../../tmp/servers/virsirnadb/666453446
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi18731gtaagacctccctttacaacctaag25
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 97117......................c..9714196
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 11747_____..t.........._______1175948
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 57735______.........g...______5772348
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 45347___..t.........t.gg..____4536456
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 113505.........ga.g..t.._______11352256
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 14908______.........._________1489940
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 17981______.........._________1797240
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 21054______.........._________2104540
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 24127______.........._________2411840
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 27200______.........._________2719140
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 30273______.........._________3026440
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 33346______.........._________3333740
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 73965__.........._____________7397440
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 46461_.........a.gc.gg.c..c.__4644060
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 106539__.c.t.........__________10655144
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 106940_________..aa.........___10695244
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 12516___........._____________1250836
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 15589___........._____________1558136
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 18662___........._____________1865436
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 21735___........._____________2172736
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 24808___........._____________2480036
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 27881___........._____________2787336
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 30954___........._____________3094636
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 34027___........._____________3401936
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 57264_____.........___________5725636
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 64302__.........______________6429436
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 87296_........._______________8730436
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 108672.........________________10866436
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 111874______.........__________11186636
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 112115____.........____________11210736
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 125130___........._____________12512236
NC_009334.1 Human herpesvirus 4, complete genome 98029......................c..9805396
NC_009334.1 Human herpesvirus 4, complete genome 44058_____.........c...t..c.__4404160
NC_009334.1 Human herpesvirus 4, complete genome 11697_____..t.........._______1170948
NC_009334.1 Human herpesvirus 4, complete genome 57865______.........g...______5785348
NC_009334.1 Human herpesvirus 4, complete genome 45527___..t.........t.gg..____4554456
NC_009334.1 Human herpesvirus 4, complete genome 114416.........ga.g..t.._______11443356
NC_009334.1 Human herpesvirus 4, complete genome 14855______.........._________1484640
NC_009334.1 Human herpesvirus 4, complete genome 17925______.........._________1791640
NC_009334.1 Human herpesvirus 4, complete genome 20995______.........._________2098640
NC_009334.1 Human herpesvirus 4, complete genome 24065______.........._________2405640
NC_009334.1 Human herpesvirus 4, complete genome 27135______.........._________2712640
NC_009334.1 Human herpesvirus 4, complete genome 30205______.........._________3019640
NC_009334.1 Human herpesvirus 4, complete genome 33275______.........._________3326640
NC_009334.1 Human herpesvirus 4, complete genome 74081__.........._____________7409040
NC_009334.1 Human herpesvirus 4, complete genome 88029_..........______________8803840
NC_009334.1 Human herpesvirus 4, complete genome 134906____________..........___13491540
NC_009334.1 Human herpesvirus 4, complete genome 145903______.........c.t.g.c.g.14592156
NC_009334.1 Human herpesvirus 4, complete genome 46642_.........a.gc.gg.c..c.__4662160
NC_009334.1 Human herpesvirus 4, complete genome 107450__.c.t.........__________10746244
NC_009334.1 Human herpesvirus 4, complete genome 107851_________..aa.........___10786344
NC_009334.1 Human herpesvirus 4, complete genome 12466___........._____________1245836
NC_009334.1 Human herpesvirus 4, complete genome 15536___........._____________1552836
NC_009334.1 Human herpesvirus 4, complete genome 18606___........._____________1859836
NC_009334.1 Human herpesvirus 4, complete genome 21676___........._____________2166836
NC_009334.1 Human herpesvirus 4, complete genome 24746___........._____________2473836
NC_009334.1 Human herpesvirus 4, complete genome 27816___........._____________2780836
NC_009334.1 Human herpesvirus 4, complete genome 30886___........._____________3087836
NC_009334.1 Human herpesvirus 4, complete genome 33956___........._____________3394836
NC_009334.1 Human herpesvirus 4, complete genome 57445_____.........___________5743736
NC_009334.1 Human herpesvirus 4, complete genome 64419__.........______________6441136
NC_009334.1 Human herpesvirus 4, complete genome 112785______.........__________11277736
NC_009334.1 Human herpesvirus 4, complete genome 113026____.........____________11301836
NC_009334.1 Human herpesvirus 4, complete genome 126038___........._____________12603036
NC_009334.1 Human herpesvirus 4, complete genome 129685______________.........__12967736
NC_009334.1 Human herpesvirus 4, complete genome 130889_____________.........___13088136