VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Hepadnaviridae are 227
Results from 50 - 75

« previous12345678910next »
siRNA sequence "cgcccaccgaauguugccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgcccaccgaauguugccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1671 " record
Length: 19
GC Content:68 %
Starting position: 1627
Strain of Virus: adw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000

Offtargets for "cgcccaccgaauguugccc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16353167
Article:Knock-down of hepatitis B virus X protein reduces the tumorigenicity of hepatocellular carcinoma cells.
Authors:Chan DW, Ng IO.
Journal:J Pathol. 2006 Feb;208(3):372-80.
Entrez:16353167

siRNA sequence "uucgcaguccccaaccucc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uucgcaguccccaaccucc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1136 " record
Length: 19
GC Content:63 %
Starting position: 310
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE 6 Cationic Liposome
Incubation Time (Hours):72

Offtargets for "uucgcaguccccaaccucc" siRNA in Human Genome sequences
See AF286594 at Genbank
Pubmed:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775

siRNA sequence "aaugucaacgaccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaugucaacgaccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1148 " record
Length: 21
GC Content:48 %
Starting position: 1681
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aaugucaacgaccgaccuuga" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "aagaccuagucaguuaug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaccuagucaguuaug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1161 " record
Length: 18
GC Content:39 %
Starting position: 2149
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aagaccuagucaguuaug" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:12951075
Article:Selective inhibition of hepatitis B virus replication by RNA interference.
Authors:Ying C, De Clercq E, Neyts J.
Journal:Biochem Biophys Res Commun. 2003 Sep 19;309(2):482-4. Erratum in: Biochem Biophys Res Commun. 2005 Nov 4;336(4):1300.
Entrez:12951075

siRNA sequence "aacauggagaacaucacauca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacauggagaacaucacauca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1027 " record
Length: 21
GC Content:38 %
Starting position: 1028
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aacauggagaacaucacauca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aaccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1149 " record
Length: 21
GC Content:48 %
Starting position: 324
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "aaccuccaaucacucaccaac" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967

siRNA sequence "gguauguugcccguuugucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuugucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1458 " record
Length: 20
GC Content:50 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gguauguugcccguuugucu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350

siRNA sequence "gacuacugccucacccaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gacuacugccucacccaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1459 " record
Length: 19
GC Content:53 %
Starting position: 99
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gacuacugccucacccaua" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1023 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934

siRNA sequence "ugucaacgaccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ugucaacgaccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1039 " record
Length: 19
GC Content:53 %
Starting position: 1683
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ugucaacgaccgaccuuga" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17596868
Article:Targeted inhibition of HBV gene expression by single-chain antibody mediated small interfering RNA delivery.
Authors:Wen WH, Liu JY, Qin WJ, Zhao J, Wang T, Jia LT, Meng YL, Gao H, Xue CF, Jin BQ, Yao LB, Chen SY, Yang AG.
Journal:Hepatology. 2007 Jul;46(1):84-94.
Entrez:17596868

siRNA sequence "aaggucuuacauaagaggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaggucuuacauaagaggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1146 " record
Length: 21
GC Content:38 %
Starting position: 1646
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aaggucuuacauaagaggacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "gaauccucacaauaccgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaauccucacaauaccgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1006 " record
Length: 19
GC Content:47 %
Starting position: 225
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gaauccucacaauaccgca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18378325
Article:Inhibition of hepatitis B virus gene expression and replication by endoribonuclease-prepared siRNA.
Authors:Meng Z, Xu Y, Wu J, Tian Y, Kemper T, Bleekmann B, Roggendorf M, Yang D, Lu M.
Journal:J Virol Methods. 2008 Jun;150(1-2):27-33. Epub 2008 Apr 18.
Entrez:18378325

siRNA sequence "aagaauccucacaauaccgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaauccucacaauaccgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1143 " record
Length: 21
GC Content:43 %
Starting position: 225
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagaauccucacaauaccgca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "ccugcaugacuacugcuca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccugcaugacuacugcuca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2282 " record
Length: 19
GC Content:53 %
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORTxp-1
Incubation Time (Hours):24

Offtargets for "ccugcaugacuacugcuca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17926641
Article:The short hairpin RNA driven by polymerase II suppresses both wild-type and lamivudine-resistant hepatitis B virus strains.
Authors:Ren GL, Fang Y, Ma HH, Lei YF, Wang D, Xu MC, Wang PZ, Huang CX, Nie OH, Sun YT, Bai XF.
Journal:Antivir Ther. 2007;12(6):865-76.
Entrez:17926641

siRNA sequence "augaugugguauugggggccaaguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "augaugugguauugggggccaaguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1471 " record
Length: 25
GC Content:52 %
Incubation Time (Hours):192

Offtargets for "augaugugguauugggggccaaguc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "gcucccgcgugucuuggcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucccgcgugucuuggcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1996 " record
Length: 19
GC Content:74 %
Starting position: 287
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucccgcgugucuuggcc" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "aagaccuagucaguuaug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaccuagucaguuaug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2010 " record
Length: 18
GC Content:39 %
Starting position: 2149
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aagaccuagucaguuaug" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:12951075
Article:Selective inhibition of hepatitis B virus replication by RNA interference.
Authors:Ying C, De Clercq E, Neyts J.
Journal:Biochem Biophys Res Commun. 2003 Sep 19;309(2):482-4. Erratum in: Biochem Biophys Res Commun. 2005 Nov 4;336(4):1300.
Entrez:12951075

siRNA sequence "cuaggaggcuguaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cuaggaggcuguaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1127 " record
Length: 19
GC Content:53 %
Starting position: 1774
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuaggaggcuguaggcaua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gaccgugugcacuucgcuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaccgugugcacuucgcuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1048 " record
Length: 19
GC Content:58 %
Starting position: 203
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaccgugugcacuucgcuu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "uagagucuccggaacauug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uagagucuccggaacauug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1042 " record
Length: 19
GC Content:47 %
Starting position: 2027
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "uagagucuccggaacauug" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17596868
Article:Targeted inhibition of HBV gene expression by single-chain antibody mediated small interfering RNA delivery.
Authors:Wen WH, Liu JY, Qin WJ, Zhao J, Wang T, Jia LT, Meng YL, Gao H, Xue CF, Jin BQ, Yao LB, Chen SY, Yang AG.
Journal:Hepatology. 2007 Jul;46(1):84-94.
Entrez:17596868

siRNA sequence "gcucccgcgugucuuggcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucccgcgugucuuggcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1307 " record
Length: 19
GC Content:74 %
Starting position: 287
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucccgcgugucuuggcc" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "agucuagacucgugguggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agucuagacucgugguggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1952 " record
Length: 21
GC Content:52 %
Starting position: 91
GenBank Acc: HQ641713
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "agucuagacucgugguggacu" siRNA in Human Genome sequences
See HQ641713 at Genbank
Pubmed:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079

siRNA sequence "caucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1675 " record
Length: 19
GC Content:42 %
Starting position: 163
GenBank Acc: FR714498
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caucacaucaggauuccua" siRNA in Human Genome sequences
See FR714498 at Genbank
Pubmed:18685862
Article:Inhibition of hepatitis B virus replication by small interference RNA induces expression of MICA in HepG2.2.15 cells.
Authors:Tang KF, Chen M, Xie J, Song GB, Shi YS, Liu Q, Mei ZC, Steinle A, Ren H.
Journal:Med Microbiol Immunol. 2009 Feb;198(1):27-32. Epub 2008 Aug 7.
Entrez:18685862

siRNA sequence "ccauacugcggaacuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccauacugcggaacuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1123 " record
Length: 19
GC Content:53 %
Starting position: 1267
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccauacugcggaacuccua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1067 " record
Length: 19
GC Content:53 %
Starting position: 460
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1671	cgcccaccgaauguugccc	Hepatitis B Virus [HBV]	X	PLC/PRF/5	RNA	88	16353167	Blast SL	refseqs
virsi1136	uucgcaguccccaaccucc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	86	15378775	Blast SL	refseqs
virsi1148	aaugucaacgaccgaccuuga	Hepatitis B Virus [HBV]	X	HepG2	RNA	86	17334648	Blast SL	refseqs
virsi1161	aagaccuagucaguuaug	Hepatitis B Virus [HBV]	C	HepAD38	DNA	85	12951075	Blast SL	refseqs
virsi1027	aacauggagaacaucacauca	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	85	16111658	Blast SL	refseqs
virsi1149	aaccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	85	16298967	Blast SL	refseqs
virsi1458	gguauguugcccguuugucu	Hepatitis B Virus [HBV]	S	HepG2	Protein	85	16929350	Blast SL	refseqs
virsi1459	gacuacugccucacccaua	Hepatitis B Virus [HBV]	PreS/P	HepG2	RNA	85	14592428	Blast SL	refseqs
virsi1023	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	85	18274934	Blast SL	refseqs
virsi1039	ugucaacgaccgaccuuga	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	84	17596868	Blast SL	refseqs
virsi1146	aaggucuuacauaagaggacu	Hepatitis B Virus [HBV]	X	HepG2	Protein	84	17334648	Blast SL	refseqs
virsi1006	gaauccucacaauaccgca	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	83	18378325	Blast SL	refseqs
virsi1143	aagaauccucacaauaccgca	Hepatitis B Virus [HBV]	S	HepG2	RNA	83	17334648	Blast SL	refseqs
virsi2282	ccugcaugacuacugcuca	Hepatitis B Virus [HBV]	ORF-S	HepG2.2.15	Protein	83	17926641	Blast SL	refseqs
virsi1471	augaugugguauugggggccaaguc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	83	12740585	Blast SL	refseqs
virsi1996	gcucccgcgugucuuggcc	Hepatitis B Virus [HBV]	S	HepG2.2.15	DNA	83	16022904	Blast SL	refseqs
virsi2010	aagaccuagucaguuaug	Hepatitis B Virus [HBV]	C	HepAD79	DNA	82	12951075	Blast SL	refseqs
virsi1127	cuaggaggcuguaggcaua	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	82	19026173	Blast SL	refseqs
virsi1048	gaccgugugcacuucgcuu	Hepatitis B Virus [HBV]	X	LinX	Protein	82	18201553	Blast SL	refseqs
virsi1042	uagagucuccggaacauug	Hepatitis B Virus [HBV]	C	HepG2.2.15	Protein	82	17596868	Blast SL	refseqs
virsi1307	gcucccgcgugucuuggcc	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	82	16022904	Blast SL	refseqs
virsi1952	agucuagacucgugguggacu	Hepatitis B Virus [HBV]	S	Huh-7	mRNA	81	20696079	Blast SL	refseqs
virsi1675	caucacaucaggauuccua	Hepatitis B Virus [HBV]	S	HepG2.2.15	RNA	81	18685862	Blast SL	refseqs
virsi1123	ccauacugcggaacuccua	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	81	19026173	Blast SL	refseqs
virsi1067	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	293T	Protein	81	15756649	Blast SL	refseqs



« previous12345678910next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm