VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 12954218 are 5
Results from 0 - 25

siRNA sequence "ggucgaaacgccuaucagaaa" alignment with "Human Metapneumovirus" virus reference Genome sequences
siRNA sequence matching with "ggucgaaacgccuaucagaaa" Human Metapneumovirus" Virus reference Genome sequences
Browse all the records for "Human Metapneumovirus" virus
Browse "virsi2147 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_004148
Transfection Reagent: TransIT-LT1

Offtargets for "ggucgaaacgccuaucagaaa" siRNA in Human Genome sequences
See NC_004148 at Genbank
Pubmed:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218

siRNA sequence "ggucgaaacguauguucucuc" alignment with "Influenza A Virus" virus reference Genome sequences
siRNA sequence matching with "ggucgaaacguauguucucuc" Influenza A Virus" Virus reference Genome sequences
Browse all the records for "Influenza A Virus" virus
Browse "virsi2143 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_002016
Transfection Reagent: TransIT-LT1

Offtargets for "ggucgaaacguauguucucuc" siRNA in Human Genome sequences
See NC_002016 at Genbank
Pubmed:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218

siRNA sequence "aauuugcaggccuaucagaaa" alignment with "Influenza A Virus" virus reference Genome sequences
siRNA sequence matching with "aauuugcaggccuaucagaaa" Influenza A Virus" Virus reference Genome sequences
Browse all the records for "Influenza A Virus" virus
Browse "virsi2144 " record
Length: 21
GC Content:38 %
GenBank Acc: NC_002016
Transfection Reagent: TransIT-LT1

Offtargets for "aauuugcaggccuaucagaaa" siRNA in Human Genome sequences
See NC_002016 at Genbank
Pubmed:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218

siRNA sequence "aacaaacaaacagcgaugaa" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "aacaaacaaacagcgaugaa" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi2145 " record
Length: 20
GC Content:35 %
GenBank Acc: NC_001563
Transfection Reagent: TransIT-LT1

Offtargets for "aacaaacaaacagcgaugaa" siRNA in Human Genome sequences
See NC_001563 at Genbank
Pubmed:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218

siRNA sequence "cagagccauuugguucaugug" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "cagagccauuugguucaugug" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi2146 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_001563
Transfection Reagent: TransIT-LT1

Offtargets for "cagagccauuugguucaugug" siRNA in Human Genome sequences
See NC_001563 at Genbank
Pubmed:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2147	ggucgaaacgccuaucagaaa	Human Metapneumovirus	M	293T	Protein	Medium	12954218	Blast SL	refseqs
virsi2143	ggucgaaacguauguucucuc	Influenza A Virus	M	293T	Protein	High	12954218	Blast SL	refseqs
virsi2144	aauuugcaggccuaucagaaa	Influenza A Virus	M	293T	Protein	High	12954218	Blast SL	refseqs
virsi2145	aacaaacaaacagcgaugaa	West Nile Virus [WNV]	CAP	293T	Protein	Medium	12954218	Blast SL	refseqs
virsi2146	cagagccauuugguucaugug	West Nile Virus [WNV]	NS5	293T	Protein	High	12954218	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm