Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 17300745 are 4
Results from 0 - 25
VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1016 | aagaucucaaucucgggaauc | Hepatitis B Virus [HBV] | refseqs |       | ||||||
virsi1017 | cagguccccuagaagaagaac | Hepatitis B Virus [HBV] | refseqs |       | ||||||
virsi1018 | aacacuuccggaaacuacugu | Hepatitis B Virus [HBV] | refseqs |       | ||||||
virsi1019 | gaucucaaucucgggaaccucaa | Hepatitis B Virus [HBV] | refseqs |       |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm