../../tmp/servers/virsirnadb/1749384375
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi16811tcaggatttatttaacataga21
S58435.1 nucleocapsid protein...large protein [measles virus, AIK-C, Genomic R9506.....................9526100
K01711.1MEANPCG Measles virus (strain Edmonston), complete genome 9506.....................9526100
Z66517.1 Measles virus (strain Edmonston B) RNA (infectious cDNA clone) 9506.....................9526100
E04903.1 DNA coding measles vaccine peptide 9506.....................9526100
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir9506.....................9526100
AB012948.1 Measles virus genomic RNA, complete sequence of wild-type strain, vir15145............_________1513457
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str9506.....................9526100
AB012949.1 Measles virus genomic RNA, complete sequence of Vero cell-adapted str15145............_________1513457
AB032167.1 Measles virus genomic RNA, complete sequence of Ichinose-Vero strain,9506.....................9526100
AF266286.1 Measles virus strain Edmonston (AIK-C vaccine), complete genome 9506.....................9526100
AF266287.1 Measles virus strain Edmonston (Moraten vaccine), complete genome 9506.....................9526100
AF266289.1 Measles virus strain Edmonston (Rubeovax vaccine), complete genome 9506.....................9526100
AF266290.1 Measles virus strain Edmonston (Zagreb vaccine), complete genome 9506.....................9526100
AF266291.1 Measles virus strain Edmonston (Schwarz vaccine), complete genome 9506.....................9526100
AB046218.1 Measles virus genomic RNA, complete sequence 9506.....................9526100
BD137590.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
BD137591.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
BD137592.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
BD137593.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
BD137594.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
BD137595.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
BD137596.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
BD137597.1 Mutation causing attenuation of measles virus or human respiratory sy9506.....................9526100
AY486083.1 Measles virus strain Edmonston-Zagreb master seed, complete genome 9506.....................9526100
AY486084.1 Measles virus strain Edmonston-Zagreb working seed, complete genome 9506.....................9526100
AY730614.1 Measles virus strain Leningrad-4, complete genome 9506.....................9526100
DQ211902.1 Measles virus strain MVi/Zhejiang.CHN/7.05/4, complete genome 9506.....................9526100
DQ227321.1 Measles virus isolate WA.USA/17.98, complete genome 9506.....................9526100
DQ227320.1 Measles virus isolate MVs/Zagreb.CRO/08.03/_SSPE, complete genome 9506.....................9526100
DQ227319.1 Measles virus isolate 97-45881, complete genome 9506.....................9526100
DQ227318.1 Measles virus isolate MVs/Zagreb.CRO/47.02/[D6]_SSPE, complete genome9506.....................9526100
DQ345721.1 Measles virus strain CAM-70, complete genome 9506.....................9526100
DQ345722.1 Measles virus strain CAM-70, complete genome 9506.....................9526100
DQ345723.1 Measles virus strain CAM-70, complete genome 9506.....................9526100
AB254456.1 Measles virus genomic RNA, complete genome, strain: SSPE-Kobe-1 9506.....................9526100
EF033071.1 Measles virus strain Changchun-47, complete genome 9506.....................9526100
EU293548.1 Measles virus isolate D-V/S, complete genome 9506.....................9526100
EU293549.1 Measles virus isolate D-CEF, complete genome 9506.....................9526100
EU293550.1 Measles virus isolate Davis87, complete genome 9506.....................9526100
EU293551.1 Measles virus isolate D-VI, complete genome 9506.....................9526100
EU293552.1 Measles virus isolate D-VII, complete genome 9506.....................9526100
AB481087.1 Measles virus genomic RNA, complete genome, strain: T11wild 9506.....................9526100
AB481088.1 Measles virus genomic RNA, complete genome, strain: T11Ve-23 9506.....................9526100
AF266288.2 Measles virus strain Edmonston, complete genome 9506.....................9526100
NC_001498.1 Measles virus, complete genome 9506.....................9526100
EU435017.1 Measles virus strain Shanghai-191, complete genome 9506....a................952695