../../tmp/servers/virsirnadb/1693356391
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi21431ggtcgaaacgtatgttctctc21
NC_007367.1 Influenza A virus (A/New York/392/2004(H3N2)) segment 7, complete seq43.....................63100
NC_004907.1 Influenza A virus (A/Hong Kong/1073/99(H9N2)) segment 7, complete seq50............c........7095
NC_007377.1 Influenza A virus (A/Korea/426/68(H2N2)) segment 7, complete sequence43............c........6395
NC_007363.1 Influenza A virus (A/Goose/Guangdong/1/96(H5N1)) strain A/Goose/Guang43............c........6395
V01099.1 Influenza A virus (A/PR/8/1934(H1N1)) ORF1 and ORF2, genomic RNA 43............c........6395
NC_004906.1 Influenza A virus (A/Hong Kong/1073/99(H9N2)) segment 8, complete seq701____________.........69342