VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Hepadnaviridae are 227
Results from 75 - 100

« previous12345678910next »
siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1956 " record
Length: 19
GC Content:53 %
Starting position: 304
GenBank Acc: HQ641713
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See HQ641713 at Genbank
Pubmed:20801205
Article:Evaluation of cationic nanoparticles of biodegradable copolymers as siRNA delivery system for hepatitis B treatment.
Authors:Wang J, Feng SS, Wang S, Chen ZY.
Journal:Int J Pharm. 2010 Nov 15;400(1-2):194-200. Epub 2010 Aug 27.
Entrez:20801205

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1960 " record
Length: 19
GC Content:53 %
Starting position: 460
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:20642484
Article:Knockdown of HBV surface antigen gene expression by a lentiviral microRNA-based system inhibits HBV replication and HCC growth.
Authors:Xiangji L, Feng X, Qingbao C, Weifeng T, Xiaoqing J, Baihe Z, Feng S, Hongyang W, Mengchao W.
Journal:J Viral Hepat. 2011 Sep;18(9):653-60. doi: 10.1111/j.1365-2893.2010.01346.x. Epub 2010 Jul 19.
Entrez:20642484

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1007 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18378325
Article:Inhibition of hepatitis B virus gene expression and replication by endoribonuclease-prepared siRNA.
Authors:Meng Z, Xu Y, Wu J, Tian Y, Kemper T, Bleekmann B, Roggendorf M, Yang D, Lu M.
Journal:J Virol Methods. 2008 Jun;150(1-2):27-33. Epub 2008 Apr 18.
Entrez:18378325

siRNA sequence "gguggacuucucucaauuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguggacuucucucaauuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1308 " record
Length: 19
GC Content:42 %
Starting position: 258
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gguggacuucucucaauuu" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "uucaccucugcacgucgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uucaccucugcacgucgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1464 " record
Length: 19
GC Content:58 %
Starting position: 1592
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "uucaccucugcacgucgca" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "uucaccucugccuaaucau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uucaccucugccuaaucau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1466 " record
Length: 19
GC Content:42 %
Starting position: 1826
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "uucaccucugccuaaucau" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "uggccaaaauucgcaguccccaacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uggccaaaauucgcaguccccaacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1472 " record
Length: 25
GC Content:56 %
Incubation Time (Hours):192

Offtargets for "uggccaaaauucgcaguccccaacc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "aaggucuuacauaagaggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaggucuuacauaagaggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1124 " record
Length: 21
GC Content:38 %
Starting position: 1646
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aaggucuuacauaagaggacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "uuuggaagagaaaccguua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uuuggaagagaaaccguua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1443 " record
Length: 19
GC Content:37 %
Starting position: 2229
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):168

Offtargets for "uuuggaagagaaaccguua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534

siRNA sequence "cuaaugacucuagcuaccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cuaaugacucuagcuaccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2286 " record
Length: 19
GC Content:42 %
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORTxp-1
Incubation Time (Hours):24

Offtargets for "cuaaugacucuagcuaccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17926641
Article:The short hairpin RNA driven by polymerase II suppresses both wild-type and lamivudine-resistant hepatitis B virus strains.
Authors:Ren GL, Fang Y, Ma HH, Lei YF, Wang D, Xu MC, Wang PZ, Huang CX, Nie OH, Sun YT, Bai XF.
Journal:Antivir Ther. 2007;12(6):865-76.
Entrez:17926641

siRNA sequence "aaguucaggcaacucuugugg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaguucaggcaacucuugugg" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1141 " record
Length: 21
GC Content:48 %
Starting position: 2188
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aaguucaggcaacucuugugg" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "aagaggacucuuggacucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaggacucuuggacucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1147 " record
Length: 21
GC Content:48 %
Starting position: 1658
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagaggacucuuggacucucu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "gcacuucgcuucaccucugca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcacuucgcuucaccucugca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1954 " record
Length: 21
GC Content:57 %
Starting position: 1526
GenBank Acc: FJ589068
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gcacuucgcuucaccucugca" siRNA in Human Genome sequences
See FJ589068 at Genbank
Pubmed:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079

siRNA sequence "gguggacuucucucaauuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguggacuucucucaauuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2011 " record
Length: 19
GC Content:42 %
Starting position: 258
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gguggacuucucucaauuu" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "ccgugaacgcccaccgaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccgugaacgcccaccgaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1052 " record
Length: 19
GC Content:63 %
Starting position: 248
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccgugaacgcccaccgaau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "gggaggagauuagauuaaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gggaggagauuagauuaaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1056 " record
Length: 19
GC Content:37 %
Starting position: 374
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gggaggagauuagauuaaa" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "acccuuauaaagaauuugg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "acccuuauaaagaauuugg" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1094 " record
Length: 19
GC Content:32 %
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):168

Offtargets for "acccuuauaaagaauuugg" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:14512871
Article:Inhibition of HBV replication by siRNA in a stable HBV-producing cell line.
Authors:Konishi M, Wu CH, Wu GY.
Journal:Hepatology. 2003 Oct;38(4):842-50.
Entrez:14512871

siRNA sequence "gucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1077 " record
Length: 19
GC Content:47 %
Starting position: 767
Transfection Reagent: Polymer Polyethylenimine (PEI)
Incubation Time (Hours):48

Offtargets for "gucuguacagcaucuugag" siRNA in Human Genome sequences
See at Genbank
Pubmed:15756649
Article:Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors.
Authors:Moore MD, McGarvey MJ, Russell RA, Cullen BR, McClure MO.
Journal:J Gene Med. 2005 Jul;7(7):918-25.
Entrez:15756649

siRNA sequence "aaagcucaucggaacugacaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaagcucaucggaacugacaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1957 " record
Length: 22
GC Content:41 %
Starting position: 1317
Strain of Virus: adw
GenBank Acc: AM282986
Transfection Reagent: FuGENE
Incubation Time (Hours):48

Offtargets for "aaagcucaucggaacugacaau" siRNA in Human Genome sequences
See AM282986 at Genbank
Pubmed:20822550
Article:Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element.
Authors:Panjaworayan N, Payungporn S, Poovorawan Y, Brown CM.
Journal:Virol J. 2010 Sep 8;7:216.
Entrez:20822550

siRNA sequence "cgaccgaccuugaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgaccgaccuugaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1054 " record
Length: 19
GC Content:58 %
Starting position: 317
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgaccgaccuugaggcaua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "agaagaucucaaucucgggaaucuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agaagaucucaaucucgggaaucuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1474 " record
Length: 25
GC Content:44 %
Incubation Time (Hours):192

Offtargets for "agaagaucucaaucucgggaaucuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "gcaaugucaacgaccgacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcaaugucaacgaccgacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1313 " record
Length: 19
GC Content:58 %
Starting position: 1679
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcaaugucaacgaccgacc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "gucuguacaacaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacaacaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1090 " record
Length: 19
GC Content:42 %
Starting position: 765
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "gucuguacaacaucuugag" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15754419
Article:Combination of small interfering RNAs mediates greater inhibition of human hepatitis B virus replication and antigen expression.
Authors:Chen Z, Xu ZF, Ye JJ, Yao HP, Zheng S, Ding JY.
Journal:J Zhejiang Univ Sci B. 2005 Apr;6(4):236-41.
Entrez:15754419

siRNA sequence "aagaucucaaucucgggaauc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaucucaaucucgggaauc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1016 " record
Length: 21
GC Content:43 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "aagaucucaaucucgggaauc" siRNA in Human Genome sequences
See at Genbank
Pubmed:17300745
Article:Inhibition of Hepatitis B virus cccDNA replication by siRNA.
Authors:Li GQ, Gu HX, Li D, Xu WZ.
Journal:Biochem Biophys Res Commun. 2007 Apr 6;355(2):404-8. Epub 2007 Feb 6.
Entrez:17300745

siRNA sequence "gacuaccaagguauguugc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gacuaccaagguauguugc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1461 " record
Length: 19
GC Content:47 %
Starting position: 451
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gacuaccaagguauguugc" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1956	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	PLC/PRF/5	Protein	80	20801205	Blast SL	refseqs
virsi1960	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	293T	Protein	80	20642484	Blast SL	refseqs
virsi1007	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	80	18378325	Blast SL	refseqs
virsi1308	gguggacuucucucaauuu	Hepatitis B Virus [HBV]	S	BEL-7402	Protein	80	16022904	Blast SL	refseqs
virsi1464	uucaccucugcacgucgca	Hepatitis B Virus [HBV]	X	HepG2	RNA	80	14592428	Blast SL	refseqs
virsi1466	uucaccucugccuaaucau	Hepatitis B Virus [HBV]	X	HepG2	RNA	80	14592428	Blast SL	refseqs
virsi1472	uggccaaaauucgcaguccccaacc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	80	12740585	Blast SL	refseqs
virsi1124	aaggucuuacauaagaggacu	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	79	19026173	Blast SL	refseqs
virsi1443	uuuggaagagaaaccguua	Hepatitis B Virus [HBV]	C	HepG2.2.15	Viral Load	79	17245534	Blast SL	refseqs
virsi2286	cuaaugacucuagcuaccu	Hepatitis B Virus [HBV]	ORF-C	HepG2.2.15	Protein	79	17926641	Blast SL	refseqs
virsi1141	aaguucaggcaacucuugugg	Hepatitis B Virus [HBV]	C	HepG2	RNA	79	17334648	Blast SL	refseqs
virsi1147	aagaggacucuuggacucucu	Hepatitis B Virus [HBV]	X	HepG2	RNA	79	17334648	Blast SL	refseqs
virsi1954	gcacuucgcuucaccucugca	Hepatitis B Virus [HBV]	S	Huh-7	mRNA	79	20696079	Blast SL	refseqs
virsi2011	gguggacuucucucaauuu	Hepatitis B Virus [HBV]	S	HepG2.2.15	DNA	78	16022904	Blast SL	refseqs
virsi1052	ccgugaacgcccaccgaau	Hepatitis B Virus [HBV]	X	LinX	Protein	78	18201553	Blast SL	refseqs
virsi1056	gggaggagauuagauuaaa	Hepatitis B Virus [HBV]	X	LinX	Protein	78	18201553	Blast SL	refseqs
virsi1094	acccuuauaaagaauuugg	Hepatitis B Virus [HBV]	PA	HepG2.2.15	Protein	78	14512871	Blast SL	refseqs
virsi1077	gucuguacagcaucuugag	Hepatitis B Virus [HBV]	S	293T	Protein	78	15756649	Blast SL	refseqs
virsi1957	aaagcucaucggaacugacaau	Hepatitis B Virus [HBV]	PRE	COS-7	Protein	77	20822550	Blast SL	refseqs
virsi1054	cgaccgaccuugaggcaua	Hepatitis B Virus [HBV]	X	LinX	Protein	77	18201553	Blast SL	refseqs
virsi1474	agaagaucucaaucucgggaaucuc	Hepatitis B Virus [HBV]	C/P	Huh-7	Protein	77	12740585	Blast SL	refseqs
virsi1313	gcaaugucaacgaccgacc	Hepatitis B Virus [HBV]	X	BEL-7402	Protein	77	16022904	Blast SL	refseqs
virsi1090	gucuguacaacaucuugag	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	76	15754419	Blast SL	refseqs
virsi1016	aagaucucaaucucgggaauc	Hepatitis B Virus [HBV]	P	HepG2.2.15	RNA	76	17300745	Blast SL	refseqs
virsi1461	gacuaccaagguauguugc	Hepatitis B Virus [HBV]	P/S	HepG2	RNA	76	14592428	Blast SL	refseqs



« previous12345678910next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm