../../tmp/servers/virsirnadb/34728671
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi19181gtgtgggttgaggtatgaacacg23
GQ994935.1 Human herpesvirus 8 clone 219BAC, complete genome 123052.......................123074100
NC_009333.1 Human herpesvirus 8, complete genome 122857.......................122879100
NC_009334.1 Human herpesvirus 4, complete genome 35434_....a..g.........g..g.3541378
U43400.1HHU43400 Human herpesvirus-7 (HHV7) JI, complete virion genome 5005..t.........t.t....____498769
U43400.1HHU43400 Human herpesvirus-7 (HHV7) JI, complete virion genome 144052..t.........t.t....____14403469
NC_001716.2 Human herpesvirus 7, complete genome 8956..t.........t.t....____893869
NC_001716.2 Human herpesvirus 7, complete genome 152002..t.........t.t....____15198469
NC_007605.1 Human herpesvirus 4 type 1, complete genome 35466_...aa..g.........g..g.3544573
NC_007605.1 Human herpesvirus 4 type 1, complete genome 36939...........a.._________3692656
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 35508_...aa..g.........g..g.3548773
AY961628.3 Human herpesvirus 4 strain GD1, complete genome 36879...........a.._________3686656
NC_006273.2 Human herpesvirus 5, complete genome 169881____....g.t.........___16986660
NC_006273.2 Human herpesvirus 5, complete genome 193101_.........c...ga.._____19311760
AB097932.1 Human herpesvirus 3 DNA, complete genome, strain: Oka, sub_strain: vO20995............a._________2100856
AB097933.1 Human herpesvirus 3 DNA, complete genome, strain: Oka, sub_strain: pO20962............a._________2097556
AY548171.1 Human herpesvirus 3 strain BC, complete genome 20996............a._________2100956
AY548170.1 Human herpesvirus 3 strain MSP, complete genome 21039............a._________2105256
DQ008354.1 Human herpesvirus 3 strain VarilRix, complete genome 20995............a._________2100856
DQ008355.1 Human herpesvirus 3 strain VariVax, complete genome 20995............a._________2100856
AJ871403.1 Human herpesvirus 3 (HHV-3), complete genome, isolate HJ0 20964............a._________2097756
DQ452050.1 Human herpesvirus 3 isolate HHV3_M2DR, complete genome 20999............a._________2101256
DQ457052.1 Human herpesvirus 3 strain CA123, complete genome 20970............a._________2098356
DQ479953.1 Human herpesvirus 3 strain SD, complete genome 20996............a._________2100956
DQ479954.1 Human herpesvirus 3 strain Kel, complete genome 21059............a._________2107256
DQ479955.1 Human herpesvirus 3 strain 11, complete genome 20963............a._________2097656
DQ479956.1 Human herpesvirus 3 strain 22, complete genome 20891............a._________2090456
DQ479957.1 Human herpesvirus 3 strain 03-500, complete genome 20921............a._________2093456
DQ479958.1 Human herpesvirus 3 strain 36, complete genome 21059............a._________2107256
DQ479959.1 Human herpesvirus 3 strain 49, complete genome 21143............a._________2115656
DQ479960.1 Human herpesvirus 3 strain 8, complete genome 21290............a._________2130356
DQ479961.1 Human herpesvirus 3 strain 32 passage 5, complete genome 20981............a._________2099456
DQ479962.1 Human herpesvirus 3 strain 32 passage 22, complete genome 21029............a._________2104256
DQ479963.1 Human herpesvirus 3 strain 32 passage 72, complete genome 21028............a._________2104156
DQ674250.1 Human herpesvirus 3 strain NH29_3, complete genome 20995............a._________2100856
EU154348.1 Human herpesvirus 3 strain SVETA, complete genome 20979............a._________2099256
NC_001348.1 Human herpesvirus 3, complete genome 21041............a._________2105456
HQ380895.1 Human herpesvirus 5 strain JHC, complete genome 192884_.........c...ga.._____19290060