../../tmp/servers/virsirnadb/1791623837
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi19261gtctgggctcatattgttatt21
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 18499.....................18519100
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 14932___............t.____1494561
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 15094_________..........g.1510552
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 1541_________.........___153342
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 4361____________.........436942
AF272001.1 Zaire Ebola virus strain Mayinga, complete genome 9798___________........._980642
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 18500.....................18520100
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 14933___............t.____1494661
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 15095_________..........g.1510652
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 1541_________.........___153342
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 4361____________.........436942
AF499101.1 Zaire Ebola virus strain Mayinga, complete genome 9798___________........._980642
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 18499.....................18519100
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 14932___............t.____1494561
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 15094_________..........g.1510552
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 1541_________.........___153342
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 4361____________.........436942
AY142960.1 Zaire Ebola virus strain Mayinga subtype Zaire, complete genome 9798___________........._980642
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 18500.....................18520100
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 14933___............t.____1494661
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 15095_________..........g.1510652
AY354458.1 Zaire ebolavirus strain Zaire 1995, complete genome 9799___________........._980742
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 18499.....................18519100
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 14932___............t.____1494561
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 15094_________..........g.1510552
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 1541_________.........___153342
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 4361____________.........436942
EU224440.2 Zaire ebolavirus strain Mayinga, complete genome 9798___________........._980642
NC_002549.1 Zaire ebolavirus, complete genome 18499.....................18519100
NC_002549.1 Zaire ebolavirus, complete genome 14932___............t.____1494561
NC_002549.1 Zaire ebolavirus, complete genome 15094_________..........g.1510552
NC_002549.1 Zaire ebolavirus, complete genome 1541_________.........___153342
NC_002549.1 Zaire ebolavirus, complete genome 4361____________.........436942
NC_002549.1 Zaire ebolavirus, complete genome 9798___________........._980642
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 14888__.............c..___1490371
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 15557__.a...........______1556957
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 18248_________.........c..1823752
EU338380.1 Sudan ebolavirus isolate EBOV-S-2004 from Sudan, complete genome 1529_________.........___152142
NC_006432.1 Sudan ebolavirus, complete genome 14888__............cc..___1490366
NC_006432.1 Sudan ebolavirus, complete genome 18248_________.........t..1823752
NC_006432.1 Sudan ebolavirus, complete genome 11421_.t........._________1141147
NC_006432.1 Sudan ebolavirus, complete genome 1529_________.........___152142
NC_006432.1 Sudan ebolavirus, complete genome 2483___........._________247542
AB050936.1 Reston ebolavirus - Reston genomic RNA, complete genome 14993_____..t.........____1498252
AB050936.1 Reston ebolavirus - Reston genomic RNA, complete genome 8218________.........a.a.820652
AB050936.1 Reston ebolavirus - Reston genomic RNA, complete genome 1533_________.........___152542
AY769362.1 Reston ebolavirus strain Pennsylvania, complete genome 14995_____..t.........____1498452
AY769362.1 Reston ebolavirus strain Pennsylvania, complete genome 8220________.........a.a.820852
AY769362.1 Reston ebolavirus strain Pennsylvania, complete genome 1535_________.........___152742
NC_004161.1 Reston ebolavirus, complete genome 14995_____..t.........____1498452
NC_004161.1 Reston ebolavirus, complete genome 8220________.........a.a.820852
NC_004161.1 Reston ebolavirus, complete genome 1535_________.........___152742
NC_014372.1 Cote d'Ivoire ebolavirus 17673____.a.........._____1768452
NC_014372.1 Cote d'Ivoire ebolavirus 16828___________..........1681947
NC_014372.1 Cote d'Ivoire ebolavirus 9821____________.........981342
NC_014373.1 Bundibugyo ebolavirus, complete genome 17436__________.g.........1744647
NC_014373.1 Bundibugyo ebolavirus, complete genome 9826_________.........___983442
NC_014373.1 Bundibugyo ebolavirus, complete genome 14761____________.........1475342