 Hepatitis B virus complete genome, isolate bne137 443..................._46195
FN594754.1 Hepatitis B virus complete genome, isolate bne200 458..................._47695
FN594755.1 Hepatitis B virus complete genome, isolate bne241 458..................._47695
FN594756.1 Hepatitis B virus complete genome, isolate bne250 458..................._47695
FN594757.1 Hepatitis B virus complete genome, isolate bne305 443..................._46195
FN594758.1 Hepatitis B virus complete genome, isolate bne341 458..................._47695
FN594759.1 Hepatitis B virus complete genome, isolate bne342 458..................._47695
FN594761.1 Hepatitis B virus complete genome, isolate bne385 458..................._47695
FN594762.1 Hepatitis B virus complete genome, isolate bne439 458..................._47695
FN594763.1 Hepatitis B virus complete genome, isolate bne446 458..................._47695
FN594764.1 Hepatitis B virus complete genome, isolate bne9439 458..................._47695
FN594767.1 Hepatitis B virus complete genome, isolate bne127 458..................._47695
FN594768.1 Hepatitis B virus complete genome, isolate bne272 458..................._47695
FN594769.1 Hepatitis B virus complete genome, isolate bne281 458..................._47695
FN594770.1 Hepatitis B virus complete genome, isolate bne367 458..................._47695
GU357842.1 Hepatitis B virus isolate C4371, complete genome 458..................._47695
GU357843.1 Hepatitis B virus isolate Y580, complete genome 458..................._47695
GU357844.1 Hepatitis B virus isolate W29, complete genome 458..................._47695
GU357845.1 Hepatitis B virus isolate Y1021, complete genome 458..................._47695
DQ776247.2 Hepatitis B virus isolate BA54, complete genome 458..................._47695
EU366116.2 Hepatitis B virus isolate BA61, complete genome 458..................._47695
EU366118.2 Hepatitis B virus isolate BA67, complete genome 458..................._47695
EU366132.2 Hepatitis B virus isolate BA95, complete genome 458..................._47695
EU366133.2 Hepatitis B virus isolate BA96, complete genome 458..................._47695
GU385774.1 Hepatitis B virus isolate C2-Shanghai, complete genome 458..................._47695
GU721029.1 Hepatitis B virus isolate CMCL107, complete genome 458..................._47695
GU451682.1 Hepatitis B virus isolate pLL-EGFP, complete genome 458..................._47695
GU565217.1 Hepatitis B virus strain CLB-DonX, complete genome 458..................._47695
AB549213.1 Hepatitis B virus DNA, complete genome, clone: G-C-F 458..................._47695
FN545821.1 Hepatitis B virus complete genome, strain 29122 458..................._47695
FN545822.1 Hepatitis B virus complete genome, strain 29134 458..................._47695
FN545823.1 Hepatitis B virus complete genome, strain 29135 458..................._47695
FN545824.1 Hepatitis B virus complete genome, strain 29136 404..................._42295
FN545826.1 Hepatitis B virus complete genome, strain 34010 458..................._47695
FN545827.1 Hepatitis B virus complete genome, strain 34011 446..................._46495
FN545828.1 Hepatitis B virus complete genome, strain 34015 458..................._47695
FN545829.1 Hepatitis B virus complete genome, strain 34028 458..................._47695
FN545830.1 Hepatitis B virus complete genome, strain 34033 458..................._47695
FN545831.1 Hepatitis B virus complete genome, strain 42002 458..................._47695
FN545832.1 Hepatitis B virus complete genome, strain 42048 458..................._47695
FN545833.1 Hepatitis B virus complete genome, strain 42063 458..................._47695
FN545834.1 Hepatitis B virus complete genome, strain 42064 458..................._47695
FN545835.1 Hepatitis B virus complete genome, strain 42096 458..................._47695
FN545836.1 Hepatitis B virus complete genome, strain 42128 458..................._47695
FN545837.1 Hepatitis B virus complete genome, strain 42145 449..................._46795
FN545838.1 Hepatitis B virus complete genome, strain 42202 458..................._47695
FN545839.1 Hepatitis B virus complete genome, strain 42266 404..................._42295
FN545840.1 Hepatitis B virus complete genome, strain 42339 446..................._46495
FN545841.1 Hepatitis B virus complete genome, strain 42349 458..................._47695
FN545842.1 Hepatitis B virus complete genome, strain 42366 458..................._47695
AB555496.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA31 458..................._47695
AB555497.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA37 458..................._47695
AB555498.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA41 458..................._47695
AB555499.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA62 458..................._47695
AB555500.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA64 458..................._47695
AB555501.1 Hepatitis B virus DNA, complete genome, isolate: HBV-TA65 458..................._47695
AB540582.1 HBV genotype B DNA, complete genome, strain: B0901189(NT15) 458..................._47695
AB540583.1 HBV genotype C DNA, complete genome, strain: C0901177(NT3) 458..................._47695
AB540584.1 HBV genotype C DNA, complete genome, strain: C0901190(NT16) 458..................._47695
AB540585.1 HBV genotype C DNA, complete genome, strain: C0901192(NT18) 458..................._47695
HM153811.1 Hepatitis B virus, complete genome 458..................._47695
HM146131.1 Hepatitis B virus isolate TCGA5889, complete genome 332..................._35095
AB480036.2 Hepatitis B virus DNA, complete genome, strain: 06-17 458..................._47695
AB480038.2 Hepatitis B virus DNA, complete genome, strain: 06-23 458..................._47695
AB480039.2 Hepatitis B virus DNA, complete genome, strain: 06-27 458..................._47695
AB480040.2 Hepatitis B virus DNA, complete genome, strain: 06-44 458..................._47695
AB480041.2 Hepatitis B virus DNA, complete genome, strain: 06-51 458..................._47695
FR714490.1 Hepatitis B virus complete genome, isolate DL706, X/C recombinant 458..................._47695
FR714491.1 Hepatitis B virus complete genome, isolate GM012, X/C recombinant 458..................._47695
FR714492.1 Hepatitis B virus complete genome, isolate GY235, X/C recombinant 458..................._47695
FR714493.1 Hepatitis B virus complete genome, isolate NA167, X/C recombinant 458..................._47695
FR714494.1 Hepatitis B virus complete genome, isolate NS052, X/C recombinant 458..................._47695
FR714495.1 Hepatitis B virus complete genome, isolate QB062, X/C recombinant 458..................._47695
FR714496.1 Hepatitis B virus complete genome, isolate QL523, X/C recombinant 458..................._47695
FR714497.1 Hepatitis B virus complete genome, isolate QP046, X/C recombinant 458..................._47695
FR714498.1 Hepatitis B virus complete genome, isolate QQB36, X/C recombinant 458..................._47695
FR714499.1 Hepatitis B virus complete genome, isolate TF051, X/C recombinant 458..................._47695
FR714500.1 Hepatitis B virus complete genome, isolate TX164, X/C recombinant 458..................._47695
FR714501.1 Hepatitis B virus complete genome, isolate TX327, X/C recombinant 458..................._47695
FR714502.1 Hepatitis B virus complete genome, isolate TZ087, X/C recombinant 458..................._47695
FR714503.1 Hepatitis B virus complete genome, isolate TZ306, X/C recombinant 458..................._47695
FR714504.1 Hepatitis B virus complete genome, isolate WL339, X/C recombinant 458..................._47695
FR714505.1 Hepatitis B virus complete genome, isolate XW233, X/C recombinant 458..................._47695
FR714506.1 Hepatitis B virus complete genome, isolate YL204, X/C recombinant 458..................._47695
AB560661.1 HBV genotype C DNA, complete genome, isolate: 58PU 458..................._47695
AB560662.1 HBV genotype C DNA, complete genome, isolate: 60PU 458..................._47695
HM622135.1 Hepatitis B virus isolate HCUCH5, complete genome 458..................._47695
HM627320.1 Hepatitis B virus isolate HCUCH21, complete genome 458..................._47695
GU177079.1 Hepatitis B virus isolate DN171, complete genome 458..................._47695
HQ378247.1 Hepatitis B virus isolate IRL-2009, complete genome 458..................._47695
AB554014.1 HBV genotype C DNA, complete genome, isolate: TRF08029 458..................._47695
AB554015.1 HBV genotype C DNA, complete genome, isolate: TRF08111 458..................._47695
AB554016.1 HBV genotype D DNA, complete genome, isolate: TRF08226 458..................._47695
AB554017.1 HBV genotype B DNA, complete genome, isolate: NMB09010 458..................._47695
AB554018.1 HBV genotype C DNA, complete genome, isolate: NMB09075 458..................._47695
AB554019.1 HBV genotype C DNA, complete genome, isolate: NMB09122 458..................._47695
AB554020.1 HBV genotype C DNA, complete genome, isolate: NMB09124 458..................._47695
AB554021.1 HBV genotype C DNA, complete genome, isolate: GRS08298 458..................._47695
AB554022.1 HBV genotype C DNA, complete genome, isolate: GRS08325 458..................._47695
AB554023.1 HBV genotype D DNA, complete genome, isolate: GRS08457 458..................._47695
AB554024.1 HBV genotype D DNA, complete genome, isolate: GRS08538 458..................._47695
AB554025.1 HBV genotype C DNA, complete genome, isolate: MRK89073 458..................._47695
HQ684848.1 Hepatitis B virus isolate HBVJSTZ1, complete genome 458..................._47695
HQ684849.1 Hepatitis B virus isolate HBVJSTZ2, complete genome 458..................._47695
AB562462.1 Hepatitis B virus DNA, complete genome, isolate: HPA184_07 458..................._47695
AB562463.1 Hepatitis B virus DNA, complete genome, isolate: HPC017_07 458..................._47695
HQ236014.1 Hepatitis B virus isolate RS1, complete genome 458..................._47695
HQ236015.1 Hepatitis B virus isolate RS2, complete genome 458..................._47695
HQ236016.1 Hepatitis B virus isolate RS3, complete genome 458..................._47695
JF412801.1 Hepatitis B virus isolate HBVJSTZ3, complete genome 458..................._47695
AB583679.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8134 458..................._47695
AB583680.1 Hepatitis B virus DNA, complete genome, isolate: Pkst7912 458..................._47695
AB583681.1 Hepatitis B virus DNA, complete genome, isolate: Pkst8216 458..................._47695
HQ231877.1 Hepatitis B virus isolate B3-1, complete genome 458..................._47695
HQ231878.1 Hepatitis B virus isolate B3-2, complete genome 458..................._47695
HQ231879.1 Hepatitis B virus isolate B3-4, complete genome 458..................._47695
HQ231880.1 Hepatitis B virus isolate B3-5, complete genome 458..................._47695
HQ231881.1 Hepatitis B virus isolate B3-6, complete genome 458..................._47695
HQ231882.1 Hepatitis B virus isolate B3-7, complete genome 458..................._47695
HQ231883.1 Hepatitis B virus isolate B3-8, complete genome 458..................._47695
HQ231884.1 Hepatitis B virus isolate B3-9, complete genome 458..................._47695
HQ231885.1 Hepatitis B virus isolate B3-10, complete genome 458..................._47695
JF440017.1 Hepatitis B virus isolate FOL496, complete genome 1830..................._184895
JF491447.1 Hepatitis B virus isolate QH-13, complete genome 458..................._47695
JF491448.1 Hepatitis B virus isolate QH-29, complete genome 458..................._47695
JF491449.1 Hepatitis B virus isolate QH-32, complete genome 458..................._47695
JF491450.1 Hepatitis B virus isolate QH-33, complete genome 458..................._47695
JF491451.1 Hepatitis B virus isolate QH-35, complete genome 458..................._47695
JF491452.1 Hepatitis B virus isolate QH-53, complete genome 458..................._47695
JF491453.1 Hepatitis B virus isolate QH-90, complete genome 458..................._47695
JF491454.1 Hepatitis B virus isolate QH-79, complete genome 458..................._47695
JF491455.1 Hepatitis B virus isolate Tibet-31, complete genome 458..................._47695
JF491456.1 Hepatitis B virus isolate Tibet-53, complete genome 458..................._47695
AB602818.1 HBV genotype B DNA, complete genome, isolate: AH-2 458..................._47695
X04615.1 Hepatitis B virus genome, subtype ayr 458..................._47695
AY738140.1 Hepatitis B virus clone A2, complete genome 459_.................._47690
AY738142.1 Hepatitis B virus clone A4, complete genome 459_.................._47690
AM180624.1 Hepatitis B virus complete genome, isolate CAE168 458..........y........_47690
DQ478885.1 Hepatitis B virus isolate CHN-D12, complete genome 459_.................._47690
EU547560.1 Hepatitis B virus isolate MC03, complete genome 458...........m......._47690
EU414140.1 Hepatitis B virus strain 28050, complete genome 458..............y...._47690
EU594425.1 Hepatitis B virus strain 4635-97, complete genome 458..............y...._47690
EU939658.1 Hepatitis B virus isolate D142, complete genome 459_.................._47690
FM199981.1 Hepatitis B virus complete genome, strain 49263 458.....r............._47690
GQ377532.1 Hepatitis B virus isolate J37, complete genome 458..............k...._47690
GQ377539.1 Hepatitis B virus isolate J53, complete genome 458.....r............._47690
FN594749.1 Hepatitis B virus complete genome, isolate bne8 458..................__47590
X65258.1 Hepatitis B virus (ayw,patient CI) genes PreS1, PreS2, PreC, C, X and460..........a........_47890
X72702.1 Hepatitis B Virus DNA sequence for 4 open reading frames 458..............g...._47690
Z35716.1 Human hepatitis B virus (ayw4) genes for surface protein S, core prot460..............c...._47890
X80925.1 Hepatitis B virus (patient 6) complete genome 460..............c...._47890
X97849.1 Hepatitis B virus (patient 3) complete genome 460..............c...._47890
D50521.1 Hepatitis B virus clone HBV-ASA-FH1 genomic DNA, complete sequence 458.........g........._47690
D50522.1 Hepatitis B virus clone HBV-ASA-FH2 genomic DNA, complete sequence 458.........g........._47690
AF043593.1 Hepatitis B virus isolate 6/89, complete genome 446..............c...._46490
AF043594.1 Hepatitis B virus isolate 1/91, complete genome 458..............c...._47690
AF046996.1 Woolly monkey hepatitis B Virus, complete genome 460..............g...._47890
AJ131571.1 Hepatitis B virus complete genome, isolate gib645 1827..............g...._184590
AJ131956.1 Hepatitis B virus complete genome, serotype ayw3 460.....a............._47890
AF143305.1 Hepatitis B virus clone RM501, complete genome 1734..............c...._175290
AB031267.1 Hepatitis B virus genomic DNA, complete sequence, isolate:HBV VietF-6458........t.........._47690
AF223960.1 Hepatitis B virus strain C-1858 isolate ea7, complete genome 458..............g...._47690
AB059659.1 Hepatitis B virus DNA, complete genome, clone:US10 458..............g...._47690
AB059660.1 Hepatitis B virus DNA, complete genome, clone:US1778 458..............g...._47690
AB059661.1 Hepatitis B virus DNA, complete genome, clone:US2065 458..............g...._47690
AB064315.1 Hepatitis B virus DNA, complete genome, clone:US1122 449..............g...._46790
AB073831.1 Hepatitis B virus DNA, complete genome, isolate:HBV-TH61 458.....a............._47690
AB073850.1 Hepatitis B virus DNA, complete genome, isolate:HBV-Na102 458..g................_47690
AY090452.1 Hepatitis B virus strain Z29, complete genome 461..............c...._47990
AY090454.1 Hepatitis B virus strain 1853Nic, complete genome 461..............g...._47990
AY090457.1 Hepatitis B virus strain 2928Nic, complete genome 461..............g...._47990
AY090458.1 Hepatitis B virus strain 70H, complete genome 461..............c...._47990
AY090460.1 Hepatitis B virus strain LAS2523, complete genome 461..............g...._47990
AF418674.1 Hepatitis B virus patient 1185 clone 1, complete genome 460...........t......._47890
AF418675.1 Hepatitis B virus patient 1185 clone 2, complete genome 460...........t......._47890
AF418679.1 Hepatitis B virus patient 821 clone 1, complete genome 460.........t........._47890
AF418680.1 Hepatitis B virus patient 821 clone 2, complete genome 460.........t........._47890
AF418681.1 Hepatitis B virus patient 821 clone 3, complete genome 460.........t........._47890
AY161138.1 Hepatitis B virus clone S1.1 complete genome 461..........t........_47990
AY161140.1 Hepatitis B virus clone S2.1 complete genome 458...........t......._47690
AY161141.1 Hepatitis B virus clone S2.2 complete genome 458...........t......._47690
AY161161.1 Hepatitis B virus clone S9.1 complete genome 458.........t........._47690
AY161162.1 Hepatitis B virus clone S9.2 complete genome 458.........t........._47690
AY161163.1 Hepatitis B virus clone S9.3 complete genome 458.........t........._47690
AY217368.1 Hepatitis B virus isolate 21949, complete genome 458.c................._47690
AY226578.1 Woolly monkey hepatitis B virus clone WMHBV-2, complete genome 460..............g...._47890
AY233282.1 Hepatitis B virus isolate 306 complete genome 458.....a............._47690
AY233291.1 Hepatitis B virus isolate 179 complete genome 458..............g...._47690
AY233293.1 Hepatitis B virus isolate 12 complete genome 458..............g...._47690
AY233295.1 Hepatitis B virus isolate 8 complete genome 458..............g...._47690
AY330917.1 Hepatitis B virus isolate Crazywoman complete genome 458..............c...._47690
AY341335.1 Hepatitis B virus isolation-source agammaglobulinaemic patient pre-co456..............c...._47490
AB112065.1 Hepatitis B virus DNA, complete genome, isolate:HBV-VT140 458.......g..........._47690
AY741796.1 Hepatitis B virus isolate IR-IPI-P3, complete genome 460.................g._47890
AY796031.1 Hepatitis B virus isolate RA1.10, complete genome 460..............c...._47890
AY738139.1 Hepatitis B virus clone A1, complete genome 458.........g........._47690
AY738143.1 Hepatitis B virus clone A11, complete genome 458.........g........._47690
AB188242.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA38 458..............c...._47690
AB179747.1 Hepatitis B virus (genotype H) genomic DNA, complete genome, isolate:458..............g...._47690
AB205122.1 Hepatitis B virus DNA, complete genome, isolate: HBV-VH69-1 458........t.........._47690
AB205128.1 Hepatitis B virus DNA, complete genome, isolate: HBV-RU316-1 458..............c...._47690
AP007261.1 HBV genotype H DNA, complete genome, isolate: HB-JI260F 458..............g...._47690
AB205190.1 Hepatitis B virus DNA, complete genome, isolate: HBV-G123 458.....a............._47690
AB205010.1 Hepatitis B virus DNA, complete genome, isolate: HBV-IM806-2 458..............g...._47690
DQ298162.1 Hepatitis B virus isolate LT3.12AM clone 2, complete genome 1859...........t......._187790
DQ377158.1 Hepatitis B virus isolate WJT31, complete genome 458..............c...._47690
AJ627215.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 06115 458..............g...._47690
AJ627216.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 17707 458..............g...._47690
AJ627218.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 21116 458..............g...._47690
AJ627220.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 29234 458..............c...._47690
AJ627222.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 31228 458..............c...._47690
AJ627223.1 Hepatitis B virus P gene, S gene, X gene and C gene, isolate 33720 458..............c...._47690
AB210820.1 Hepatitis B virus DNA, complete genome, strain:Tokyo 1 458..............c...._47690
DQ995801.1 Hepatitis B virus isolate H60-6, complete genome 458.................c._47690
EF157291.1 Hepatitis B virus isolate B3586-YKH94, complete genome 458..............g...._47690
AB275308.1 Hepatitis B virus DNA, complete genome, genotype: H 458..............g...._47690
AB270540.1 Hepatitis B virus DNA, complete genome, isolate: MGL241F 437..............g...._45590
EF103275.1 Hepatitis B virus isolate Ran11, complete genome 458..............g...._47690
EF103285.1 Hepatitis B virus isolate Ran128, complete genome 458...........t......._47690
AB266536.1 Hepatitis B virus DNA, complete genome, isolate: HB-JAIW05 458..............g...._47690
AB298362.1 HBV genotype H DNA, complete genome, isolate: HBV ST0404 458..............g...._47690
AB274980.1 Hepatitis B virus s gene for S protein, complete cds, strain:AB90 458.....a............._47690
DQ993694.1 Hepatitis B virus isolate patient 234, complete genome 458..........t........_47690
EF494378.1 Hepatitis B virus isolate TW1244 genotype C, complete genome 458..............c...._47690
AB300371.1 Hepatitis B virus DNA, complete genome, isolate: patient13 458........a.........._47690
EU239221.1 Hepatitis B virus isolate PW1, complete genome 458..........g........_47690
AB330367.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ14H458.................c._47690
AB330369.1 Hepatitis B virus X gene for X protein, complete cds, isolate: TAJ5HB458..............c...._47690
EU185786.1 Hepatitis B virus isolate S-IDU11, complete genome 458.....t............._47690
EU185787.1 Hepatitis B virus isolate S-IDU4, complete genome 458.....t............._47690
EU185788.1 Hepatitis B virus isolate S-IDU19, complete genome 458.....t............._47690
EU185789.1 Hepatitis B virus isolate S-IDU8, complete genome 458.....t............._47690
AM494692.1 Hepatitis B virus complete genome, isolate CAR026 458..............c...._47690
EU306677.1 Hepatitis B virus clone 220-14, complete genome 458..............c...._47690
EU306695.1 Hepatitis B virus clone 712-64, complete genome 458..............c...._47690
EU306696.1 Hepatitis B virus clone 712-47, complete genome 458..............c...._47690
EU306697.1 Hepatitis B virus clone 712-99, complete genome 458..............c...._47690
EU306698.1 Hepatitis B virus clone 712-105, complete genome 458..............c...._47690
EU306719.1 Hepatitis B virus clone 602(son)-23, complete genome 458.........t........._47690
AB353764.1 Hepatitis B virus DNA, complete genome, isolate: HBDI03 458..............g...._47690
EU439023.1 Hepatitis B virus clone dzc-22 from China, complete genome 458......c............_47690
EU589340.1 Hepatitis B virus isolate S852-7, complete genome 413.....a............._43190
EU414138.1 Hepatitis B virus strain 28129, complete genome 458..............c...._47690
EU414139.1 Hepatitis B virus strain 28027, complete genome 458..............c...._47690
AB375159.1 Hepatitis B virus DNA, complete genome, strain: MEX8-H 458..............g...._47690
AB375160.1 Hepatitis B virus DNA, complete genome, strain: MEXICO30-H 458..............g...._47690
AB375161.1 Hepatitis B virus DNA, complete genome, strain: MEXICO32 458..............g...._47690
AB375162.1 Hepatitis B virus DNA, complete genome, strain: MEXICO33-H 458..............g...._47690
AB375163.1 Hepatitis B virus DNA, complete genome, strain: MEXICO34-H 458..............g...._47690
AB375164.1 Hepatitis B virus DNA, complete genome, strain: MEXICO35-H 458..............g...._47690
EU594398.1 Hepatitis B virus strain 4496-97, complete genome 458..............c...._47690
EU594399.1 Hepatitis B virus strain 4484-97, complete genome 458..............c...._47690
EU594400.1 Hepatitis B virus strain 2009-02, complete genome 458..............c...._47690
EU594401.1 Hepatitis B virus strain 1989-97, complete genome 458..............c...._47690
EU594402.1 Hepatitis B virus strain 1988-02, complete genome 458..............c...._47690
EU594403.1 Hepatitis B virus strain 1904-99, complete genome 458..............c...._47690
EU594404.1 Hepatitis B virus strain 1901-98, complete genome 458..............c...._47690
EU594405.1 Hepatitis B virus strain 620-98, complete genome 458..............c...._47690
EU594406.1 Hepatitis B virus strain 321-96, complete genome 458..............c...._47690
EU594407.1 Hepatitis B virus strain 295-01, complete genome 458..............c...._47690
EU594408.1 Hepatitis B virus strain 281-01, complete genome 458..............c...._47690
EU594409.1 Hepatitis B virus strain 280-01, complete genome 458..............c...._47690
EU594410.1 Hepatitis B virus strain 279-01, complete genome 458..............c...._47690
EU594415.1 Hepatitis B virus strain 4374-97, complete genome 458..............c...._47690
EU594416.1 Hepatitis B virus strain 4373-97, complete genome 458..............c...._47690
EU594421.1 Hepatitis B virus strain 4658-97, complete genome 458..............c...._47690
EU594422.1 Hepatitis B virus strain 4655-97, complete genome 458..............c...._47690
EU594423.1 Hepatitis B virus strain 4652-97, complete genome 458..............c...._47690
EU594424.1 Hepatitis B virus strain 4651-97, complete genome 458..............c...._47690
EU594426.1 Hepatitis B virus strain 4630-97, complete genome 458..............c...._47690
EU594427.1 Hepatitis B virus strain 4628-97, complete genome 458..............c...._47690
EU594428.1 Hepatitis B virus strain 4385-97, complete genome 458..............c...._47690
EU594430.1 Hepatitis B virus strain 4565-97, complete genome 458..............c...._47690
EU594431.1 Hepatitis B virus strain 4547-97, complete genome 458..............c...._47690
EU594432.1 Hepatitis B virus strain 4545-97, complete genome 458..............c...._47690
EU594433.1 Hepatitis B virus strain 4605-97, complete genome 458..............c...._47690
EU939680.1 Hepatitis B virus isolate C186, complete genome 458..............g...._47690
FJ032358.1 Hepatitis B virus isolate S1607-10 from China, complete genome 458.......g..........._47690
FJ386676.1 Hepatitis B virus isolate S1055, complete genome 458........t.........._47690
FJ787443.1 Hepatitis B virus isolate S171-5, complete genome 458..c................_47690
FJ787444.1 Hepatitis B virus isolate S208-1, complete genome 458......c............_47690
FJ787471.1 Hepatitis B virus isolate S1538-6, complete genome 458.............c....._47690
FJ787472.1 Hepatitis B virus isolate S1732-1, complete genome 458..............g...._47690
FJ787477.1 Hepatitis B virus isolate LWM-1, complete genome 458..........t........_47690
FJ787479.1 Hepatitis B virus isolate S157-7, complete genome 458.............c....._47690
FJ787483.1 Hepatitis B virus isolate S1158-8, complete genome 428..c................_44690
FJ787484.1 Hepatitis B virus isolate S1348-3, complete genome 458......c............_47690
FJ787489.1 Hepatitis B virus isolate DMY-6, complete genome 404...g..............._42290
AB493845.1 Hepatitis B virus DNA, complete genome, isolate: 07UC 438.................c._45690
GQ377628.1 Hepatitis B virus isolate J232, complete genome 458.....a............._47690
GQ475330.1 Hepatitis B virus isolate KOR26LC, complete genome 458..............c...._47690
FN594760.1 Hepatitis B virus complete genome, isolate bne362 458..a................_47690
FN594766.1 Hepatitis B virus complete genome, isolate bne9449 458.....c............._47690
FN594771.1 Hepatitis B virus complete genome, isolate bne442 458.................c._47690
GU357846.1 Hepatitis B virus isolate Y10, complete genome 458.....c............._47690
FN545825.1 Hepatitis B virus complete genome, strain 29137 458..............c...._47690
HM066946.2 Hepatitis B virus isolate MX-HBV-0114, complete genome 458..............g...._47690
HM117850.2 Hepatitis B virus isolate MX-HBV-0153, complete genome 458..............g...._47690
HM117851.2 Hepatitis B virus isolate MX-HBV-0201, complete genome 458..............g...._47690
AB516393.1 HBV genotype H DNA, complete genome, isolate: 904MEXM 458..............g...._47690
AB516394.1 HBV genotype H DNA, complete genome, isolate: MEX912M 455..............g...._47390
AB516395.1 HBV genotype H DNA, complete genome, isolate: MEX914M 458..............g...._47690
AY738141.1 Hepatitis B virus clone A3, complete genome 460__................._47685
M38454.1HPBADR1CG Hepatitis B virus , complete genome 2279.........t.t......._229785
AB188241.1 Hepatitis B virus DNA, complete genome, isolate:KAMCHATKA25 458..............c.a.._47685
DQ304547.1 Hepatitis B virus isolate LT4 clone 1, complete genome 1820........ag........._183885
FN594765.1 Hepatitis B virus complete genome, isolate bne9447 458.............cc...._47685
FN594751.1 Hepatitis B virus complete genome, isolate bne52H 458..........g..ag...._47680